ID: 1141169049

View in Genome Browser
Species Human (GRCh38)
Location 16:81679833-81679855
Sequence AAACTGGGGCTCCCAGAACC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 275
Summary {0: 1, 1: 0, 2: 3, 3: 22, 4: 249}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141169049_1141169057 25 Left 1141169049 16:81679833-81679855 CCTGGTTCTGGGAGCCCCAGTTT 0: 1
1: 0
2: 3
3: 22
4: 249
Right 1141169057 16:81679881-81679903 CTGCCCCCCACAGAGCCATGTGG 0: 1
1: 2
2: 5
3: 34
4: 319

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141169049 Original CRISPR AAACTGGGGCTCCCAGAACC AGG (reversed) Intronic
900584640 1:3426779-3426801 AAACTGCAGCTCCCAGAGCAAGG - Intronic
901020311 1:6251984-6252006 AAACTGAGGCTTAGAGAACCAGG + Intronic
901393773 1:8965421-8965443 AAACTGTGGTTACCAGAAGCTGG - Intronic
901878814 1:12181992-12182014 AAACTGAGGCACAGAGAACCTGG + Intronic
905405268 1:37728255-37728277 GAACTGGGGGAGCCAGAACCTGG + Intronic
905441150 1:37997234-37997256 AAACTGGTACTCCCTGACCCAGG - Exonic
907284425 1:53370872-53370894 AAGCTGGGCCTCCCAACACCTGG - Intergenic
907301111 1:53486822-53486844 AAACTGGGGCTGGGAGAGCCTGG + Intergenic
911036647 1:93557285-93557307 ACACTGGGGATCCCAAAAGCGGG - Intergenic
912419224 1:109532115-109532137 AAGCTGGGGCTCCGAAAAGCCGG + Intergenic
915009457 1:152671717-152671739 AAACTGGGGCTTCAAAACCCAGG - Intergenic
916676334 1:167066831-167066853 AAACTGGGGCTCCGGGACCGGGG - Intronic
916991341 1:170248989-170249011 CACCTGGGGCTACCAGAAGCTGG + Intergenic
920666656 1:207967677-207967699 CTCCTGGGGCTCCCAGAAGCTGG + Intergenic
923104402 1:230843360-230843382 AAACTTGGGTTCCGAGAACAGGG + Exonic
1068287817 10:54962475-54962497 ACCTTGGGGCTCCCTGAACCAGG + Intronic
1069256973 10:66344835-66344857 ACACTGGGGATTCTAGAACCAGG - Intronic
1069517310 10:69088211-69088233 GAACTGAGGATTCCAGAACCAGG - Exonic
1069805008 10:71116721-71116743 GAGCTGGGGCTCCCAGAATGTGG - Intergenic
1070664419 10:78333172-78333194 AAACTGGGGCTGCCATGACGGGG + Intergenic
1070795969 10:79216421-79216443 CAACTGTGGGTCCCAGAGCCTGG - Intronic
1070923212 10:80202003-80202025 AAGCTAGAGATCCCAGAACCAGG + Intronic
1071497941 10:86181305-86181327 AAGCTGTGGCCCCCAGGACCTGG + Intronic
1074760962 10:116667224-116667246 ACACTGGGGCCACCAGAAGCTGG + Intronic
1077085820 11:750059-750081 AAACTGGGGAGCCCTGAGCCAGG - Intronic
1080812409 11:35717678-35717700 AAACTGTGCCTCTGAGAACCAGG + Intronic
1083136282 11:60679539-60679561 CACCTGGGGCTACCAGAACCTGG + Intergenic
1083535570 11:63463903-63463925 AAACAGGGGATCCAAGAGCCAGG + Intronic
1084438673 11:69158234-69158256 CAACCGGGGACCCCAGAACCTGG - Intergenic
1084550714 11:69840223-69840245 AAACTGAGGCACCGAGAATCAGG + Intergenic
1085047942 11:73364106-73364128 AAAGTGGGTCACCCAGGACCAGG - Intronic
1085255533 11:75170575-75170597 CACCTGAGGCTCCCAGGACCTGG - Intronic
