ID: 1141167093

View in Genome Browser
Species Human (GRCh38)
Location 16:81668236-81668258
Sequence GTTTATGGAGGGTCGGGGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 266}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141167081_1141167093 1 Left 1141167081 16:81668212-81668234 CCCCTCCGTGGTCAGCCACATCA 0: 1
1: 0
2: 1
3: 8
4: 111
Right 1141167093 16:81668236-81668258 GTTTATGGAGGGTCGGGGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 266
1141167080_1141167093 8 Left 1141167080 16:81668205-81668227 CCAGGCTCCCCTCCGTGGTCAGC 0: 1
1: 0
2: 1
3: 15
4: 196
Right 1141167093 16:81668236-81668258 GTTTATGGAGGGTCGGGGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 266
1141167084_1141167093 -4 Left 1141167084 16:81668217-81668239 CCGTGGTCAGCCACATCACGTTT 0: 1
1: 0
2: 0
3: 7
4: 113
Right 1141167093 16:81668236-81668258 GTTTATGGAGGGTCGGGGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 266
1141167083_1141167093 -1 Left 1141167083 16:81668214-81668236 CCTCCGTGGTCAGCCACATCACG 0: 1
1: 0
2: 1
3: 6
4: 98
Right 1141167093 16:81668236-81668258 GTTTATGGAGGGTCGGGGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 266
1141167082_1141167093 0 Left 1141167082 16:81668213-81668235 CCCTCCGTGGTCAGCCACATCAC 0: 1
1: 0
2: 0
3: 7
4: 88
Right 1141167093 16:81668236-81668258 GTTTATGGAGGGTCGGGGGCAGG 0: 1
1: 0
2: 0
3: 21
4: 266

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141167093 Original CRISPR GTTTATGGAGGGTCGGGGGC AGG Intronic
900204858 1:1427466-1427488 GGTGATGGAGGGGAGGGGGCTGG - Intronic
900204870 1:1427493-1427515 GGTAATGGAGGGCTGGGGGCAGG - Intronic
900388691 1:2423570-2423592 GATTATGGAGGGTGAGGGGCTGG + Intergenic
901024164 1:6270292-6270314 TTTAATGGAGGGTTGGGGGTGGG + Intronic
903455505 1:23484260-23484282 GCGGCTGGAGGGTCGGGGGCGGG - Intronic
907756725 1:57317826-57317848 GTTGAGGGAGGGTGGGAGGCAGG - Intronic
907998608 1:59657826-59657848 GTTTAGGGATGGTGGAGGGCAGG + Intronic
908280637 1:62530973-62530995 GTATAGGGAGGGTCGGTGGGTGG + Intronic
910620047 1:89243642-89243664 CTTGTTGGAGGGTAGGGGGCTGG - Intergenic
912475048 1:109929673-109929695 GCTCATGGATGGACGGGGGCAGG - Exonic
912536870 1:110380618-110380640 GTTTTTGATGGGGCGGGGGCGGG + Intronic
912955528 1:114152533-114152555 ATATCTGGAGGGTCCGGGGCGGG - Intronic
913480606 1:119285673-119285695 GATTATGGAGGGTGAGGGGCTGG - Intergenic
915489511 1:156243342-156243364 GTTTATGGAGTGTGGGAGGGAGG + Intronic
915725584 1:158014675-158014697 CTTTATGGGGGGGGGGGGGCGGG + Intronic
916212443 1:162369875-162369897 CCTGATGGAGGGTCGGTGGCTGG - Exonic
917440494 1:175064508-175064530 GTTTCTGGAGGATTTGGGGCAGG + Intergenic
917720182 1:177779724-177779746 GTTTAGAGAGGGCCCGGGGCTGG - Intergenic
