ID: 1141171406

View in Genome Browser
Species Human (GRCh38)
Location 16:81693954-81693976
Sequence GCTCAGGGGCAGAAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 624
Summary {0: 1, 1: 0, 2: 4, 3: 46, 4: 573}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141171406_1141171418 6 Left 1141171406 16:81693954-81693976 CCTTCCACCTTCTGCCCCTGAGC 0: 1
1: 0
2: 4
3: 46
4: 573
Right 1141171418 16:81693983-81694005 ACATGGGCAGGGACCTAGGCAGG 0: 1
1: 0
2: 1
3: 18
4: 201
1141171406_1141171410 -10 Left 1141171406 16:81693954-81693976 CCTTCCACCTTCTGCCCCTGAGC 0: 1
1: 0
2: 4
3: 46
4: 573
Right 1141171410 16:81693967-81693989 GCCCCTGAGCCTGTGCACATGGG 0: 1
1: 0
2: 2
3: 24
4: 213
1141171406_1141171419 11 Left 1141171406 16:81693954-81693976 CCTTCCACCTTCTGCCCCTGAGC 0: 1
1: 0
2: 4
3: 46
4: 573
Right 1141171419 16:81693988-81694010 GGCAGGGACCTAGGCAGGCAAGG No data
1141171406_1141171417 2 Left 1141171406 16:81693954-81693976 CCTTCCACCTTCTGCCCCTGAGC 0: 1
1: 0
2: 4
3: 46
4: 573
Right 1141171417 16:81693979-81694001 GTGCACATGGGCAGGGACCTAGG 0: 1
1: 0
2: 1
3: 24
4: 266
1141171406_1141171414 -6 Left 1141171406 16:81693954-81693976 CCTTCCACCTTCTGCCCCTGAGC 0: 1
1: 0
2: 4
3: 46
4: 573
Right 1141171414 16:81693971-81693993 CTGAGCCTGTGCACATGGGCAGG 0: 1
1: 0
2: 2
3: 34
4: 332
1141171406_1141171415 -5 Left 1141171406 16:81693954-81693976 CCTTCCACCTTCTGCCCCTGAGC 0: 1
1: 0
2: 4
3: 46
4: 573
Right 1141171415 16:81693972-81693994 TGAGCCTGTGCACATGGGCAGGG 0: 1
1: 0
2: 2
3: 35
4: 500

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141171406 Original CRISPR GCTCAGGGGCAGAAGGTGGA AGG (reversed) Intronic
900145353 1:1156838-1156860 GTTCAGGGCAAGAAGGTGGGGGG + Intergenic
900154400 1:1198216-1198238 GCTGAGGGGCACAGGGTGGTGGG - Intergenic
900278973 1:1853094-1853116 GCACAGGGGCAGGAGGGGAAAGG - Intronic
900541491 1:3205168-3205190 GGCCAGGGGCAGAAGGGGAAGGG + Intronic
900813030 1:4822396-4822418 GCTAAGGGGCATAAGGCAGAGGG - Intergenic
901143156 1:7048634-7048656 GCTCAGGGACAGGTGGTGGTGGG - Intronic
901387739 1:8922131-8922153 GAGCAGGGGCATACGGTGGAGGG - Intergenic
901638632 1:10682034-10682056 GGACAGGGACAGGAGGTGGAGGG - Intronic
901685022 1:10938974-10938996 GCGCAGGGACAGAGGGTGGGAGG + Intergenic
901693118 1:10986943-10986965 CCTGAGAGGCAGAAGGTGAATGG + Intergenic
901812621 1:11776523-11776545 GCCCAGGGGCAGCAGGAGCAAGG + Exonic
901869027 1:12126664-12126686 GCCCAGGGGCAGGAGGGGAAAGG + Intronic
902116023 1:14121911-14121933 GCCCAGAGGCAGAAGGTGCCTGG + Intergenic
902196662 1:14803460-14803482 CATCAGGGTCAGAAGGAGGATGG - Intronic
902681398 1:18046343-18046365 GCCCTGGGGCAGCAAGTGGAGGG - Intergenic
902779163 1:18693408-18693430 GCCCAGGGGCACAAGCTGGATGG + Intronic
902783045 1:18716819-18716841 GCGCAGGGGCTGAAGATGGAGGG - Intronic
903283128 1:22261549-22261571 GCTGAGGGACAGGAGGTGGTGGG + Intergenic
903789931 1:25885913-25885935 GCCAAGGGACAGGAGGTGGAGGG + Intronic
903943123 1:26945280-26945302 TCTCAGGTGCAGGATGTGGATGG + Intronic
