ID: 1141167398

View in Genome Browser
Species Human (GRCh38)
Location 16:81669599-81669621
Sequence TTGGTGCGGAAGGAGGTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 360
Summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 330}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141167398 Original CRISPR TTGGTGCGGAAGGAGGTGAG AGG (reversed) Intronic
900242926 1:1625481-1625503 TTGGGGAGGAAGGGGCTGAGGGG - Intronic
900848248 1:5120954-5120976 TGGGTGTGTAAGTAGGTGAGTGG - Intergenic
901928598 1:12582952-12582974 TGGGTGGAGAAGTAGGTGAGTGG - Intronic
901928650 1:12583180-12583202 TGGGTGGAGAAGCAGGTGAGTGG - Intronic
902806748 1:18865750-18865772 TGGGTGGGGAAGGAGGAGACAGG - Intronic
903455426 1:23483997-23484019 CTGGCGCGGGAGGAGGTGAGGGG - Exonic
903692805 1:25186215-25186237 TTGGGGTGGAAGGAGGGGTGGGG - Intergenic
904212467 1:28894987-28895009 CTGGTGTGGGAGGAGCTGAGTGG + Intronic
904591624 1:31618228-31618250 TGAGTGCGGGAGGAGGGGAGGGG + Intronic
904916980 1:33977261-33977283 TTGGTGGTGAGGGAGGTGAGTGG + Intronic
906400285 1:45499524-45499546 GTGGTCCGGAATAAGGTGAGGGG - Exonic
907230470 1:52993773-52993795 TTGGTGCTGGGGGAGGAGAGAGG - Intronic
907415242 1:54309930-54309952 TTGGTGCGGGAAGGGGTGGGGGG + Intronic
907560004 1:55379556-55379578 TTGGTGAGGAAGGAGGGCAAAGG - Intergenic
911146508 1:94557586-94557608 TTGGGGAGGAAGAAGGGGAGAGG - Intergenic
911165671 1:94722352-94722374 TTGGTGGGAAAGGAGGGGACAGG + Intergenic
912500236 1:110116866-110116888 TCGGAGTGGAAGGAGGGGAGAGG - Intergenic
912687574 1:111779300-111779322 TTGGTGGGGAGGGGGGTGTGGGG - Intronic
913606759 1:120474528-120474550 TTGGAGGGTAAGGTGGTGAGAGG - Intergenic
914209672 1:145565613-145565635 TTGGAGGGTAAGGTGGTGAGAGG + Intergenic
914268589 1:146057982-146058004 TTGGAGGGTAAGGTGGTGAGAGG + Intergenic
914584434 1:149047308-149047330 TTGGAGGGTAAGGTGGTGAGAGG + Intronic
915595205 1:156893209-156893231 TAGGGGCGGCAGGAGGAGAGGGG + Intergenic
915729319 1:158041942-158041964 TTTCTGGGGAAGGAGGTGAGAGG + Intronic
916033505 1:160900110-160900132 ATGGGGTGGAGGGAGGTGAGAGG + Intergenic
916087956 1:161284907-161284929 TTGGTGCAGAAGGATCTGAAGGG - Exonic
918046834 1:180946581-180946603 AGGGTGGGGAAGGAGGGGAGGGG + Exonic
921159600 1:212463696-212463718 CTGGGGAGGAAGGAGGTGTGAGG + Intergenic
922209924 1:223479047-223479069 TTGGGGGGTGAGGAGGTGAGAGG + Intergenic
922880916 1:228979663-228979685 TTGGAGCAGAAGAAGTTGAGAGG + Intergenic
923189968 1:231611019-231611041 TTGGAGTGGAAGGAATTGAGAGG - Intronic
923334768 1:232958612-232958634 TTGGGGAAGAAGGAGGTGGGAGG - Intronic
1064048859 10:12042939-12042961 GCGGGGCGGAAGGAGGCGAGAGG + Intronic
1064139391 10:12777790-12777812 TGGCTGCGGAAGGAGGTGAGTGG - Intronic
1064773335 10:18748391-18748413 TTTGTGGGGAAGGAAGTTAGGGG - Intergenic
1065488369 10:26255914-26255936 ATGGGGAGGAAGGAGGGGAGGGG + Intronic
1066693796 10:38060407-38060429 TTGCTGTGGGAGGATGTGAGGGG - Intronic
1066999019 10:42588734-42588756 TTGCTGTGGGAGGATGTGAGGGG + Intronic
1067145093 10:43688905-43688927 TTGCTGGGGAAAGAGGTGTGGGG + Intergenic
1067697677 10:48547614-48547636 CTGGTGCAGAAGGAGGTGAAGGG - Intronic
1068099545 10:52534247-52534269 TTGGTGGGGTTGGGGGTGAGGGG + Intergenic