1085258936 11:75193326-75193348 AAACTGGCGCTCCAGGAACTTGG - Exonic
1085304726 11:75478861-75478883 AAACTGAGGCTCAGAGAACAAGG + Intronic
1085978018 11:81683901-81683923 AAACTGAGGCTCCAAGTACCAGG + Intergenic
1088313565 11:108485159-108485181 AAGCTTGGGCTACCAGAAACAGG - Intronic
1089298724 11:117485095-117485117 AAGCTGTGGCTCCCGGCACCAGG - Intronic
1089681188 11:120119845-120119867 AACCAGGGTCTCCCAGAACCAGG + Intronic
1091778982 12:3201962-3201984 CCACTGGGGCTCCCAGAACCTGG - Intronic
1092609757 12:10159723-10159745 AAACTGGGGTTCCAGGAGCCTGG - Exonic
1094788142 12:33875115-33875137 AAACTGAGAATCTCAGAACCTGG - Intergenic
1095392749 12:41728612-41728634 AAACAGTAGCTTCCAGAACCTGG + Intergenic
1096103696 12:48984454-48984476 AAGCTGGGGCACTCTGAACCAGG + Intergenic
1097078507 12:56412588-56412610 ACCCAGGGGCTCCCAGAGCCAGG - Intergenic
1099361912 12:81713636-81713658 ACACTGGGACTTCCAGAACTAGG - Intronic
1099595500 12:84658487-84658509 AAACTGGGGCTACAAGAAGTTGG - Intergenic
1099618337 12:84968311-84968333 AAACTGAGGCACCTAGAAACTGG + Intergenic
1102227631 12:111240248-111240270 AAACTGGGCCTCCCAGAGGGTGG + Intronic
1102527293 12:113520946-113520968 AAACCGAGGCTCACAGAACGAGG + Intergenic
1102530136 12:113540229-113540251 ACACAGGGAATCCCAGAACCAGG + Intergenic
1102773610 12:115499762-115499784 GAACTTGAGCACCCAGAACCAGG - Intergenic
1102956388 12:117061722-117061744 AAACTGAGGCTCCAAGAGTCAGG - Intronic
1104070673 12:125342715-125342737 AAGCTGGGGCTCACAGGAACAGG - Intronic
1106248442 13:27967180-27967202 TAGCAGGGGCTCCCAGATCCTGG - Intronic
1108265804 13:48707505-48707527 AAAGTGGAGGTCCCAGAATCGGG + Exonic
1109173941 13:59132068-59132090 AAATTGGGTGTCCCATAACCGGG - Intergenic
1113465608 13:110510777-110510799 CACCTGGGACTCCCAGAACGAGG - Intronic
1114409343 14:22486105-22486127 AAACTGAGCCTCACAGACCCAGG + Intergenic
1115786296 14:36829511-36829533 ATCCTGGGGCTACCAGCACCAGG - Intronic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1119535914 14:75402191-75402213 AAACAGGCCCACCCAGAACCTGG - Intergenic
1120039504 14:79736671-79736693 TAACATGGGCTCCCAGAACTTGG - Intronic
1122135830 14:99632392-99632414 GAACTGGGGCCCACAGAAACAGG - Intergenic
1122583084 14:102783871-102783893 AAAATGGGGCTACTAGCACCAGG + Intronic
1122633038 14:103116383-103116405 AGGAGGGGGCTCCCAGAACCTGG + Intergenic
1123457889 15:20442690-20442712 AGCCTGGAGCTCCCAGAAGCTGG + Intergenic
1123660180 15:22557719-22557741 AGCCTGGAGCTCCCAGAAGCTGG - Intergenic
1124264037 15:28217843-28217865 AGCCTGGAGCTCCCAGAAGCTGG + Intronic
1124314039 15:28652214-28652236 AGCCTGGAGCTCCCAGAAGCTGG - Intergenic
1127039869 15:54962847-54962869 GAACAGGGCCTCCCTGAACCAGG + Intergenic
1127911583 15:63420442-63420464 CATCTGGGGCTACCAGAAACTGG + Intergenic
1128889309 15:71316695-71316717 AGAGTGGGGCTCCCTGGACCTGG + Intronic
1129326239 15:74801643-74801665 AGACTGGGGCTCCCATAGCAGGG - Intronic
