ID: 1141168792

View in Genome Browser
Species Human (GRCh38)
Location 16:81678199-81678221
Sequence GCCTTTAGTCTGATGGGTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 66}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141168787_1141168792 -1 Left 1141168787 16:81678177-81678199 CCTCATCCTGGGATTCAGGGAGG 0: 1
1: 0
2: 3
3: 25
4: 267
Right 1141168792 16:81678199-81678221 GCCTTTAGTCTGATGGGTCATGG 0: 1
1: 0
2: 0
3: 6
4: 66
1141168789_1141168792 -7 Left 1141168789 16:81678183-81678205 CCTGGGATTCAGGGAGGCCTTTA 0: 1
1: 0
2: 1
3: 19
4: 213
Right 1141168792 16:81678199-81678221 GCCTTTAGTCTGATGGGTCATGG 0: 1
1: 0
2: 0
3: 6
4: 66

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141168792 Original CRISPR GCCTTTAGTCTGATGGGTCA TGG Intronic
905772318 1:40646312-40646334 CCCTGTGGTCTGATGGCTCAGGG - Intronic
907479757 1:54737255-54737277 GGCTTTAGTCTGATTTGTTAGGG + Intronic
909133077 1:71764025-71764047 GCTTTTGGTCTCATGGGCCAGGG - Intronic
909398151 1:75193982-75194004 GCCCTTGGTCTGATGGGAGAGGG - Intergenic
910448303 1:87320855-87320877 GCCTTTTGTTTGTTTGGTCAAGG + Intergenic
918585981 1:186188774-186188796 GCAATTGGTCTGATGGGACATGG + Intronic
921174788 1:212584614-212584636 GCATTTAAACTGATGGATCAAGG - Intronic
922167580 1:223128791-223128813 GCCATCAGTCTGATGGGTTGTGG - Intronic
1075323611 10:121512151-121512173 GCCTCTAATCAGATGTGTCAAGG - Intronic
1078898698 11:15621541-15621563 TCCTTTAGGCTGATGAGTTATGG - Intergenic
1084208253 11:67608489-67608511 GCCCTTAGTGTGTTGGGTCCCGG + Intronic
1091084600 11:132708968-132708990 ATTTTTAGTCTCATGGGTCACGG + Intronic
1104626815 12:130363572-130363594 GCATCTAGTCTCATGGGGCAGGG + Intronic
1107013167 13:35687618-35687640 CTCTTTAGTTTGATGGGTCTCGG - Intergenic
1111934953 13:94549024-94549046 TTCTTTAGTCTGATGCGTCGGGG + Intergenic
1115108029 14:29784683-29784705 GCCTGTGGTCTGAGGGTTCACGG + Intronic
1119941235 14:78643839-78643861 GCCTTTAGAAAGATGGATCAAGG + Intronic
1121828812 14:97032929-97032951 GCCAGCAGTCTGATGGGTCTGGG + Intergenic
1122818872 14:104330313-104330335 GCCTGTACACTGATGAGTCAGGG - Intergenic
1129615537 15:77096652-77096674 GCCTCAAGTCTGAGGTGTCAGGG + Intergenic
1130935804 15:88469391-88469413 GCTTTTTGTCTGTTTGGTCAGGG - Intronic
1141101463 16:81200556-81200578 GCATCTATTCTGATTGGTCATGG - Intergenic
1141168792 16:81678199-81678221 GCCTTTAGTCTGATGGGTCATGG + Intronic
1144535838 17:16090570-16090592 GCTTTTACTCTGTTGGGTCTAGG - Intronic
1150156449 17:62857758-62857780 GCCTTTGGTTTGTTAGGTCAAGG + Intergenic
1150441749 17:65197031-65197053 GCCTTTAGTCTCATGGCCCAGGG - Intronic
1164914011 19:32035425-32035447 CAGTTTAGTCTGATGGGCCATGG - Intergenic
1168369401 19:55819508-55819530 GCCTTGACTGTGTTGGGTCAAGG - Intronic
946475217 2:220000520-220000542 GACTTTATTCTGATGGGTAGAGG + Intergenic
1170235112 20:14094778-14094800 GCCCTTAATCTTATGGGCCATGG - Intronic
1171122180 20:22577389-22577411 GTCTTTGGTCTGATGCGACAGGG - Intergenic