1069748577 10:70731669-70731691 ATGGTTTGGAAGGAGTTGAGGGG - Intronic
1069909420 10:71750488-71750510 ATGGTGCTGAGGGAGGTGGGTGG - Exonic
1070335709 10:75453697-75453719 TTGGTGGAGCAGAAGGTGAGAGG + Intronic
1072945384 10:99805199-99805221 TGGGTGCGGCAGGAGCAGAGTGG + Intronic
1074397111 10:113107339-113107361 TGGGAGGGGAAGGGGGTGAGGGG - Intronic
1075312309 10:121424700-121424722 TTGGTGTGGAAGGAGGGTAGAGG + Intergenic
1078079992 11:8197189-8197211 GTGGTGCAGCAGGAGGTTAGAGG - Intergenic
1078159981 11:8832000-8832022 TTTGTGAGGAAGGAGCTTAGAGG - Intronic
1078498307 11:11842210-11842232 CTGGTCCCGAAAGAGGTGAGGGG + Exonic
1080380588 11:31767935-31767957 TTGGTGAGGAGGGAGGTTTGTGG + Intronic
1080830671 11:35890709-35890731 CTGGTACAGCAGGAGGTGAGTGG - Intergenic
1081843211 11:46218720-46218742 TTGGTGGAGCAGGAGGAGAGTGG - Intergenic
1082255986 11:50033639-50033661 TCAGTGGGGAAGGAGGTTAGAGG - Intergenic
1083316909 11:61821004-61821026 TAGGTGGGTAAGGAGATGAGAGG - Intronic
1083753996 11:64779157-64779179 TTGGGGCGGGAGCAGGGGAGGGG + Intergenic
1085928890 11:81056734-81056756 TTGCTGCGGGAGGGGATGAGTGG - Intergenic
1086134418 11:83432136-83432158 TTGATGCGTAGGGAGGGGAGGGG + Intergenic
1086241374 11:84696558-84696580 TTGAGGAGCAAGGAGGTGAGTGG + Intronic
1088043574 11:105419453-105419475 TTGGTGCAGCAGGAGGTGCTGGG + Intergenic
1088110971 11:106260955-106260977 GTGGTACAGCAGGAGGTGAGAGG - Intergenic
1089737002 11:120556514-120556536 CTGGAGTGGCAGGAGGTGAGTGG - Intronic
1091364708 11:135007960-135007982 TTGGGGCGGAAAGAGGGCAGAGG + Intergenic
1092077438 12:5685355-5685377 ATGGTGGGGAAGGATGGGAGGGG + Intronic
1095928482 12:47603303-47603325 TGTGTGTGGAAGGAGGTGTGGGG - Intergenic
1096530191 12:52237555-52237577 GTGGTGCTGAAGAAGGTGAGTGG + Exonic
1096599457 12:52718961-52718983 GTGGTCCTGAAGAAGGTGAGGGG - Intergenic
1096711844 12:53463219-53463241 TTGATGAGGAAGGAGCAGAGAGG - Intronic
1096829082 12:54300717-54300739 TGGGGGGTGAAGGAGGTGAGGGG - Intronic
1097430248 12:59496885-59496907 GTGGTGGGTAAGGAGATGAGAGG - Intergenic
1098918021 12:76277146-76277168 GTGGGGAGGAAGGAGATGAGTGG - Intergenic
1099953100 12:89325836-89325858 GAGCTGAGGAAGGAGGTGAGAGG - Intergenic
1101499017 12:105283972-105283994 TTAGTGAGGAAGCAGGTAAGGGG + Intronic
1101692445 12:107094113-107094135 ATGGAGTGGAAGGAGGAGAGTGG + Intergenic
1102624624 12:114225148-114225170 TTGCTAGGGAAGGTGGTGAGTGG + Intergenic
1102726652 12:115071418-115071440 TTGGAGCAGAAGGAGGTGATGGG - Intergenic
1103767202 12:123288897-123288919 CTGCTGCGGAAGGCGGTGGGAGG - Intergenic
1105068856 12:133221669-133221691 CTGGTGCGGAAGGATGTGCCAGG + Intronic
1109326479 13:60873328-60873350 TTGGAGGGGAAGGAGGACAGAGG + Intergenic
1110551233 13:76813481-76813503 TCGCTTAGGAAGGAGGTGAGAGG - Intergenic
1111847061 13:93524246-93524268 TTTGTGGTTAAGGAGGTGAGTGG - Intronic
1111947177 13:94678079-94678101 TTGGTGCGACAGGCAGTGAGGGG + Intergenic
1114538747 14:23439389-23439411 GTGGGGCTGAAGGAGGTGTGGGG - Intergenic
1117488073 14:56218743-56218765 TTGGTGGGGAATGAAGAGAGAGG + Intronic
1118881930 14:69836217-69836239 TTGGTGTGAAAGGAGGGGACAGG - Intergenic
1119404385 14:74388397-74388419 TTGCTGAGGAAGGAGAAGAGGGG + Intergenic