904324622 1:29720278-29720300 GCCCAGAGGCAGCAGGTGCAGGG - Intergenic
904403997 1:30274521-30274543 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
904461022 1:30679858-30679880 GCTCCTGGACAGAAGGTGGCAGG + Intergenic
904987708 1:34565564-34565586 GTGAAGGGGGAGAAGGTGGAGGG + Intergenic
906078671 1:43069501-43069523 GCTCAGGGGAGGAGGGAGGATGG + Intergenic
906319435 1:44807233-44807255 GGCCAAAGGCAGAAGGTGGAAGG - Intergenic
907077071 1:51588541-51588563 ACTCAGGGGCTGAAGTGGGATGG + Intronic
907369651 1:53992657-53992679 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
907440374 1:54474937-54474959 GCGCAGGGGGAGCAGGTGGCGGG + Intergenic
907775184 1:57507154-57507176 GCTTAGGGCCAGATGGTGAAGGG - Intronic
908170602 1:61500915-61500937 GATCAGAAGCAGAAGTTGGAGGG - Intergenic
908360053 1:63359993-63360015 GCTGAGGTTCAGAAGGAGGAGGG - Intergenic
909099781 1:71336210-71336232 ACTGAGGGGCAGAAGTTAGAAGG + Intergenic
909238327 1:73180855-73180877 GCTCCTGGGCAGAAGGGGGCGGG - Intergenic
911462073 1:98203640-98203662 GGTCAGGGGCAGGGAGTGGAGGG + Intergenic
912445413 1:109732279-109732301 GCTCCAGGGCAGCAGGAGGAGGG + Intronic
912466956 1:109880992-109881014 AGTCAGGGGCAACAGGTGGAGGG + Intergenic
912560519 1:110548274-110548296 CCTGAGGGGCAGAAGTGGGAAGG - Intergenic
913211881 1:116589157-116589179 GCTCAGAGCCTGGAGGTGGATGG - Intronic
913539440 1:119804872-119804894 GGTGAGGGGCAGAAAGGGGAGGG - Intronic
914247372 1:145896252-145896274 TCTCAGGGTGAGAAGCTGGAGGG - Exonic
914911453 1:151790608-151790630 GCTCAGGGGCAGCCCGCGGAAGG - Intronic
915107331 1:153542617-153542639 GGTCAGGTGCAGAGGCTGGAGGG - Intergenic
915238448 1:154502399-154502421 GCGCAGCGACAGACGGTGGACGG + Intronic
915579045 1:156802488-156802510 GCCAAGGGGCAGAAGGAGAAAGG + Intergenic
915724466 1:158007796-158007818 GCACAGGGGCTGCTGGTGGATGG - Intronic
915929238 1:160048506-160048528 TCCCAGGGGCAGCAGGTGCAGGG + Intronic
916651792 1:166839979-166840001 GCTCCGGGGCAGAGGTGGGAGGG - Intronic
917452400 1:175157943-175157965 GTTCAGGGACAGAGGCTGGAAGG + Intronic
918014523 1:180620174-180620196 TCCCAATGGCAGAAGGTGGAAGG - Intergenic
919239183 1:194889553-194889575 GCTCCTGGGCAGAAGGAGGCAGG + Intergenic
919513468 1:198494250-198494272 GCTCCTGGGCAGAAGGGGGTTGG - Intergenic
920222076 1:204411450-204411472 GCTCAGCGGCTGGAGGTCGACGG + Exonic
920535505 1:206734113-206734135 CCTCAGGGGCAGGTGGTGGAGGG + Exonic
920744240 1:208611036-208611058 ACTCAGGAGGATAAGGTGGAAGG - Intergenic
921123066 1:212153406-212153428 AATGAGGGGCAGGAGGTGGAGGG - Intergenic
921310513 1:213838417-213838439 GCTCAGGGAAAGAAGATGGAAGG - Intergenic
922041703 1:221903889-221903911 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
924140836 1:241021644-241021666 GGTCAAGGGGAGGAGGTGGAAGG + Intronic
1062810509 10:459928-459950 GCTCACGTGCAGCAGGTGGTTGG - Intronic
1064811657 10:19206866-19206888 GCTGTAGGGCAGAAGGTGAATGG - Intronic
1065317941 10:24482909-24482931 GCTCAGGAGGCTAAGGTGGAAGG + Intronic