917835869 1:178941319-178941341 GTTTAGGGAAGGTAGGAGGCTGG - Intergenic
919350912 1:196452811-196452833 GTTAGTGGAGGGTCTGGGGAGGG + Intronic
921065749 1:211621016-211621038 GCTTATGGGGTGGCGGGGGCGGG - Intergenic
921268296 1:213444315-213444337 GTTTGTGGCAGGTGGGGGGCGGG + Intergenic
921794437 1:219326290-219326312 GTTTTTGGTGGGTGGGGGGTTGG + Intergenic
922129308 1:222761066-222761088 GTTTGTGGAGGGTTTGGTGCAGG - Intergenic
922702432 1:227769702-227769724 GGTTGTGGAGGGTGGAGGGCCGG + Intronic
1062883247 10:995654-995676 GTACATGCAGGGTCGGGGGCTGG + Intronic
1063547505 10:6996695-6996717 GTTTATGTAGGGTGGGAGGCGGG - Intergenic
1064778899 10:18810896-18810918 GTTGGTGGGGGGTGGGGGGCTGG + Intergenic
1065484992 10:26228807-26228829 ACATATGGAAGGTCGGGGGCTGG - Intronic
1065706830 10:28478313-28478335 GTTGTTGGGGGGTGGGGGGCAGG - Intergenic
1065874250 10:29983336-29983358 GATCATGGAGGGTGAGGGGCTGG + Intergenic
1066434723 10:35386861-35386883 TTTTATGGAGGGGTGGGGGATGG + Intronic
1066640572 10:37550905-37550927 GGCTATGGAGGGACGGGGACTGG - Intergenic
1067042716 10:42963525-42963547 GGTTATGGAGGGGCTGGGGAGGG - Intergenic
1067405752 10:46022172-46022194 GTCTTTGGAGGGGCAGGGGCAGG - Intronic
1068083231 10:52346320-52346342 TTTTTTGGGGGGTGGGGGGCGGG - Intergenic
1068346049 10:55779640-55779662 TTTTTTGGAGGGTGGGGGACAGG + Intergenic
1069495823 10:68902174-68902196 TTTTTTGGAGGGCAGGGGGCTGG - Intronic
1070681504 10:78452241-78452263 GTTTTGGGAGGGTAGGGGGAAGG + Intergenic
1071623924 10:87148553-87148575 GTTTGTGGGGGGGCGGGGGTTGG + Intronic
1072583067 10:96757047-96757069 GCTTATGGAGTGTTGTGGGCAGG - Intergenic
1075628699 10:123985924-123985946 GATTATGGAGGATGAGGGGCTGG + Intergenic
1077048306 11:555674-555696 GTTTCTGCTGGGTCGGGGCCTGG + Intronic
1077674897 11:4187205-4187227 GTTTTTGGAGGGGCCGGGGAGGG + Intergenic
1078520088 11:12056019-12056041 TTTTTTGGGGGGTGGGGGGCAGG - Intergenic
1078865362 11:15292368-15292390 GTTTATGGAGAATATGGGGCAGG + Intergenic
1079036055 11:17021129-17021151 GATTGTGGAGGGTGAGGGGCTGG - Intergenic
1080616443 11:33948797-33948819 GTTTCTGGAGGGTGGGGACCAGG - Intergenic
1081737171 11:45412152-45412174 AATTATGGAGGCTCGGGGACTGG - Intergenic
1084082186 11:66835017-66835039 GTTTCCGGCGGGTCGGGGGAGGG + Intronic
1084164326 11:67367944-67367966 GTACATGGAGGGACGGGGCCAGG + Intronic
1084590651 11:70088106-70088128 GTTTGTGGGGGGTGGGGGGTGGG + Intronic
1086043859 11:82510106-82510128 GTTTATGGATGGTCAGAGGTAGG + Intergenic
1089125647 11:116174678-116174700 GCTTATGGATGGTCAGGGGAGGG - Intergenic
1089581650 11:119485199-119485221 GTATTTGGAGGGTTGGCGGCAGG - Intergenic
1089950843 11:122524643-122524665 TTTAATGGAGGGTTGGGGGTTGG + Intergenic