1121260547 14:92562923-92562945 TTGGTGATGAAGGAGGTGAAAGG + Intronic
1122606146 14:102948444-102948466 TGGGTTTGGAGGGAGGTGAGGGG + Intronic
1123008010 14:105333682-105333704 TTGGGGAGGGAGGAGGTGGGAGG + Intronic
1124593787 15:31077347-31077369 CTGGAGCAGAAGGAGGTGGGAGG + Intronic
1125815038 15:42576584-42576606 TTGGTGTGGAGGGAAGTGAGTGG + Intronic
1126797052 15:52267901-52267923 TTGGTGCGTGAGGAGGGGACAGG - Intronic
1127308861 15:57733562-57733584 GTGGTGGGGAAGGGGGTGGGAGG + Intronic
1127627629 15:60795769-60795791 CTGGTAGGGATGGAGGTGAGGGG - Intronic
1128067825 15:64775497-64775519 CGGGTGCGGAAGGTGGGGAGGGG + Exonic
1131228206 15:90642508-90642530 TCGGTGCGGACGGAGATCAGTGG - Exonic
1132539979 16:504183-504205 GGGGTGCACAAGGAGGTGAGGGG - Intronic
1132540060 16:504434-504456 GGGGTGCACAAGGAGGTGAGGGG - Intronic
1132540096 16:504549-504571 GGGGTGCACAAGGAGGTGAGGGG - Intronic
1132540125 16:504645-504667 GGGGTGCAGGAGGAGGTGAGGGG - Intronic
1133200852 16:4203707-4203729 GAGGTGAGGAAGGAGGAGAGAGG - Intronic
1133421896 16:5653339-5653361 TTTGTGCGGAAGGTGGGGTGTGG + Intergenic
1133810449 16:9157380-9157402 CAGGGGCCGAAGGAGGTGAGGGG - Intergenic
1136549936 16:30977622-30977644 GTGGTGGGGAGGAAGGTGAGAGG + Intronic
1137327005 16:47450095-47450117 TTGCTGTGGAAGGAGCGGAGTGG + Intronic
1137589093 16:49682496-49682518 TTGCTGCAGAGGGAGGTGAAGGG - Intronic
1137704645 16:50526290-50526312 TTGGGGAGGCAGGAGGTGAGGGG - Intergenic
1137782989 16:51113792-51113814 TTGATGGGGAAGGAGGCGCGCGG - Intergenic
1137945412 16:52729360-52729382 ATGGTGTTGAAGGAGGTGTGTGG - Intergenic
1138031237 16:53560968-53560990 TTAGTGGGGTAGAAGGTGAGGGG + Intergenic
1138277600 16:55747351-55747373 TTAGAGCGGGAGGAGGTGGGGGG - Intergenic
1138772061 16:59677326-59677348 GTGGTGCGGTAGGAGGTTAGTGG + Intergenic
1139008152 16:62598900-62598922 TTGGTGGGGGAGGTGGGGAGCGG - Intergenic
1139650276 16:68358926-68358948 TTGGTGCTGAGGGAGGTGTGCGG + Exonic
1139951546 16:70674607-70674629 AGGGTGGGGAAAGAGGTGAGGGG + Intronic
1140739740 16:77930473-77930495 CTGGTACGGAAGGAGGTGTGAGG + Intronic
1140903175 16:79389179-79389201 GTGGTGGGGAAGGAGTTGAGTGG - Intergenic
1141167300 16:81669160-81669182 TGGGTGTGGAAGGAGGTGAGAGG - Intronic
1141167340 16:81669346-81669368 TGGGTGTGGAAGGAGGTGAGAGG - Intronic
1141167362 16:81669437-81669459 TGGATGTGGAAGGAGGTGAGAGG - Intronic
1141167392 16:81669576-81669598 TGGGTGTGGAAGGAGGTGAGAGG - Intronic
1141167398 16:81669599-81669621 TTGGTGCGGAAGGAGGTGAGAGG - Intronic
1141167403 16:81669622-81669644 TGGGTGTGGAAGGAGGTGAGAGG - Intronic
1141167433 16:81669746-81669768 TGGGTGTGGAAGGAGAAGAGAGG - Intronic
1141688186 16:85582093-85582115 TGGGTGGGGAAGGAGGCAAGAGG + Intergenic
1141810448 16:86372191-86372213 CTGGTGCAGAAGGAGGTGGGTGG - Intergenic
1143380982 17:6496272-6496294 GTGGTGTGGGAGGAGGTGATGGG - Intronic
1145192097 17:20851890-20851912 CTGCTGCGGAAGGAGCAGAGGGG - Intronic
1145402318 17:22551923-22551945 CTGCTGCGGAAGGAGCAGAGGGG - Intergenic
1146140498 17:30363806-30363828 GTGGTGAGGAAAGAGGTGAATGG - Intergenic
1146519222 17:33513638-33513660 TTGGGGCAGTAAGAGGTGAGAGG + Intronic
1147662931 17:42126849-42126871 CTGGTTTGGATGGAGGTGAGAGG + Intronic