1066084421 10:31962485-31962507 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1068425577 10:56859334-56859356 GCTGATGGGCAGAGGCTGGAAGG - Intergenic
1069107138 10:64397100-64397122 ACTCAGGGGCATAAGGGAGAAGG + Intergenic
1069594807 10:69663749-69663771 GGTCGAGGGCAGAGGGTGGAGGG - Intergenic
1071264219 10:83949856-83949878 ACTCACAGGCAGAAGGTGAAGGG - Intergenic
1071289500 10:84177890-84177912 GCTCAGAGGCAGGAAGTTGAGGG + Intronic
1071524142 10:86348422-86348444 GCTCTGCGGCACAGGGTGGATGG + Intronic
1071957052 10:90770805-90770827 GCTCCTGGGCAGAAGGCGGTGGG + Intronic
1072001711 10:91201588-91201610 CCTCAGGGGCTGTGGGTGGAGGG - Intronic
1072309099 10:94137205-94137227 GCACAGGGACAGGAAGTGGAAGG - Intronic
1073915138 10:108394206-108394228 GCACAGGGGCAGGAGGAGTATGG + Intergenic
1074316864 10:112369044-112369066 GCTCAGGAGCCTAAGGTGGGAGG + Intergenic
1074846947 10:117406825-117406847 GCTCTGGGGCAGAGGGCGGAGGG + Intergenic
1074865776 10:117543613-117543635 AGCCAGGGGTAGAAGGTGGACGG - Exonic
1075094265 10:119460780-119460802 CCTCAAGGGCAGAAGATGCAGGG + Intergenic
1075593570 10:123710449-123710471 GATCAGGTGGAGCAGGTGGAGGG + Intronic
1075625098 10:123958282-123958304 ACTCAGGGGCAGGAGTGGGAAGG + Intergenic
1075948259 10:126455962-126455984 GCTCAGGAGCAGAACCTGAAAGG - Intronic
1076526452 10:131115374-131115396 CCCCAGGGGCAGAAGAGGGAGGG + Intronic
1076857934 10:133126756-133126778 CCTCAGGGGAAGAAGGTCGGAGG - Intronic
1076898975 10:133327847-133327869 GGACAGGAGGAGAAGGTGGAAGG - Intronic
1077285027 11:1761799-1761821 GCGCAGGTGCAGAGGGAGGACGG - Intronic
1077550720 11:3199073-3199095 GCTCAGGGGGAGATGGAGGCTGG - Intergenic
1077887240 11:6395210-6395232 CAGCAGGGGCAGAAGGAGGAAGG - Exonic
1078002166 11:7505720-7505742 ACTCAGGAGGAGAAGGTGGGGGG + Intronic
1078396949 11:10989548-10989570 ACTCAGAGGCAGAAGCTGCAGGG - Intergenic
1078841556 11:15080318-15080340 GATCAGAGGCTGAGGGTGGAAGG - Intronic
1079582409 11:22082170-22082192 ACTCAGGAGCCTAAGGTGGAAGG - Intergenic
1080668283 11:34354934-34354956 GCTCCAGGGCAGGAAGTGGAGGG - Intronic
1081698099 11:45132653-45132675 GCTCAGAGGCAGATTGTGAAAGG - Intronic
1082942726 11:58725608-58725630 ACTGAGGGGCAGAAGGCAGAAGG + Intronic
1082943076 11:58728412-58728434 ACTGAGGGGCATAAGGTGGAAGG - Intronic
1083211988 11:61193930-61193952 GAGCTGGGGCTGAAGGTGGAGGG - Intergenic
1083732681 11:64661232-64661254 GCTGCAGGGCACAAGGTGGAGGG - Intronic
1083739075 11:64698347-64698369 GGTCAGGGGCCGTAGGTGGTTGG - Intronic
1083747729 11:64744898-64744920 GCGCAGGGGCGGAGGGGGGAGGG - Intronic
1084553313 11:69862024-69862046 GCTCAGGGGCAGGCAGTGGTGGG - Intergenic
1084670403 11:70603433-70603455 GGTCAGGGTCAGGATGTGGAGGG - Intronic
1085242305 11:75068196-75068218 GCTCAGGGAGAGAGGGTGGGTGG - Intergenic
1085850668 11:80115802-80115824 GTACATGGGCAGAGGGTGGATGG + Intergenic
1086089109 11:82987343-82987365 GCTCTAGGGAAGAAGTTGGATGG - Intronic
1086973403 11:93107165-93107187 GCTGAGAGACAGAAGCTGGATGG + Intergenic