1090279669 11:125445157-125445179 GTTCATGGAGGGCCGCGGGAAGG + Intergenic
1091787845 12:3253722-3253744 TTTTATTGAGGGTGGGAGGCTGG + Intronic
1096642741 12:53006982-53007004 GTTGGTGGAGGGGCGGGGGAAGG + Intronic
1097289966 12:57906370-57906392 GGTTATGGGGGGTGGGGTGCAGG + Intergenic
1098950549 12:76636492-76636514 GGTCATGGAGGGTGAGGGGCTGG + Intergenic
1102895857 12:116598111-116598133 GTTTATGGAGGGCAGGGGACAGG + Intergenic
1104001771 12:124864449-124864471 GTGTATGGAGGCCCTGGGGCTGG - Intronic
1104218913 12:126762994-126763016 GTTCATGGAGGTTGAGGGGCTGG - Intergenic
1105964316 13:25371538-25371560 GGTTGTGGAGAGTGGGGGGCTGG + Intergenic
1107085052 13:36418286-36418308 GATTATGGAGAGTAAGGGGCTGG - Intergenic
1109299045 13:60571726-60571748 GTGTGTGGAGGGTTGGGGGAAGG - Intronic
1111167082 13:84473731-84473753 GACTGGGGAGGGTCGGGGGCAGG - Intergenic
1111968235 13:94882794-94882816 GTGTTTGGGGGGTGGGGGGCGGG - Intergenic
1112776812 13:102852841-102852863 GTTTTTGGAAGGCCGGGGGCAGG + Intronic
1112923369 13:104642851-104642873 TTTGATGGAGTGTCTGGGGCAGG - Intergenic
1113312953 13:109150040-109150062 ATTTCTGGTGGGTCTGGGGCAGG - Intronic
1113882451 13:113635299-113635321 GGTGATGGAGGCTCGTGGGCAGG + Intronic
1114259165 14:21025154-21025176 GTTTACTGGGGGTCTGGGGCGGG - Intronic
1116233513 14:42248303-42248325 GATTATGGAGGGTGAGGAGCTGG + Intergenic
1120103246 14:80467687-80467709 GGTTATGGAGGGCTGGGGGAGGG - Intergenic
1122316055 14:100826709-100826731 GTTTTTGGTGGATCGTGGGCGGG + Intergenic
1122541671 14:102501173-102501195 GCTTAAGGAGCGGCGGGGGCGGG + Exonic
1122889493 14:104725786-104725808 GTCTAAGGAGGGTCAGGGGCCGG - Intronic
1124217249 15:27817596-27817618 GATCATGGAGGGTGAGGGGCTGG - Intronic
1125082399 15:35690494-35690516 GTATGTAGAGGGTCGGGGGAAGG + Intergenic
1125544640 15:40494114-40494136 TTCTATGGAGTGACGGGGGCTGG - Intergenic
1127632865 15:60842692-60842714 CTGTGTGGAGGGTCGGGGGAGGG - Intronic
1128004144 15:64222276-64222298 GTGGATGGGGGGTCGGGGGAGGG + Intronic
1128550635 15:68596009-68596031 GAGTGTGGAGGGTCGGGGGCTGG + Intronic
1129309426 15:74695834-74695856 GTTTGTGGACGGTCGTGGGAGGG - Intronic
1129385416 15:75193546-75193568 GAGTGTGGAGGGGCGGGGGCAGG - Intergenic
1129857482 15:78834962-78834984 TTTTTTGGAGGGTGGGGGACAGG - Intronic
1130072892 15:80664004-80664026 GATTATGGGGGGTGGGGGGTGGG + Intergenic
1130688969 15:86063887-86063909 GTTGCTGGAGGGTGGGGGGCGGG + Intergenic
1130689868 15:86072905-86072927 GATCATGGAGGGTGAGGGGCTGG - Intergenic
1130986996 15:88851114-88851136 GTTCACGGAGGGTCAGGGGTGGG - Intronic
1131692726 15:94844815-94844837 GCTTTTGGAGGGTGGGCGGCCGG + Intergenic
1131830944 15:96354288-96354310 GGGGATGGAGGGGCGGGGGCGGG - Intergenic