1147939641 17:44037206-44037228 GTGGTGTGGAAAGAAGTGAGTGG - Intronic
1149814070 17:59706316-59706338 ATGGTGCAGAAGGAGGTAATGGG - Intronic
1151459749 17:74247512-74247534 TGGGAGGGGAAGGAGGAGAGAGG + Intronic
1151534459 17:74730763-74730785 CTGGTGAGGAAGGAAGAGAGTGG + Intronic
1151702805 17:75752361-75752383 GTGGTGGGCAGGGAGGTGAGGGG + Intronic
1155635071 18:27942989-27943011 GTGGTGGGGAAGGAGATGAATGG - Intergenic
1155712647 18:28902579-28902601 TTGGAAAGGAAGGAAGTGAGTGG + Intergenic
1155758976 18:29540531-29540553 TTGATGTGGAAGGAGGTCATAGG - Intergenic
1157109772 18:44809693-44809715 GGGTTGGGGAAGGAGGTGAGGGG + Intronic
1157496503 18:48161112-48161134 TTGGGGCTGGAGGAGGTGGGGGG + Intronic
1157664106 18:49470829-49470851 TTGGTGGGGAAGGTTGGGAGGGG - Intergenic
1158837481 18:61346273-61346295 AAGGTGCGGAAGGAAGTTAGCGG - Intronic
1159166628 18:64710563-64710585 GTGTTGGAGAAGGAGGTGAGTGG - Intergenic
1159213347 18:65358871-65358893 TTGGTGAAGAAGGAGCAGAGAGG + Intergenic
1160826528 19:1082849-1082871 TAGAGGCGGAAGGAGATGAGCGG - Exonic
1160980835 19:1815878-1815900 GGGGTGCGGCAGGACGTGAGCGG + Exonic
1161244105 19:3239687-3239709 TTGGTGGGGGACGAGGGGAGGGG - Intronic
1161851793 19:6740975-6740997 ATGGTGGGGGAGGAGGGGAGAGG - Intronic
1165785473 19:38459232-38459254 TTGATGCGGAAGGAGATGGACGG - Exonic
1166833686 19:45653782-45653804 ATGGTGCGGGAGGAGGAGGGAGG + Intergenic
1167161298 19:47768993-47769015 TTGATGGGCAAGTAGGTGAGTGG - Intergenic
1167371681 19:49086216-49086238 TTGGTGGGGGTGGAGGTGAAAGG - Intronic
1167383321 19:49150636-49150658 TTCGTCCGAAAGGAGGGGAGGGG + Exonic
1167499530 19:49837280-49837302 CTGGGAGGGAAGGAGGTGAGGGG + Intronic
1168258629 19:55180467-55180489 TTGGGGCGGGAGGAGTGGAGTGG - Intergenic
1202631920 1_KI270706v1_random:7987-8009 GTGGTGTGGAAGGAGGGGGGAGG - Intergenic
1202708649 1_KI270714v1_random:4276-4298 TTGGAGGGTAAGGTGGTGAGAGG - Intergenic
925556169 2:5133455-5133477 GTGGTGCGGTATGTGGTGAGTGG - Intergenic
925871808 2:8278229-8278251 GGGGTGCGGGAGGAGGTGGGAGG - Intergenic
925943052 2:8837984-8838006 TGGAGGCTGAAGGAGGTGAGGGG - Intergenic
928171606 2:29007922-29007944 TGGGTGGGGAAAGGGGTGAGAGG - Intronic
928997451 2:37308525-37308547 TGGGTGGGGAGGGAGGTGGGTGG - Intronic
929501415 2:42494075-42494097 GCGGCGCGGAGGGAGGTGAGCGG - Exonic
930171133 2:48252723-48252745 TTGGAGAGGAAGGGGGTGAGAGG + Intergenic
931199445 2:60083312-60083334 TTGGTGGGGAGGGTGGTCAGGGG - Intergenic
932140565 2:69273667-69273689 TGGGTGGGGGAGGAGGTGGGAGG - Intergenic
934556032 2:95287450-95287472 TGGGTGAGAGAGGAGGTGAGTGG + Exonic
935301742 2:101698450-101698472 CTGGAGAGGAAGGAGGGGAGGGG - Intronic
936397671 2:112141490-112141512 TTAGTGCAGAAGGTAGTGAGGGG + Intronic
936616356 2:114051697-114051719 TTGGTGAGGAAGGTGTTGTGTGG - Intergenic
937791460 2:125967052-125967074 TTGGAGCAGAAGGAGGAGATTGG - Intergenic
937793480 2:125988117-125988139 TTGGTAGGGAAGGATGGGAGGGG - Intergenic
938994273 2:136660884-136660906 TTGATGGGGAAATAGGTGAGAGG - Intergenic
939632545 2:144542905-144542927 TTGGAGCTGAAGGAGATGAAGGG - Intergenic
940763440 2:157763978-157764000 TTGGTAGGGAAGGAGTTGAGGGG - Intronic