1129407395 15:75328523-75328545 GAGCTGGGGTTCCCAGAGCCTGG + Intergenic
1130031502 15:80318433-80318455 GAAATGTGGCTCCTAGAACCTGG + Intergenic
1130484758 15:84392495-84392517 AAACTGGAGACCCCAGAACTTGG - Intergenic
1132759797 16:1503052-1503074 AAGGTGGGGCTGCCAAAACCTGG + Intronic
1133272940 16:4619516-4619538 ATTCTGGTGCTCCCAGAGCCAGG - Intronic
1133828802 16:9302828-9302850 CACCTGGGGCTACCAGAAGCTGG + Intergenic
1133879281 16:9765271-9765293 TAACTGAGCCTCCCAGCACCCGG + Intronic
1134414823 16:14034282-14034304 CACCTGGGGCTACCAGAAGCTGG - Intergenic
1135139078 16:19906518-19906540 CACCTGGGGCCCCCAGAAGCTGG - Intergenic
1136413922 16:30092181-30092203 AAGCTGGGTCTCCGGGAACCGGG - Intergenic
1136702366 16:32156091-32156113 AGCCTGGAGCTCCCAGAAGCTGG + Intergenic
1136765301 16:32771397-32771419 AGCCTGGAGCTCCCAGAAGCTGG - Intergenic
1136802798 16:33098987-33099009 AGCCTGGAGCTCCCAGAAGCTGG + Intergenic
1137556501 16:49473726-49473748 TCACTGGGGCTCCCAGAGGCGGG - Intergenic
1138280429 16:55768717-55768739 AAACAGGGGCTCTGGGAACCTGG + Intergenic
1139138606 16:64234113-64234135 GAGCTGGGGCTCCCTGAGCCAGG + Intergenic
1139671075 16:68492843-68492865 AGGCTGGGGATCCCTGAACCTGG + Intergenic
1140476193 16:75240257-75240279 AAACTGAGTCTCCCAGTTCCAGG - Intronic
1141169049 16:81679833-81679855 AAACTGGGGCTCCCAGAACCAGG - Intronic
1141607716 16:85164480-85164502 AAACTGAGGCTCCAAGAAGCAGG - Intergenic
1141642939 16:85352022-85352044 AGACTGGGGATCCCAGACCTAGG + Intergenic
1203067689 16_KI270728v1_random:1033630-1033652 AGCCTGGAGCTCCCAGAAGCTGG - Intergenic
1142510658 17:390638-390660 CACCTGGGGCCCCCAGAAACGGG + Intergenic
1144765193 17:17728792-17728814 AATCTGGGGCTCCCAACTCCTGG - Intronic
1145064507 17:19752993-19753015 AAGCTGTGGCTCCCAGGCCCAGG + Intergenic
1146001542 17:29133428-29133450 GAACTGGGTCTCCCTGATCCTGG - Intronic
1146627539 17:34445692-34445714 AATTTGGGCCTCCCAGACCCAGG + Intergenic
1147952149 17:44113221-44113243 AAAGCAGGGCCCCCAGAACCTGG + Intronic
1148454234 17:47802315-47802337 CACCTGGGTCTCCCAGAACAGGG + Intergenic
1148457338 17:47818167-47818189 AAACTGGGGCTCCCTGAGGCAGG + Intronic
1150312538 17:64140725-64140747 TACCTGGGGCTCCCAGAAGCTGG - Intergenic
1155411949 18:25556195-25556217 TGACTGGGACTCCCAGAAGCTGG - Intergenic
1156845977 18:41665608-41665630 AATCTGGGTCTCTCAGAGCCAGG - Intergenic
1160613713 18:80108799-80108821 AAACTTTGGCTCCCAGAACTGGG - Intergenic
1160878714 19:1309954-1309976 AAACTGAGGCTCAGAGAACAGGG - Intergenic
1162208206 19:9071758-9071780 AAACTGGGGCTCAGAGAACCAGG + Intergenic
1162833638 19:13302446-13302468 AAAATGGGGCTCAGAGAACTTGG + Intronic
1163813955 19:19452529-19452551 ACACTGGGGCTCCCTGGACTTGG - Intronic
1164415723 19:28045171-28045193 CAACTGGTGCTGCCAGAGCCTGG - Intergenic
1164530066 19:29041823-29041845 AAAGTGCAGCTCCCAGGACCTGG + Intergenic