1132178904 15:99736654-99736676 GAATTTGGAGGGTCTGGGGCTGG + Intergenic
1132724297 16:1332234-1332256 GTCTGTGCAGGATCGGGGGCAGG - Intergenic
1133846007 16:9454505-9454527 GATTATGGAGGCTGAGGGGCTGG - Intergenic
1133981301 16:10635173-10635195 GTTTGTGGGGGGTGGGGGGTGGG - Intronic
1135324390 16:21517023-21517045 GTCTACGGGGGGTCGGGGGGTGG + Intergenic
1136313174 16:29429463-29429485 GTGTATGGTGGATCGGGGGTAGG - Intergenic
1139841389 16:69883723-69883745 GTTTTTGCAGGGTGGGGTGCGGG - Intronic
1139850763 16:69950681-69950703 GTCTGGGCAGGGTCGGGGGCTGG - Intergenic
1139879747 16:70173593-70173615 GTCTGGGCAGGGTCGGGGGCTGG - Intronic
1140372777 16:74421955-74421977 GTCTGGGCAGGGTCGGGGGCTGG + Intergenic
1141167093 16:81668236-81668258 GTTTATGGAGGGTCGGGGGCAGG + Intronic
1141828601 16:86497472-86497494 CTGAATGGAGGGGCGGGGGCGGG - Intergenic
1142312000 16:89319615-89319637 GTTCATGGAGAGGCGGGGGCTGG - Intronic
1143116730 17:4585377-4585399 GTGAATGGAGGGTGGGGGTCAGG - Intronic
1145214492 17:21042176-21042198 GGTTCTGGAGGGTTCGGGGCTGG - Intronic
1146229598 17:31095617-31095639 GGGGATGGAGGGTCGGAGGCTGG - Intronic
1146607697 17:34275434-34275456 CCTTTTGGAGGGTGGGGGGCTGG - Intergenic
1147239358 17:39080409-39080431 GGTCATGGCGGGGCGGGGGCAGG + Intronic
1147966351 17:44196256-44196278 GTCTTTGGTGGGTCCGGGGCGGG - Intronic
1148414050 17:47492406-47492428 GTTTATCGAGGGTTTTGGGCTGG - Intergenic
1148438288 17:47698700-47698722 GTGCAGGGAGGGGCGGGGGCTGG - Exonic
1151395813 17:73822210-73822232 GTTCATGCAGGGTGGGGGCCTGG - Intergenic
1151898124 17:76994087-76994109 GTTTTCGGAGAGTCGGGGACAGG + Intergenic
1152798424 17:82320082-82320104 GTTTATGGAGAGCCTGGGGGAGG - Intergenic
1156260489 18:35441150-35441172 GTTTATGGAGGGAGTGGTGCAGG - Intergenic
1157469360 18:47976705-47976727 GTGTGTGGAGGGGCGGGGGTGGG + Intergenic
1157899906 18:51504840-51504862 GATAATGGAGGGTTTGGGGCTGG + Intergenic
1158458928 18:57630782-57630804 TTTTATAGAGGGGCGGGGGCGGG - Intergenic
1159161345 18:64646719-64646741 GTTTATGGGTGGTCATGGGCAGG + Intergenic
1160206904 18:76842196-76842218 CTTTATGGGGGGTGGGGGGAAGG - Intronic
1160551741 18:79697734-79697756 GTCCATGGAGCGTGGGGGGCTGG + Intronic
1161101304 19:2423455-2423477 GTTGGTGGGGGGTGGGGGGCGGG + Intronic
1161596791 19:5154665-5154687 GTCTGTGGTGGGACGGGGGCTGG + Intergenic
1162473937 19:10888637-10888659 GGTTGTGGAGGGTAGGGGGTGGG - Intronic
1163100409 19:15092382-15092404 GTTTAAGGAGGATAGGGGGTGGG + Intergenic
1166375615 19:42325459-42325481 CTTTATGGAGGGTTGGGGTTGGG + Intergenic
1166542787 19:43616685-43616707 GTTTATAGAGGGGCAGGGGTGGG - Intronic
1166789814 19:45392071-45392093 GTTTCTTGTGGGTAGGGGGCAGG + Exonic
1166854960 19:45778813-45778835 TTTTTTTGAGGGGCGGGGGCGGG - Intronic