941111790 2:161424306-161424328 TGGGTGCGCAAGGAGGAGTGTGG - Exonic
946177602 2:217930984-217931006 CTGGTGTGAAAGGAGGTGACAGG + Intronic
946219898 2:218217348-218217370 TGGGTGGGGTAGGAGGTTAGGGG - Exonic
946313393 2:218895258-218895280 TTGGAGGGGAAGGAGATGAGGGG - Intronic
946940425 2:224764168-224764190 ATGGTGAGGAGGGAGGTAAGGGG - Intergenic
947234215 2:227922866-227922888 TTGATGAGAAAAGAGGTGAGGGG + Intronic
947632896 2:231665361-231665383 ATGGTGCTGAGGGAGGTCAGTGG - Intergenic
947929823 2:233955122-233955144 CTGGTGCTGAAGGCTGTGAGAGG - Exonic
948600559 2:239105570-239105592 GTGGTGAGGAAGGATGAGAGTGG - Intronic
948760109 2:240185053-240185075 ATGGTGTGGATGGATGTGAGAGG + Intergenic
948889478 2:240900043-240900065 TGGGGGAGGAAGGAGGTGATGGG + Intergenic
1170218100 20:13912968-13912990 TTCATGCAGAAGGAGGTGAAAGG + Intronic
1172022090 20:31921822-31921844 TTGGGGTGGAAGGAGGGGGGAGG + Intronic
1172939303 20:38643786-38643808 TTGGTGCAGAAAGAGGTTAGGGG - Exonic
1173002735 20:39116320-39116342 CTGATCTGGAAGGAGGTGAGGGG + Intergenic
1173422965 20:42918936-42918958 GTGGTGCGGCATGAGCTGAGAGG - Intronic
1174216537 20:48920845-48920867 GTGGTGTGGGAAGAGGTGAGAGG - Intergenic
1175199394 20:57267134-57267156 TGGGGGCGGGAGGTGGTGAGTGG - Intergenic
1175491758 20:59384619-59384641 GTGGGGGGGAAGGAGGTGATGGG + Intergenic
1175491776 20:59384678-59384700 GTGGGGGGGAAGGAGGTGATGGG + Intergenic
1175491794 20:59384737-59384759 GTGGGGGGGAAGGAGGTGATGGG + Intergenic
1175491812 20:59384796-59384818 GTGGGGGGGAAGGAGGTGATGGG + Intergenic
1175491829 20:59384855-59384877 GTGGGGGGGAAGGAGGTGATGGG + Intergenic
1175491847 20:59384914-59384936 GTGGGGGGGAAGGAGGTGATGGG + Intergenic
1175491865 20:59384973-59384995 GTGGGGGGGAAGGAGGTGATGGG + Intergenic
1175491883 20:59385032-59385054 GTGGGGGGGAAGGAGGTGATGGG + Intergenic
1175491901 20:59385091-59385113 GTGGGGGGGAAGGAGGTGATGGG + Intergenic
1178946837 21:36955347-36955369 TTGGTGAGGGCTGAGGTGAGAGG + Intronic
1181617842 22:24066929-24066951 TTGGTGGGGCAGGGGCTGAGGGG + Intronic
1181976742 22:26736127-26736149 GTGGAGTGGGAGGAGGTGAGAGG - Intergenic
1183263553 22:36811783-36811805 TTGGTGGGGATGGGGGTGTGAGG + Intronic
1183587779 22:38762859-38762881 TTAGCGGGGAAGGAGGGGAGGGG - Intronic
1184430663 22:44440025-44440047 TGGGCGGGGAGGGAGGTGAGTGG + Intergenic
1184639489 22:45861820-45861842 CTGGTGAAGTAGGAGGTGAGAGG - Intergenic
1185171059 22:49294914-49294936 TTGGTGCAGACAGAGGCGAGAGG + Intergenic
1203307913 22_KI270736v1_random:122407-122429 TTGGAGTGGAATGAGGGGAGTGG + Intergenic
950443207 3:13021886-13021908 GTGGAGCGGGAGGAGGAGAGTGG - Intronic
950548283 3:13651976-13651998 CTGCTGCGTCAGGAGGTGAGAGG + Intergenic
951692445 3:25410817-25410839 TTGGGAGGGAAGGAGGGGAGAGG - Intronic
953251600 3:41249390-41249412 CTGGTGTGGAGGGAGATGAGTGG + Intronic
953463167 3:43097468-43097490 GTGGTGGGGAGGGAGGAGAGGGG + Intronic
954609637 3:51937537-51937559 TTGGTGGCAAAAGAGGTGAGTGG - Exonic
955312848 3:57906904-57906926 TTGGAGAGGAAGGAGTTTAGGGG + Intronic
956229579 3:66998520-66998542 ATGGTGCGGAGGGCGGTGGGCGG + Intronic
961049336 3:123733612-123733634 TGGGTGCTGAAGGAAGGGAGTGG + Intronic
961245928 3:125453322-125453344 TGGGTACTGAAGGAGGGGAGGGG + Intronic