1165384144 19:35500633-35500655 AAACTGGGGCTCTGAAAGCCCGG - Intronic
1166662906 19:44658791-44658813 AAACCAGGATTCCCAGAACCAGG - Exonic
1167095248 19:47371973-47371995 CAGCTCGGGCGCCCAGAACCAGG + Intronic
1167150296 19:47704975-47704997 AACCTGGGGCCACCAGAAACTGG - Intergenic
1167604542 19:50474942-50474964 AAACTGAGGCTCAGAGAGCCGGG - Intronic
926117909 2:10224897-10224919 TACCTGGGGCTACCAGAAGCTGG + Intergenic
927315048 2:21671949-21671971 AAACTGTGGATCCCAGCATCTGG - Intergenic
929561708 2:42960443-42960465 AAACTGCCGCTCCCAGACACAGG + Intergenic
929863812 2:45700912-45700934 TGCCTGGGGCTCCCAGAAGCTGG + Intronic
931441557 2:62293915-62293937 ACACTGGGGCAACCAGAACCAGG - Intergenic
937352488 2:121175058-121175080 AGACTGGGCCTGCCAGAACAGGG + Intergenic
937913229 2:127086259-127086281 AAACTGGGGCACACAGACACTGG + Intronic
938094212 2:128451176-128451198 ACACTGGGGCCCCCAGAAACCGG - Intergenic
940988882 2:160077617-160077639 AAACTGGGGTTCCCAGAGTCAGG - Intergenic
945232535 2:207607654-207607676 ACAGTGGGGTTCCAAGAACCTGG + Intronic
946072619 2:217047586-217047608 AGTCAGGGCCTCCCAGAACCAGG + Intergenic
946161282 2:217837515-217837537 AATCAGGGGCTCCCATAATCGGG + Intronic
948504867 2:238421939-238421961 CACCTGGGGCCCCCAGAAGCTGG - Intergenic
1170814690 20:19703815-19703837 AAGCTGGGGTTCCCAGAAAATGG + Intronic
1171952268 20:31431017-31431039 AAACAGAGGCTCTCTGAACCTGG - Intergenic
1172178597 20:32987247-32987269 AAACTGAGGCTCAAAGAGCCAGG - Intronic
1173450506 20:43159417-43159439 AAACTGAGGCTCAGAGAAGCTGG - Intronic
1173826181 20:46049084-46049106 TAAACTGGGCTCCCAGAACCTGG + Intronic
1174333782 20:49842887-49842909 AAACCGGGGCCACCAGAAGCTGG - Intronic
1174371311 20:50090035-50090057 AAGCTTGGGCTGTCAGAACCTGG - Intronic
1175148198 20:56912371-56912393 AAAACGGGGCTCCCAGGAACAGG - Intergenic
1175225992 20:57444342-57444364 AAACTGAGGCTCCAAGAAGTTGG - Intergenic
1175335538 20:58193553-58193575 AGACTGGGCCTCCCACCACCAGG + Intergenic
1175497659 20:59425934-59425956 CACCTGGGGCCCTCAGAACCAGG - Intergenic
1175961327 20:62638068-62638090 ATGCTGGGGCCCCCAGCACCTGG - Intergenic
1175967061 20:62665032-62665054 GAACTGGGACTCCAAGAACTTGG - Exonic
1176079129 20:63262882-63262904 GGACTGGGGGTCCCAGGACCTGG - Intronic
1176085536 20:63293960-63293982 AGGCTGGGGCTCACAGAACCAGG + Intronic
1179184301 21:39072634-39072656 TGACTGGGGCTACCAGAAGCTGG + Intergenic
1179549629 21:42135693-42135715 AAACCGAGGCCCCCAGATCCCGG - Intronic
1179929116 21:44555591-44555613 ACACTAGGGCTCCCAGATCCTGG - Intronic
1180983611 22:19891285-19891307 AACCTGGGGGTCCCACAGCCAGG - Intronic
1181402835 22:22661696-22661718 AGACTGGGGGTCTCAGATCCAGG - Intergenic
1181501047 22:23315697-23315719 AGCCTGGGGCTCCCAGACCTGGG - Exonic
1181534300 22:23533780-23533802 AAACTGAGGCTACCTGAGCCTGG - Intergenic