1167172650 19:47843479-47843501 ATTTATGAAGGATCAGGGGCTGG + Intergenic
1167606921 19:50486177-50486199 TTTTTTGGTGGGTGGGGGGCAGG + Exonic
926317023 2:11717486-11717508 GTGTTTGGAGGGTGGGGGGATGG - Intronic
927022199 2:19029010-19029032 GACTGTGGAGGGGCGGGGGCGGG - Intergenic
930380307 2:50619865-50619887 GTTTATGTAGGATTGGGGGAGGG - Intronic
930702213 2:54469682-54469704 GTTAGAGGAGGGTAGGGGGCTGG + Intronic
932841293 2:75085272-75085294 GATCATGGAGGGTAAGGGGCTGG - Intronic
934750367 2:96789942-96789964 CATTTTGGAGGGCCGGGGGCGGG - Intronic
935624039 2:105154233-105154255 GTTTATGGAAGGTCAGGGAATGG + Intergenic
937359221 2:121217509-121217531 CCTTATGGAGGGCCGGGGGGCGG + Exonic
937816487 2:126256500-126256522 GATCATGGAGGGTGAGGGGCTGG - Intergenic
942051500 2:172145208-172145230 GTTGGTGGAGGATGGGGGGCTGG - Intergenic
942206443 2:173624498-173624520 GTTTAGTGAGAGTCGGGAGCTGG - Intergenic
944543937 2:200780577-200780599 GTTTCTAGAGGGTAGGGGCCAGG - Intergenic
945338583 2:208622141-208622163 CTGTAAGGAGGGTCGGGGGAGGG - Intronic
949040305 2:241844999-241845021 GCTGATGGAGGCTCCGGGGCGGG + Intergenic
1168799397 20:634602-634624 GTCTGTGGAGGGTGGGGAGCGGG + Intergenic
1169562507 20:6817264-6817286 CCTTTTGGAGGGTGGGGGGCTGG + Intergenic
1171767415 20:29297772-29297794 GCTTCTCGAGGGTAGGGGGCCGG - Intergenic
1172007343 20:31826537-31826559 GGGTATGGAGGGTGGGTGGCAGG + Intronic
1172121628 20:32602255-32602277 TGTTATGGAGGGTGGGTGGCAGG - Intronic
1173413475 20:42836242-42836264 GTGGATGGAGGGTCTGGGGTGGG - Intronic
1173528315 20:43749787-43749809 GTCTCTGGAGGGTCAGGGACTGG + Intergenic
1173684014 20:44910127-44910149 GTTCATGGTGGGCAGGGGGCCGG - Exonic
1174263028 20:49311155-49311177 GGTTATGGAGGGCTGGGTGCAGG + Intergenic
1176548510 21:8212002-8212024 GCGTCTCGAGGGTCGGGGGCCGG + Intergenic
1176556404 21:8256210-8256232 GCGTCTCGAGGGTCGGGGGCCGG + Intergenic
1176567441 21:8395037-8395059 GCGTCTCGAGGGTCGGGGGCCGG + Intergenic
1176575343 21:8439252-8439274 GCGTCTCGAGGGTCGGGGGCCGG + Intergenic
1177401428 21:20610634-20610656 GGTAATGGAGGGTTGGGGGGAGG + Intergenic
1183285290 22:36958897-36958919 GTTTGTGGGGGGTTGGGGGTGGG - Intergenic
1184485286 22:44774823-44774845 TTTTTTGGAGGGGTGGGGGCGGG + Intronic
1184944415 22:47792822-47792844 GTGGATGGAGGGTCGGGGGAGGG + Intergenic
1185205954 22:49538900-49538922 CATGATGGAGGGTAGGGGGCAGG - Intronic
1203253394 22_KI270733v1_random:128307-128329 GCGTCTCGAGGGTCGGGGGCCGG + Intergenic
1203261448 22_KI270733v1_random:173385-173407 GCGTCTCGAGGGTCGGGGGCCGG + Intergenic
953716182 3:45318916-45318938 GTTGATGTAGGGCGGGGGGCGGG - Intergenic
954260901 3:49438131-49438153 GTTTTTGGAGAGTCAGGGTCTGG - Intergenic
954745443 3:52785118-52785140 GTTTATGGTGGTTCTGGGTCAGG - Exonic