961589234 3:127963302-127963324 TTGGTGCGGAGTGAGAGGAGGGG - Exonic
962872682 3:139511854-139511876 TTGGTGGGGCAGGAGGGGAAAGG - Intergenic
963500442 3:146119195-146119217 TTGGAGCAGGAGGAAGTGAGGGG - Intronic
965165721 3:165193233-165193255 TTGGTGAGGAAGGTGGAGATGGG + Intronic
966226222 3:177600951-177600973 TTGGGGTGGAAGGAGGGCAGAGG + Intergenic
966711805 3:182980147-182980169 TTGGGGCGGGGGGAGGGGAGGGG - Intronic
967666034 3:192173123-192173145 GGGTTGGGGAAGGAGGTGAGAGG + Intronic
968094221 3:195916682-195916704 TAGGTGCTGAAGGAGGAGATGGG - Intergenic
968438621 4:609868-609890 AAGGTGCGGAAGGGGGTCAGGGG + Intergenic
968577434 4:1374436-1374458 GTGGTGCAGGAGGAGGGGAGAGG + Intronic
969344280 4:6561456-6561478 CTGGGTCGGAAGGAGGTGGGGGG + Intronic
971619455 4:28836564-28836586 TTGGAGAGGAAGGTGGGGAGAGG - Intergenic
975822894 4:78289822-78289844 GTGGTGGGGAAGGTGGGGAGGGG - Intronic
977401707 4:96541097-96541119 GTGGTGAGGAAGGGGGTGGGGGG - Intergenic
980960188 4:139467274-139467296 GTGGTGGGGAAAGAGGTGCGCGG - Intronic
981578911 4:146232739-146232761 TGGGTGATGAGGGAGGTGAGAGG + Intergenic
982561739 4:156936381-156936403 TTGGTTAGGAATGAGTTGAGAGG - Intronic
984741260 4:183165546-183165568 TGGGTGTGGAAGGGGGTGTGGGG + Intronic
990451367 5:55934033-55934055 GTGGTGGGGAGGGAGATGAGGGG + Intergenic
992596621 5:78353651-78353673 GTGGTAATGAAGGAGGTGAGAGG + Intergenic
992654643 5:78896323-78896345 TTGGAGCTGAAGGAAGTGTGTGG - Intronic
993602610 5:89947136-89947158 TTGGAGGGGGAGGAGGCGAGAGG - Intergenic
995144741 5:108774046-108774068 TTGGGGGGTGAGGAGGTGAGGGG - Intronic
995930513 5:117436946-117436968 CTGGAGCGGGGGGAGGTGAGGGG - Intergenic
996381393 5:122865695-122865717 ATGATGAGGATGGAGGTGAGAGG + Intronic
999317711 5:150594917-150594939 ATGCTGTGGAAGGAGGTCAGAGG + Intergenic
999670931 5:153958770-153958792 TGGGGGCTGTAGGAGGTGAGGGG - Intergenic
999948762 5:156626031-156626053 TTGGTGGGGGTGGAGGTGGGGGG + Intronic
1000252065 5:159505134-159505156 TAGATGGGGAAGGAGGTGTGGGG - Intergenic
1001547516 5:172579732-172579754 CAGGTGAGGATGGAGGTGAGTGG - Intergenic
1001768557 5:174274796-174274818 TTGGTGAATAAGTAGGTGAGTGG - Intergenic
1001932761 5:175684822-175684844 TTGGTGGGGAAAGAGGCCAGTGG + Intronic
1002293474 5:178215052-178215074 TTGGTGTGGACAGAGGAGAGAGG + Intronic
1002508678 5:179698730-179698752 TTGGTTGGGCGGGAGGTGAGGGG - Intronic
1002808575 6:603170-603192 TGGGTGGGGTAGCAGGTGAGGGG - Intronic
1002988695 6:2217267-2217289 GTGGTGCAGAGTGAGGTGAGGGG - Intronic
1003400293 6:5785102-5785124 TGGGTGAGGGAAGAGGTGAGGGG + Intergenic
1003868234 6:10382159-10382181 TTAGAGGGGAAGGAGGTTAGAGG - Intergenic
1005083183 6:21977962-21977984 TTGGTGATGGAGGAGGTCAGGGG + Intergenic
1005314266 6:24589092-24589114 TTGGGGTGGAAGGAGGTGTGGGG - Intronic
1006083161 6:31579181-31579203 TTTGTGGTGAAGGAGGGGAGAGG + Intergenic
1006089583 6:31620646-31620668 TAGGCGCGGAGGGAGGTGGGAGG + Intergenic
1006998513 6:38285518-38285540 GTGGTGGGGAGGGAGGTGTGGGG + Intronic
1007008752 6:38394287-38394309 TTGGTGCTGATGGTGGTGATAGG + Intronic
1007011112 6:38418402-38418424 TTGGTGGGGGAGGAGCAGAGTGG - Intronic
1007093917 6:39201684-39201706 TTGCTGGGAAGGGAGGTGAGAGG - Intronic