1182053492 22:27331276-27331298 AAACTGAGGCTCAAAGAACTTGG - Intergenic
1182070167 22:27458002-27458024 AACCTGGAGCTCCCACCACCTGG + Intergenic
1183080586 22:35453222-35453244 ACACTGGGCCTCACAGAGCCTGG + Intergenic
1184403253 22:44286053-44286075 CATCTGGGGCTCCCAGGACATGG + Intronic
1184461610 22:44640931-44640953 GACCTGGGGCTCCCAGAGTCTGG - Intergenic
1184745805 22:46455102-46455124 CACCTGGGGCTACCAGAAACTGG + Intronic
1185377282 22:50488323-50488345 TACCTGGGGCTCCCCGAACAGGG - Exonic
949878717 3:8644935-8644957 GAAGAGGAGCTCCCAGAACCCGG - Intronic
950994566 3:17481032-17481054 AGTCAGGGGCTCCCTGAACCAGG + Intronic
953345264 3:42170323-42170345 CAACCTGGGGTCCCAGAACCTGG - Intronic
953679879 3:45031061-45031083 GAGGTGGGGCTCCCTGAACCTGG - Intronic
956930291 3:74035712-74035734 AAACTGGAACTCCTAGAACAAGG + Intergenic
959710142 3:109377654-109377676 AAACTGGCACTCCCAGAAAATGG - Intergenic
966732061 3:183159523-183159545 AAACTGTGATTCCCTGAACCTGG - Intronic
967546289 3:190732545-190732567 AAACGGGGTCTCCCTGAACAAGG + Intergenic
968285884 3:197508491-197508513 AACCTGGGGCTGCCTGAGCCAGG + Intergenic
968880532 4:3296530-3296552 AAACTAAGGCTCCCAGGACAAGG - Intronic
968903754 4:3442620-3442642 ATACTGGGGCCCCCAGATCTCGG - Intronic
969283722 4:6189585-6189607 ACACTGGGACTCCCACAGCCTGG - Intronic
969556202 4:7912161-7912183 AAACTGGTGCACCCAGGTCCCGG - Intronic
970191842 4:13524981-13525003 AAACTTGGGCTCTCCGAAACAGG + Intergenic
972292785 4:37705385-37705407 CACCTGGGGCTGCCAGAACCTGG - Intergenic
973652520 4:53010572-53010594 AAACTAGACCTCCCAGTACCTGG + Intronic
982113173 4:152074502-152074524 AAACTGAGGCTCAGAGAAACTGG - Intergenic
985069571 4:186154876-186154898 AACCTGGAGCCCCCAGGACCAGG - Intronic
986874114 5:12085085-12085107 AGACTGGGGCTCCCAGGAACTGG + Intergenic
987434354 5:17875857-17875879 AGACTGGGTCTCCCCAAACCTGG - Intergenic
991210586 5:64099933-64099955 AAGCTGGGGCTCTAAAAACCTGG + Intergenic
994404518 5:99327906-99327928 AAACTGAGGCTTCAAGAAGCTGG - Intergenic
995677880 5:114683841-114683863 CAACTGGGGATCTCAGACCCAGG - Intergenic
997389448 5:133502011-133502033 CACCTGGGGCTTCCAGAAGCTGG + Intronic
997520420 5:134520088-134520110 AAACTGTGGATTCCAGAATCAGG - Intergenic
997887874 5:137647759-137647781 AAAATGGGGGTCTGAGAACCAGG + Intronic
999698347 5:154205802-154205824 CACCTGGGGCTACCAGAAGCTGG + Intronic
999797414 5:155001542-155001564 CACCTGGGGCTACCAGAAGCTGG + Intergenic
1001649042 5:173302293-173302315 AGCCTGGGGCTCCCAGCACAGGG - Intergenic
1002648532 5:180674261-180674283 AAACGGAGGCTCCCAGGGCCCGG + Intergenic
1004238344 6:13895733-13895755 CACCTGGGGCTACCAGAAGCTGG - Intergenic
1005463153 6:26087838-26087860 AGCCTGGGGCTCCTTGAACCTGG + Intronic
1006908019 6:37545959-37545981 AGACTGGGGCTCCCTGAGTCAGG - Intergenic
1007088638 6:39168053-39168075 AGACTGGGGCTCCCTGAGCTCGG - Intergenic