954811096 3:53248621-53248643 TTTTTTGGGGGGTGGGGGGCAGG - Intronic
955909217 3:63843080-63843102 GTTTTTGGAGGGGTTGGGGCAGG - Intronic
958689898 3:97450954-97450976 GTTTCTGGAGGGTGAGAGGCTGG + Intronic
958707250 3:97671327-97671349 GTTCATGAAGGGTGGGGGACAGG + Intronic
961077863 3:123998381-123998403 GCATATGGAGGGTAGGGGCCAGG + Intergenic
961306707 3:125962954-125962976 GCATATGGAGGGTAGGGGCCAGG - Intergenic
961543801 3:127618270-127618292 GGTTATGTAGGGTGGGGGTCGGG - Intronic
962202607 3:133414066-133414088 GTTTGTGGAGGGGAGAGGGCAGG - Intronic
962202951 3:133415373-133415395 GTTTGTGGAGGGGAGAGGGCAGG - Intronic
962595664 3:136941129-136941151 TTTTTTGGAGGGTGGGGGTCAGG + Intronic
964083601 3:152789572-152789594 GGTTGTGGAGGGGCGGGGGTGGG + Intergenic
965505452 3:169510231-169510253 GGATGTGAAGGGTCGGGGGCAGG + Intronic
968572406 4:1348831-1348853 GTTTATGTGGGGTCAGGAGCTGG + Intronic
969451634 4:7277128-7277150 GTGTATGGAGGGTGGGTGGGTGG + Intronic
970008007 4:11428796-11428818 GTTTCTGGATGGCCCGGGGCAGG + Exonic
970061831 4:12042281-12042303 AGTGATGGAGGGTTGGGGGCTGG - Intergenic
971272328 4:25161555-25161577 ATTTGTGGAGGGTGAGGGGCTGG - Intronic
972015362 4:34236515-34236537 GTTTCTGGAGGCTTGGGGGAGGG + Intergenic
972844750 4:42974189-42974211 GATCATGGAGGGTAGGGGGCTGG + Intronic
973861414 4:55068906-55068928 GTTTATGGAGGATAGAAGGCAGG - Intergenic
974480541 4:62437592-62437614 GATTATGGAGGGTGAGGGCCTGG + Intergenic
980055721 4:128077501-128077523 TTTTTTGCAGGGGCGGGGGCGGG - Intronic
981721509 4:147806487-147806509 GTTTTTGGGGGGGCGGGGGATGG + Intronic
983218882 4:165025836-165025858 ATTTTTGGAGGGTGGGGGACAGG + Intergenic
983451568 4:167918223-167918245 GATCATGGAGGGTAAGGGGCTGG + Intergenic
983953862 4:173674674-173674696 GATTCTGGGGGGTTGGGGGCGGG - Intergenic
984528226 4:180882689-180882711 GTGTGTGGGGGGTTGGGGGCAGG - Intergenic
987234324 5:15928032-15928054 GTGTGAGGCGGGTCGGGGGCGGG - Exonic
989673307 5:43945689-43945711 GATTTTGGAGGGTCCGGGGATGG - Intergenic
989822062 5:45804977-45804999 CTTATTGGAGGGTCGGGGGGTGG - Intergenic
990888734 5:60624892-60624914 CTGTGTGGGGGGTCGGGGGCAGG - Intronic
992172653 5:74119728-74119750 GATTCTGGAGGGTTGGGTGCTGG - Intergenic
993151230 5:84164901-84164923 GTTTTTGGAGGATCTGGGCCTGG + Intronic
994074652 5:95636914-95636936 GTATATGAAAGGTTGGGGGCAGG + Intergenic
994654571 5:102574880-102574902 GTTACTGGAGGGTTGGGGGTGGG - Intergenic
995971840 5:117982150-117982172 TTTTATGGAGGGTAGGAGGAGGG + Intergenic
997435809 5:133874248-133874270 TTTTATGGAGGGTGAGGGGCTGG + Intergenic
999475502 5:151894544-151894566 GTTTATGGGGGGTAGTGGGGTGG - Intronic
1001762309 5:174218442-174218464 GATTATGGAGGATGGGGAGCTGG - Intronic