1087036237 11:93758820-93758842 GTTCCGGGGCAGAAGGGGGCGGG + Intronic
1087953775 11:104258078-104258100 GTTCAGGGACAGAAGGTGCTTGG + Intergenic
1088432466 11:109773915-109773937 CCTCAGAGGGAGAAGGAGGAAGG - Intergenic
1088880335 11:113968740-113968762 GACCTGGGGCAGAAGGTGGTTGG - Intergenic
1089293989 11:117457263-117457285 GCTCTGGGGCAGAGGGCTGAAGG + Intronic
1089398961 11:118153442-118153464 GCGATGGGGCAGAAGGTGGCGGG - Intergenic
1089441904 11:118524586-118524608 GTTCATGGGCAAAAGGAGGAAGG - Exonic
1089640433 11:119844246-119844268 GGGCAGGGGCAGGGGGTGGAGGG - Intergenic
1090077997 11:123591484-123591506 GTTCAGCGGCAGCAGGTGCATGG - Intronic
1090130943 11:124141623-124141645 GCTGAGATGCAGAAGGAGGACGG - Exonic
1090137057 11:124209812-124209834 GCTCCTGGGCAGAAGGTGGCGGG - Intergenic
1090490267 11:127154574-127154596 ATTCAGGGGCAGACTGTGGAAGG - Intergenic
1090728351 11:129547756-129547778 GGTAATGGGCAGAAGTTGGAAGG + Intergenic
1090939344 11:131373653-131373675 TCTCAGTGGCAGAAGGTGGGCGG - Intronic
1091192840 11:133708717-133708739 AGTCAGAGGCACAAGGTGGAGGG - Intergenic
1091704916 12:2687213-2687235 GGGCAGGGGCAGGAGGTGGAAGG + Intronic
1091713376 12:2758848-2758870 GCTCAGGGGGAAAGGGTGGGAGG + Intergenic
1091981183 12:4865455-4865477 GCTCAGGACCAGCAGGTGGCTGG + Intergenic
1092260839 12:6952545-6952567 GGTGAGGGGCAGACGGAGGAAGG - Intronic
1093493030 12:19726162-19726184 GCTCCTGGGCAGAAGGAGGTGGG - Intergenic
1093756905 12:22862900-22862922 ACGTAGGGGTAGAAGGTGGAGGG + Intergenic
1095612741 12:44149220-44149242 GCTCTGGGGCAGAAGGAAGCTGG + Intronic
1095971735 12:47906079-47906101 GCTCAGAGGGACAAGGTGAAAGG + Intronic
1096000338 12:48124564-48124586 GCTCAGGATCAGAAGGTGGAAGG - Intronic
1096400158 12:51299394-51299416 GGTCAGGGGAAGAAGAGGGATGG - Intronic
1096417293 12:51425101-51425123 GCTCGGGGGCAGAAGGAAGGAGG - Intronic
1096607501 12:52777166-52777188 GCTCTGGGGGAGCTGGTGGAGGG - Exonic
1096647325 12:53045971-53045993 ACCCTGGAGCAGAAGGTGGAGGG - Intergenic
1098204234 12:68090368-68090390 TCTAAGGGGCAGAAGGAGGGAGG - Intergenic
1098393009 12:69989392-69989414 CCTCAAGGGAGGAAGGTGGAAGG + Intergenic
1098951574 12:76645308-76645330 GCTCCTGGGCAGAAGGGGGCGGG + Intergenic
1100285114 12:93157773-93157795 CCACAGGGGCTGAAGCTGGATGG + Intergenic
1100287165 12:93177925-93177947 GCTCAGGCACAGAAGGTGGGGGG + Intergenic
1101407256 12:104439447-104439469 ACTAAGGGGCAGAAGGCAGAAGG - Intergenic
1101445148 12:104732136-104732158 GCTCAGAAGCAGGAGGTGGCAGG + Intronic
1101736266 12:107465578-107465600 GCTCAGGGGCAGGGGGTGCTGGG + Intronic
1101938392 12:109079470-109079492 GCTCAGGGGGCTAAGGTGGGAGG - Intronic
1102469668 12:113152684-113152706 GATCAGGGACAACAGGTGGAAGG + Intronic
1103552401 12:121747247-121747269 GCACTGGGGTAGAAGGTGGGAGG + Intronic
1103552618 12:121747873-121747895 GCACTGGGGTAGAAGGTGGGAGG + Intronic
1103552632 12:121747915-121747937 GCACTGGGGTAGAAGGTGGGAGG + Intronic
1103552646 12:121747957-121747979 GCACTGGGGTAGAAGGTGGGAGG + Intronic