1176445959 21:6820698-6820720 GTAGTTGGTCTGATGGGTCAGGG - Intergenic
1179280299 21:39928190-39928212 GCCTCTAGTCTGATGAGACCCGG - Intronic
954354398 3:50072822-50072844 GCCTTGAGTCTTCTGGGACAAGG + Intronic
954533418 3:51340224-51340246 GCCTTGTCTCTGATGGCTCAGGG + Intronic
955859845 3:63316757-63316779 TCCTTTATTCTGCTGGGTTAGGG + Intronic
955949905 3:64232677-64232699 ACCTTTAGGCTGATGACTCAAGG + Intronic
956045977 3:65196319-65196341 GCCTCTATTCTGATAGCTCAGGG + Intergenic
957728076 3:84094564-84094586 GGCCTTCTTCTGATGGGTCAGGG - Intergenic
959931532 3:111988671-111988693 CTCTTGAGTCTGAGGGGTCAAGG - Intronic
963008035 3:140744437-140744459 ACCTTTCATCTGATGGCTCAGGG + Intergenic
963907300 3:150783217-150783239 GCCTATAGTCTGATGGGCAAGGG + Intergenic
975225281 4:71864491-71864513 GGTTTTAGTGTGCTGGGTCAAGG + Intergenic
975622469 4:76307899-76307921 GCCTTTACTGTGATTGGTCTGGG + Intronic
982005097 4:151056077-151056099 GCCTCTATTCTGACTGGTCAGGG - Intergenic
982462550 4:155688940-155688962 GCCTTGAGTCTGCTGAGTTATGG + Intronic
982534905 4:156598335-156598357 GTCTTGAGTCTGCTGGGTCAGGG - Intergenic
994556137 5:101306694-101306716 GGCTTTAGTCTTCTGTGTCAAGG + Intergenic
995135760 5:108678479-108678501 GCCTTTAGTCTAAAGGGGCATGG + Intergenic
1002037473 5:176483179-176483201 ACCTGTAGTCTGAGGTGTCAGGG - Intronic
1003399101 6:5776840-5776862 GCCTTTAGTCTCATGGAGAAGGG - Intergenic
1011561889 6:88627755-88627777 GTTTTTAGTCTAATGGTTCAAGG - Intronic
1013237032 6:108206391-108206413 GCCTTAAGTGTGAAGGTTCATGG + Intergenic
1015113685 6:129621722-129621744 TCCTTTATTCTTATGTGTCATGG + Intronic
1015886247 6:137921705-137921727 TCCTTTAGACTGAAGGGTCAGGG + Intergenic
1020192503 7:6010783-6010805 GCGTATAGTCTGATGTGTCTGGG + Intronic
1022735124 7:33069140-33069162 GCCTTGGGTCTGAGGGGTCATGG - Intergenic
1025238028 7:57247878-57247900 GCATCTGGGCTGATGGGTCAGGG - Intergenic
1027665283 7:81037258-81037280 TCCTTTGGTCTGATGGGTATGGG - Intergenic
1029718815 7:102349538-102349560 GCATTTAGTCTAATGGGACTGGG + Intergenic
1032532850 7:132636390-132636412 CCCTGTAGTCTGATGTTTCATGG + Intronic
1039589632 8:38735624-38735646 GCCTTAGGCCTGAAGGGTCAGGG - Intronic
1042701080 8:71615355-71615377 GCTTTGTGTCTGATAGGTCAGGG - Intergenic
1045912385 8:107425621-107425643 ACCTTGAGACTGATGTGTCAAGG - Intronic
1048488055 8:134867004-134867026 CCCTGTGGTCTGATGGGTCTGGG + Intergenic
1049069474 8:140345614-140345636 GCATTTAGTCGGAAGGGACAGGG - Intronic
1055534548 9:77225332-77225354 AGCTTAAGTCTGAGGGGTCATGG - Intronic
1203523234 Un_GL000213v1:63827-63849 GTAGTTGGTCTGATGGGTCAGGG + Intergenic
1190483182 X:50897926-50897948 GAATTTAGTCAGATGGGTCCAGG - Intergenic
1191576816 X:62715340-62715362 GCCTTTGGTCTTAGGTGTCATGG + Intergenic
1191937100 X:66437786-66437808 GTCCTTAATCTAATGGGTCAGGG - Intergenic
1192343683 X:70283819-70283841 CCCTGTAGTCAGAAGGGTCATGG + Intronic
1201360306 Y:13139575-13139597 GCCTCTGGGCTGATTGGTCAAGG + Intergenic