1002304614 5:178275858-178275880 GATCATGGAGGGTGAGGGGCTGG - Intronic
1002422980 5:179159285-179159307 GTTTTGGGAGGGTCCGTGGCAGG + Intronic
1002991830 6:2245596-2245618 GTGCAGGGAGGGCCGGGGGCGGG + Exonic
1003349160 6:5299682-5299704 CTTCTTGGAGGGTGGGGGGCTGG - Intronic
1004893493 6:20124228-20124250 GTTTATGGAGGGTGGGAGAGAGG + Intronic
1006376316 6:33673499-33673521 CTTTATGGGGGGCAGGGGGCAGG - Intronic
1007450678 6:41939042-41939064 GTTTTTGGAGGGGTTGGGGCTGG - Intronic
1007465022 6:42045813-42045835 GTTTAGGGAGGGCTGGGGGTGGG - Intronic
1008374209 6:50772966-50772988 TTTTATGGAGGGTTGGGGAAGGG - Exonic
1014383173 6:120769342-120769364 GCTTATGGAAGGCTGGGGGCTGG + Intergenic
1016434995 6:144027039-144027061 GTTTTTGTAGAGTCGGGGGGTGG - Intronic
1016820381 6:148341454-148341476 GTTTTTGGCGGGTGCGGGGCTGG - Intronic
1017358932 6:153543191-153543213 GATCATGGAGGGTGAGGGGCTGG - Intergenic
1017956778 6:159185055-159185077 TTATATGGAGGGTGGGGGGGGGG + Intronic
1018091658 6:160350834-160350856 AATGATGGAGGGTCAGGGGCTGG + Intronic
1018438630 6:163787781-163787803 GTTTCTGGAGGGGTGGGGGTAGG + Intergenic
1019052085 6:169191707-169191729 GTTTATGCAGGGTTGGGGCAGGG - Intergenic
1019553190 7:1614156-1614178 GATCATGGAGGGTGAGGGGCTGG - Intergenic
1019731486 7:2631882-2631904 GCCAATGGAGGCTCGGGGGCGGG + Intergenic
1021276137 7:18653902-18653924 GTGGATGGAGGGTTGGGGACAGG - Intronic
1025209576 7:57013121-57013143 GTTTGTGCATGGACGGGGGCTGG - Intergenic
1026100658 7:67382042-67382064 GTTTCTGGAGGGTTGGGGACTGG + Intergenic
1027781640 7:82527736-82527758 GATTATGGAGAGTGAGGGGCTGG + Intergenic
1028580641 7:92406270-92406292 GGTTAGGGATGGTGGGGGGCAGG + Intergenic
1029111143 7:98213562-98213584 GGTTGTGGAGGGTCTGGGGCAGG + Intergenic
1030540087 7:110819282-110819304 GTTTGGGGAGGTTCGGAGGCTGG + Intronic
1031134133 7:117867537-117867559 GTATATGGTGGGGTGGGGGCAGG - Intronic
1032417450 7:131747323-131747345 GTGTATGGAGGGGTGGGGGATGG + Intergenic
1035339678 7:158152245-158152267 GAGTATGAAGGATCGGGGGCTGG + Intronic
1039398232 8:37245735-37245757 GTTTATTGACGGTTGGGGGCAGG + Intergenic
1039575861 8:38623625-38623647 TTCTTTGGTGGGTCGGGGGCTGG - Intergenic
1041297467 8:56373544-56373566 ATTTCTGGAGGGTAGGGGCCAGG + Intergenic
1041526865 8:58816015-58816037 GTTTGTGGAGGGTGGGGGACGGG + Intronic
1042173179 8:66012212-66012234 GTTGATGGGGGGTCGGGGGGAGG + Intergenic
1042186714 8:66142998-66143020 TTTTTTGGAGGGTTGGTGGCAGG + Intronic
1042992187 8:74654307-74654329 GATTATGGAGGGAAGGAGGCAGG + Intronic
1046617293 8:116491247-116491269 GTTTATGAAGGGTTGGGGGATGG - Intergenic
1049225339 8:141448080-141448102 GTTCATGGCCTGTCGGGGGCAGG + Intergenic
1049527797 8:143137390-143137412 GTTTTTGTAGGGACGGGGTCTGG - Intergenic