1103552660 12:121747999-121748021 GCACTGGGGTAGAAGGTGGGAGG + Intronic
1103552674 12:121748041-121748063 GCACTGGGGTAGAAGGTGGGAGG + Intronic
1103552688 12:121748083-121748105 GCACTGGGGTAGAAGGTGGGAGG + Intronic
1103552716 12:121748165-121748187 GCACTGGGGTAGAAGGTGGGAGG + Intronic
1103552736 12:121748227-121748249 GCACTGGGGTAGAAGGTGGGAGG + Intronic
1103561856 12:121797075-121797097 GCTCAGGGGCAGGAGCTTGCTGG + Intronic
1103571385 12:121847284-121847306 GCTCAGGGACAGATTCTGGAAGG - Intronic
1104603409 12:130169144-130169166 GCTAGGGGGAAGCAGGTGGATGG + Intergenic
1104797859 12:131532143-131532165 GCTCACAGGTAGAAGATGGAGGG - Intergenic
1104856695 12:131905486-131905508 GCTCAGGGGTAGAAGTGGGATGG + Intronic
1106065858 13:26348541-26348563 GGGAAGGGGCAGATGGTGGATGG - Intronic
1107133234 13:36919204-36919226 GGTCAAGGGCAGGAGGAGGAAGG + Intronic
1108718387 13:53105023-53105045 GCTGAGGGGCATAAGGCAGAAGG + Intergenic
1109582172 13:64355111-64355133 GTTGAAGGGTAGAAGGTGGATGG + Intergenic
1110439967 13:75516880-75516902 CCATAGTGGCAGAAGGTGGAAGG - Intergenic
1110911213 13:80966412-80966434 TTTCAGGAGCAGAAGTTGGATGG + Intergenic
1114186072 14:20403568-20403590 GCTCATGGGCATATGGTGCAGGG - Intronic
1114194965 14:20469231-20469253 GCCCCGGGGCAGAAGGTTTAGGG + Intronic
1114200215 14:20513103-20513125 GCTTAGGGAGAGAAGCTGGACGG - Intergenic
1115035745 14:28854352-28854374 ACTCAGGAGCTGGAGGTGGAAGG + Intergenic
1115059071 14:29168637-29168659 GCTCAGGGAGAGAGGGTGAAGGG + Intergenic
1115548226 14:34482038-34482060 ACTCAGGAGCCCAAGGTGGAAGG + Intergenic
1116791772 14:49346942-49346964 CCTGAGGGGCAGAAGGAGAAGGG - Intergenic
1117099715 14:52333881-52333903 GCTGAGGGGCATAAGGCAGAGGG + Intergenic
1117344548 14:54819513-54819535 GCTCAGGGGCCGAATCTGGCTGG - Intergenic
1118377723 14:65191579-65191601 CCTCAAGGGCAAAAGGAGGAAGG + Intergenic
1118758545 14:68863468-68863490 GCAGAGGTGCAGAAGATGGAAGG + Intergenic
1119197284 14:72726456-72726478 GCTGATGGGCAGAGGGAGGATGG - Intronic
1119442495 14:74637672-74637694 GATGAGGGGCAGAAGGGAGACGG - Intergenic
1120019946 14:79517430-79517452 GCTCAGGGGCAAAAGCTGTAAGG - Intronic
1121047094 14:90796155-90796177 CCTCTGGGGCAGAGGCTGGATGG + Intronic
1121303075 14:92887295-92887317 GCTCATGGACAGAAGGATGAAGG + Intergenic
1121604292 14:95229244-95229266 GCTCTGGGTGAGAAGGGGGATGG - Intronic
1122225549 14:100275715-100275737 GCTCACAGGCAGAAGGGAGAGGG - Intronic
1122231297 14:100307319-100307341 GCTCAGGCGCTGAAGTCGGAGGG + Intergenic
1122480083 14:102041589-102041611 GATCAGGAGCAGGCGGTGGATGG - Exonic
1122719276 14:103713112-103713134 GGGCAGGGGCAGAGGATGGAAGG - Intronic
1122969728 14:105147658-105147680 GGGCAGGGGCAGCAGGGGGAGGG + Intronic
1123431008 15:20216330-20216352 ACTGAGGGGCAGAAGGCAGAAGG - Intergenic
1123956649 15:25342807-25342829 GTTGAGGGGCAGGTGGTGGAGGG - Intronic
1124098657 15:26672614-26672636 GTTCAGGGGCTGGAGGTGGAGGG - Intronic
1124391841 15:29266295-29266317 TCACAGGGGGTGAAGGTGGAGGG + Intronic