1007273073 6:40652971-40652993 AGACTGGGGCTCCCTGAGTCAGG - Intergenic
1007548277 6:42710123-42710145 ACACTGGGGCTCCCTGAGTCAGG + Intronic
1007548288 6:42710162-42710184 AGACTGGGGCTCCCTGAAGACGG + Intronic
1007707207 6:43798222-43798244 AAACTGGGGCTCCCTGAGTCAGG - Intergenic
1007750095 6:44066293-44066315 AGACTGGGGCTCCCTGAGTCAGG + Intergenic
1007750176 6:44066598-44066620 AGACTGGGGCTCCCTGAGTCAGG + Intergenic
1007750188 6:44066636-44066658 AGACTGGGGCTCCCTGAGTCAGG + Intergenic
1007750218 6:44066751-44066773 AGACTGGGGCTCCCTGAGTCAGG + Intergenic
1008071161 6:47100476-47100498 CAAATGGGGTTCCCAGAACCAGG - Intergenic
1008298997 6:49811227-49811249 ACACTGGGGATCCCAGAAAAGGG + Intergenic
1009636249 6:66268403-66268425 AAACTGGGAATGCCAAAACCTGG - Intergenic
1010848149 6:80737649-80737671 GCACTGGGGCTTCCAGGACCTGG + Intergenic
1013399763 6:109781436-109781458 AAACTGTGGCCCCCAGATCTGGG + Intronic
1013531649 6:111024758-111024780 AAACTAGGACTCACAGAGCCAGG + Intronic
1014227086 6:118861305-118861327 ACATTGGGGCTCCCTGAGCCAGG - Intronic
1014249381 6:119099911-119099933 AAACTGGAGATCCCAAATCCTGG - Intronic
1014310383 6:119792383-119792405 AAAATTGGGGTTCCAGAACCAGG - Intergenic
1015937175 6:138415750-138415772 AAACTTGGGATCCCAAAACATGG + Exonic
1016770915 6:147849775-147849797 AGACTGGGGCAGACAGAACCTGG + Intergenic
1017959401 6:159208719-159208741 AAACTGGGATCCCCAGAACTTGG + Intronic
1019607693 7:1918349-1918371 AGACAGACGCTCCCAGAACCAGG - Intronic
1022217903 7:28282466-28282488 CACCTGGGGCTGCCAGAAGCTGG + Intergenic
1022350517 7:29563548-29563570 AAACTTGGGATCCCGGGACCCGG + Intergenic
1023831836 7:44043992-44044014 AAACTGGTGCTCCCAGGAGGAGG + Intergenic
1026986590 7:74558976-74558998 TACCTTCGGCTCCCAGAACCTGG + Exonic
1028722546 7:94050181-94050203 CCAATGTGGCTCCCAGAACCAGG + Intergenic
1029207470 7:98878358-98878380 AAAAAGGAGCTCCTAGAACCTGG + Intronic
1029255548 7:99267093-99267115 AAACTGAGGCTCTCAGCAGCTGG - Intergenic
1029334851 7:99889869-99889891 AACCTGGGGCTACCAGAAGCTGG - Intronic
1030924431 7:115434316-115434338 AAATGGGGGCTACCAGAAGCTGG - Intergenic
1032004418 7:128288797-128288819 AGTCTGGGGCTACCAGAAGCTGG + Intergenic
1032436393 7:131904464-131904486 AAACTGGGGGCCCCACAACAAGG - Intergenic
1034626914 7:152500575-152500597 AAATTGGGGCTTCCAGGTCCAGG - Intergenic
1035221138 7:157407154-157407176 AGACTGGGCTTCCCAGAGCCAGG + Intronic
1037632144 8:20667756-20667778 AAACTTGGACTCATAGAACCAGG - Intergenic
1037920332 8:22801302-22801324 AGACTGGGGCTCACAGAGGCAGG + Intronic
1038969896 8:32621475-32621497 AAAATGGGGCTACCAGCAGCTGG - Intronic
1039022955 8:33227610-33227632 AAAGTGGGCCTCCCAGTGCCTGG + Intergenic
1039380813 8:37083304-37083326 CATCTGGGGCTACCAGAAGCTGG - Intergenic
1040063868 8:43128225-43128247 GAGCTGAAGCTCCCAGAACCTGG - Intergenic
1040784434 8:51148874-51148896 CAATTGGGGCTACCAGAAGCTGG + Intergenic