1007412853 6:41674882-41674904 TAGGTGGGGAAGGAGGGGAAGGG - Intergenic
1007580912 6:42959484-42959506 TTGGAAAGGAAGGAGGAGAGAGG + Intergenic
1008320990 6:50113534-50113556 TTGTTGTGGAGGGAGGGGAGGGG - Intergenic
1008673167 6:53794199-53794221 CTGGTGCGGAGGGAGGAGCGAGG - Intergenic
1010830662 6:80524272-80524294 GTGGGGCTGAAGGAGGAGAGAGG + Intergenic
1011722679 6:90175573-90175595 TTGGGGCGGTGGGGGGTGAGTGG + Intronic
1014256919 6:119169772-119169794 GTGGTGGGGTAAGAGGTGAGGGG + Intergenic
1015986578 6:138890392-138890414 TAGGTAAGGATGGAGGTGAGGGG - Intronic
1016799629 6:148155785-148155807 TTAGTTGGGAAGGAGGAGAGTGG - Intergenic
1017264193 6:152423430-152423452 TTGGTGGGGAGGGAGGAGTGGGG - Intronic
1017444454 6:154494703-154494725 TTGGTGCTGAAGGAAGAGGGTGG - Intronic
1017799906 6:157885657-157885679 GTGGTGTGGAAGGATGTGACAGG + Intronic
1018026938 6:159814071-159814093 TTGATGTGGAAGGAAATGAGAGG - Intronic
1018071359 6:160167225-160167247 TTACTGTGGAAGTAGGTGAGAGG + Intergenic
1018094858 6:160376359-160376381 GTGGTGCGGAGAGGGGTGAGGGG + Intronic
1019105468 6:169663946-169663968 TGGGTGGGGACGGGGGTGAGAGG - Intronic
1019471781 7:1224919-1224941 TTGGAGCGGAAGGAGGGGCAGGG + Intergenic
1019471813 7:1225077-1225099 TTGGAGCGGAAGGAGGGGCAGGG + Intergenic
1019836088 7:3385635-3385657 TTGGTGGGCAGGGAAGTGAGAGG - Intronic
1020087718 7:5320524-5320546 TTGCTGCAGGAGGCGGTGAGGGG - Exonic
1020879526 7:13742092-13742114 GGGGTGTGGAAGGAGGTGAGAGG + Intergenic
1021085805 7:16420566-16420588 TAGGTGCTGCAGGAGGGGAGAGG - Intronic
1021380580 7:19961236-19961258 TAGGTGTGGAAGGAGAAGAGAGG - Intergenic
1021742007 7:23696453-23696475 TTGGTGAGGGCTGAGGTGAGAGG + Intronic
1022057658 7:26756319-26756341 GTGGGGCGGGAGGAGGTGGGAGG - Intronic
1023381552 7:39613220-39613242 GTGGTACAGCAGGAGGTGAGCGG - Intergenic
1023448001 7:40251792-40251814 TTGGTGAGGAAGGAGCAGTGAGG + Intronic
1025206595 7:56996641-56996663 TTGCTGCAGGAGGTGGTGAGAGG + Intergenic
1025994749 7:66520842-66520864 TTGGTGCTGAAGAACCTGAGCGG + Intergenic
1026742520 7:72988002-72988024 GTTGTGCAGCAGGAGGTGAGTGG + Intergenic
1026986371 7:74557489-74557511 TCGGTGCTGAAGGACCTGAGGGG + Intronic
1027028639 7:74872705-74872727 GTTGTGCAGCAGGAGGTGAGTGG + Intergenic
1027101215 7:75377076-75377098 GTTGTGCAGCAGGAGGTGAGTGG - Intergenic
1027480205 7:78686359-78686381 TGGGTGTGTAAGGAGGGGAGAGG - Intronic
1027542238 7:79481454-79481476 TTTGTAAGGAAGGAGGTGTGGGG - Intergenic
1028968614 7:96830942-96830964 TGGGTGTGGAAGGTGGAGAGAGG - Intergenic
1032264471 7:130361458-130361480 TTGGTCAGGAAGTAGGTGGGAGG + Intronic
1032319011 7:130867918-130867940 TTGGTGTGGCAGGAGGTGACAGG - Intergenic
1033393265 7:140949251-140949273 GAGGTGGGGGAGGAGGTGAGAGG - Intergenic
1034143916 7:148851467-148851489 TTGTGGGGGAAGGAGGTCAGGGG - Intronic
1035312392 7:157977712-157977734 TGGGGGCGGGAGGAAGTGAGAGG + Intronic
1038035446 8:23682795-23682817 TGGATGAGGAAGGACGTGAGCGG + Exonic
1041538403 8:58954907-58954929 TGGGTGAGGAAGCAGGTGGGAGG + Intronic
1042159925 8:65882256-65882278 GTCGTGCCGCAGGAGGTGAGTGG + Intergenic
1042215903 8:66429522-66429544 CTGGTGTGGGACGAGGTGAGTGG + Exonic