1049735584 8:144202972-144202994 GTCTGTGGAGGGGCGGGGGGGGG + Intronic
1049735599 8:144203006-144203028 GTCTGTGGAGGGGCGGGGGGGGG + Intronic
1049735613 8:144203039-144203061 GTCTGTGGAGGGGCGGGGGGGGG + Intronic
1049735643 8:144203109-144203131 GTCTGTGGAGGGGCGGGGGAGGG + Intronic
1049735658 8:144203143-144203165 GTCTGTGGAGGGGCGGGGGGGGG + Intronic
1049735674 8:144203178-144203200 GTCTGTGGAGGGGCGGGGGGGGG + Intronic
1049735688 8:144203211-144203233 GTCTGTGGAGGGGCGGGGGGGGG + Intronic
1049735702 8:144203244-144203266 GTCTGTGGAGGGGCGGGGGGGGG + Intronic
1051340857 9:16109082-16109104 GATTATGGTGTGGCGGGGGCGGG + Intergenic
1053416938 9:37952783-37952805 GTTTATGGAGGTGCGGAAGCTGG + Intronic
1057015507 9:91647483-91647505 GTTTGTGCAGGGGCTGGGGCGGG - Intronic
1059133552 9:111781191-111781213 GTTGATTGAGGGGCGGGGGTAGG - Intronic
1059354411 9:113687844-113687866 GTTTATGGAGAGCCCAGGGCAGG - Intergenic
1059451229 9:114372593-114372615 GGTCATGGAGTGGCGGGGGCTGG - Intronic
1060034205 9:120241175-120241197 TATGATAGAGGGTCGGGGGCAGG + Intergenic
1060149226 9:121277039-121277061 TATTATGGAGGGGTGGGGGCAGG - Intronic
1060473426 9:123967548-123967570 GTTCATGGATGGGCTGGGGCTGG + Intergenic
1060818510 9:126648433-126648455 CTTGATGGAGTGTTGGGGGCGGG + Intronic
1061485965 9:130920674-130920696 GTTTAAGGAGGTTTGGCGGCAGG - Intronic
1062434895 9:136542650-136542672 GTTTGGGGAGGGTGGGGGCCGGG + Intronic
1062607487 9:137354687-137354709 GTTTGTGGAGGTTCGTGAGCAGG - Exonic
1203469794 Un_GL000220v1:111454-111476 GCGTCTCGAGGGTCGGGGGCCGG + Intergenic
1203477615 Un_GL000220v1:155426-155448 GCGTCTCGAGGGTCGGGGGCCGG + Intergenic
1185599287 X:1327861-1327883 GTGGGTGGAGGGTGGGGGGCTGG + Intergenic
1186601515 X:11042442-11042464 GTGTATGGGGGGTCGGGGGTGGG - Intergenic
1187528870 X:20078847-20078869 GATCAGGGAGGGTCAGGGGCTGG - Intronic
1189800234 X:44685164-44685186 GTTTCTGGAGGCTCTGGGGACGG - Intergenic
1190498770 X:51054527-51054549 GTTTAGGCAGGGTAGGGGGAAGG + Intergenic
1190586022 X:51943209-51943231 GTCTTTGGAGGGTCGGGGATGGG + Intergenic
1190865999 X:54385098-54385120 TTTTATGGAGGTTTGGAGGCTGG + Intergenic
1192200437 X:69063044-69063066 GGTGATGGGGGGTGGGGGGCAGG + Intergenic
1193732791 X:85121689-85121711 ATTTAAGGTGGGTAGGGGGCAGG - Intergenic
1197517762 X:127457091-127457113 GTTTATGGATGGCCAGTGGCAGG + Intergenic
1197756847 X:130001682-130001704 GTTTAGGAAGGGTTGGGAGCTGG + Intronic
1198250961 X:134878842-134878864 GGTTAGGGATGGTGGGGGGCAGG - Intergenic
1200747061 Y:6911685-6911707 GGTTCTGGCGGGTCGGGGTCTGG + Intronic
1201077679 Y:10199608-10199630 GCTTCTCGAGGGTAGGGGGCTGG + Intergenic
1201917586 Y:19198918-19198940 GATTCTGGGGGGTTGGGGGCAGG + Intergenic