1042183435 8:66113869-66113891 TATCTGGCGCTCCCGGAACCTGG + Intergenic
1046871618 8:119210012-119210034 AAACTGGAGCTTGCAGAACATGG - Intronic
1047234357 8:123026583-123026605 AAACTGGGGATCAGTGAACCTGG + Intronic
1047249066 8:123167837-123167859 GATCTGGGGGTCCCAGAACCAGG + Intergenic
1047284903 8:123479624-123479646 AAGCTGCGGCTCCTAGAGCCAGG + Intergenic
1048571910 8:135663539-135663561 ACACTGGGGCATCCAGAACCAGG - Intergenic
1051037828 9:12770346-12770368 ATGCTGGGCCTCCCAGAAGCTGG + Intergenic
1052033721 9:23657143-23657165 AAACTGAGGCAGCCAGAGCCAGG - Intergenic
1053556859 9:39146274-39146296 CAACTGGGGCTCCCTGAGCAGGG - Intronic
1053820969 9:41966552-41966574 CAACTGGGGCTCCCTGAGCAGGG - Intronic
1054089838 9:60834691-60834713 CAACTGGGGCTCCCTGAGCAGGG - Intergenic
1054111249 9:61110249-61110271 CAACTGGGGCTCCCTGAGCAGGG - Intergenic
1054609608 9:67220876-67220898 CAACTGGGGCTCCCTGAGCAGGG + Intergenic
1055143680 9:72906864-72906886 AAAATGTGGCTTCCAGAGCCTGG + Intronic
1057209751 9:93193269-93193291 AAACCGAGGCTCGCAGAAACAGG - Intronic
1057290058 9:93800730-93800752 AAACTGGGTTTCCAAGAAACTGG - Intergenic
1058116410 9:101090043-101090065 TGTCTGGGGCTCCCAGAAGCTGG - Intronic
1058486066 9:105444579-105444601 AAACTGTCTCTCCCAGAACCAGG - Intergenic
1059999353 9:119944220-119944242 AAAGTGGGGATCCCAGAACCAGG - Intergenic
1060312532 9:122475263-122475285 TAACTGGGGATCCCAGTACCTGG - Intergenic
1060798277 9:126527124-126527146 AAACAGAGGCTCCGAGAACTAGG - Intergenic
1060976338 9:127767330-127767352 AAAATGGGGCTTCGAGATCCAGG - Intronic
1062017656 9:134299231-134299253 AAACTGGAGGTCCCTGAAGCTGG - Intergenic
1185932557 X:4219233-4219255 GTACTGGGGCTCCCAGCTCCTGG + Intergenic
1186800144 X:13084292-13084314 AAACTCTGGCTCCTAGACCCAGG - Intergenic
1188604139 X:32007343-32007365 CACCTGGGGCTACCAGAAGCTGG + Intronic
1189248666 X:39582764-39582786 CTACTGGGGCTACCAGAAGCTGG - Intergenic
1197419265 X:126217777-126217799 AGTCTGGGGCTACCAGAAGCTGG + Intergenic
1199196754 X:145041298-145041320 ATACTGGGACACCCAGAAGCTGG + Intergenic
1199298530 X:146186418-146186440 AAAATGGGGCTGCCACAACCTGG + Intergenic
1199548567 X:149033594-149033616 AAACAGGGGCTCCTAGAAGTTGG + Intergenic
1199613477 X:149636890-149636912 CACCTGGGGCTACCAGAAGCTGG + Intergenic
1199722406 X:150551332-150551354 CACCTGGGGCTACCAGAAGCTGG - Intergenic
1199973669 X:152878671-152878693 CACCTGGGGCTACCAGAAGCTGG + Intergenic
1200758782 Y:7016778-7016800 AAGCTGGAGCAACCAGAACCTGG - Intronic
1201473852 Y:14360331-14360353 GAACCCGGACTCCCAGAACCCGG - Intergenic
1202328008 Y:23712924-23712946 AACCTGGGCCTCCCAGATTCAGG - Intergenic
1202373338 Y:24212792-24212814 AAACTGGAGACCCCAGAACTTGG + Intergenic
1202497443 Y:25457328-25457350 AAACTGGAGACCCCAGAACTTGG - Intergenic
1202542762 Y:25957128-25957150 AACCTGGGCCTCCCAGATTCAGG + Intergenic