1042496740 8:69463436-69463458 TTGGTGGGGAGGGAGGTGACGGG - Intergenic
1042623455 8:70731579-70731601 TGGGTGCTGAATGAGGTGACTGG - Intronic
1042757395 8:72230816-72230838 TAGGAGCGGGAGGAAGTGAGAGG - Intergenic
1042876618 8:73446282-73446304 ATGGTGGGGAAGTAGGTGTGAGG + Intronic
1042955438 8:74244993-74245015 TTGGGGAGGAAGCAGGAGAGTGG + Exonic
1046810003 8:118523213-118523235 TTGGGGAGGAGGGAGGTGGGGGG + Intronic
1047010805 8:120670518-120670540 TTGGTGGGTAGGGAAGTGAGAGG + Intronic
1049273998 8:141710734-141710756 CTGGTGCGGAGGGAGGGCAGAGG + Intergenic
1049651524 8:143771951-143771973 GCGGTGCTGAAGGAGGTCAGCGG + Intergenic
1053149788 9:35736130-35736152 TTGGTGAGGATGGTGATGAGGGG + Exonic
1053241785 9:36501940-36501962 TTTTTGCGGGGGGAGGTGAGGGG + Intergenic
1053575903 9:39357418-39357440 TGGATGCGGAGGGGGGTGAGGGG + Intronic
1053840419 9:42185355-42185377 TGGATGCGGAGGGGGGTGAGGGG + Intronic
1054097472 9:60916109-60916131 TGGATGCGGAGGGGGGTGAGGGG + Intergenic
1054118875 9:61191739-61191761 TGGATGCGGAGGGGGGTGAGGGG + Intronic
1054588877 9:66990823-66990845 TGGATGCGGAGGGGGGTGAGGGG - Intergenic
1055194026 9:73564551-73564573 TTGCTGGGGTAGGGGGTGAGGGG + Intergenic
1056584507 9:87919580-87919602 TGGATGCGGAGGGGGGTGAGGGG + Intergenic
1056612359 9:88133340-88133362 TGGATGCGGAGGGGGGTGAGGGG - Intergenic
1057141464 9:92729016-92729038 CAGGAGCTGAAGGAGGTGAGGGG - Exonic
1057483255 9:95462264-95462286 ATGGGGCGAAAGGAGGAGAGTGG - Intronic
1057501772 9:95602077-95602099 CTGGTGGGGACCGAGGTGAGTGG - Intergenic
1060070511 9:120542943-120542965 TTGGGCTGGGAGGAGGTGAGAGG + Intronic
1061377091 9:130233001-130233023 ATGGCACAGAAGGAGGTGAGTGG - Exonic
1062612982 9:137383305-137383327 CGGGAGCGGAAGCAGGTGAGTGG - Exonic
1202796631 9_KI270719v1_random:126188-126210 TAGGTCTGGAAGGAGGTGATTGG - Intergenic
1185596175 X:1308352-1308374 TGGGGGTGGAAGAAGGTGAGAGG + Intronic
1185683171 X:1905938-1905960 ATAGTGGGGAAGGAGGTGATGGG - Intergenic
1186137459 X:6534341-6534363 CTTGTGAGGAAGGAGGCGAGGGG + Intronic
1186266973 X:7843338-7843360 CTTGTGAGGAAGGAGGCGAGGGG - Intronic
1186298131 X:8170487-8170509 CTTGTGAGGAAGGAGGCGAGGGG + Intronic
1186324663 X:8465585-8465607 CTTGTGAGGAAGGAGGCGAGGGG - Intronic
1188235841 X:27730174-27730196 TTGGAGGTGAAGGTGGTGAGAGG + Intronic
1189564979 X:42232355-42232377 TAGGAGGGGAAGGAGATGAGAGG + Intergenic
1190712885 X:53082324-53082346 TTGGCGCGGAGGGAGTAGAGCGG + Intergenic
1191705911 X:64094359-64094381 TTGGAGGTGGAGGAGGTGAGGGG + Intergenic
1193041824 X:77012038-77012060 TTGGGGCGGTAGGGGGTGAATGG - Intergenic
1196819594 X:119692604-119692626 CTGGGGCAGAAGGCGGTGAGTGG - Intronic
1197098643 X:122625310-122625332 GTGGTGTGGTAGGAGGTGATTGG - Intergenic
1199952416 X:152716402-152716424 ATGGTACAGAAGGAGATGAGGGG - Intronic
1199957267 X:152752046-152752068 ATGGTACAGAAGGAGATGAGGGG + Intronic
1200258133 X:154596687-154596709 TTGCAGGGGAAGGCGGTGAGGGG - Intergenic
1200292038 X:154884521-154884543 GTGGTGTGGAAGGAGGCGTGCGG + Intronic
1200338876 X:155380258-155380280 GTGGTGTGGAAGGAGGCGTGCGG + Intergenic
1200347593 X:155460434-155460456 GTGGTGTGGAAGGAGGCGTGCGG - Intergenic
1200838539 Y:7756331-7756353 GTGGTGTGGAAGGAGGAAAGAGG + Intergenic