1125594566 15:40876070-40876092 GCAGAGGTGGAGAAGGTGGAAGG + Intergenic
1125638939 15:41213596-41213618 GCTGAGTGGGAGGAGGTGGAGGG - Intronic
1125832009 15:42723648-42723670 GCACAGGGGCTGAAGGTACAGGG + Exonic
1126713053 15:51483222-51483244 GCTCACTGGCGGTAGGTGGAGGG - Intronic
1127271828 15:57408613-57408635 GCTCAGGAGGCCAAGGTGGAAGG - Intronic
1127931555 15:63600502-63600524 GTGCAGGGGCAGAAAGAGGAGGG + Intronic
1128096331 15:64959177-64959199 CCTGAGGGGCAGGAGGGGGAGGG + Intergenic
1128179500 15:65589264-65589286 ACTCAGGGGGCGGAGGTGGAAGG - Intronic
1129539128 15:76336832-76336854 GGCCAGGGGCAGAAGGACGAGGG - Exonic
1131418263 15:92279466-92279488 GTTCAGGCCCAAAAGGTGGAGGG - Intergenic
1131604317 15:93884932-93884954 GCTGAGGTCCAGAAGGTGAATGG - Intergenic
1132641289 16:979765-979787 TCCCAGGGGCAGGGGGTGGAAGG + Intronic
1132716100 16:1290553-1290575 GCTGAGGGGCAGAAGGCAGAAGG + Intergenic
1133050249 16:3113349-3113371 GCTCCTGGCCAGAAGCTGGAGGG + Exonic
1133100504 16:3476378-3476400 CCTCAGGTGCAGAAGCTGGGCGG + Intronic
1133836881 16:9375368-9375390 GCTCAAGCCCAGAAGGTCGAGGG - Intergenic
1135042653 16:19129890-19129912 GCTGAGGGGCAGAAGGCAGAAGG - Intronic
1135046724 16:19162030-19162052 GTTCAAGGGAAGAAGGTGAAAGG + Intronic
1136134890 16:28249711-28249733 ACTAAGGGCCAGGAGGTGGAAGG + Intergenic
1136853645 16:33634917-33634939 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1137253439 16:46756972-46756994 GGTGAGGGGCAGGAGGAGGAAGG + Intronic
1137295844 16:47092528-47092550 GCTCAGAGGCTGCAGGTGGCTGG + Intronic
1137469731 16:48743564-48743586 CCTCAGTGACAGAAGGTGGTTGG - Intergenic
1138033552 16:53580187-53580209 GCTCTTGGGCAGAAGGGGGCAGG - Intergenic
1139374712 16:66489734-66489756 GCACAGAGGCAGAGGCTGGAGGG + Intronic
1139673178 16:68505536-68505558 TCTCAGAGGCAGAAGGTGAGGGG + Intergenic
1140014527 16:71168702-71168724 GCTGCAGGGCAGAAGGAGGAGGG + Intronic
1140128056 16:72134209-72134231 ACTGAGGGGCAGAAGGCAGAAGG - Intronic
1141171406 16:81693954-81693976 GCTCAGGGGCAGAAGGTGGAAGG - Intronic
1141635239 16:85310894-85310916 GCTCAGGGGCTGGGGATGGAGGG + Intergenic
1142286342 16:89173062-89173084 CCTCAGGGGCAGCTGCTGGAGGG - Intronic
1203115236 16_KI270728v1_random:1483362-1483384 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1142765168 17:2060439-2060461 GCACAGGAGCCGAGGGTGGAAGG + Exonic
1143284917 17:5781766-5781788 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284940 17:5781890-5781912 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143284957 17:5781980-5782002 GCTCAGGTGCAGGTGGAGGATGG + Intronic
1143941534 17:10547404-10547426 GCTCAGTGGAAGAAGCAGGATGG + Intronic
1144180423 17:12746382-12746404 GTAGAAGGGCAGAAGGTGGAAGG + Intronic
1144285907 17:13774243-13774265 GCTCAGGAGGCTAAGGTGGAAGG + Intergenic
1144493196 17:15731890-15731912 GATAGGGGGCAGAAGGTTGAGGG - Intergenic
1144734215 17:17545987-17546009 GCCCAGGGACAGAAGATGGAAGG - Intronic
1144907060 17:18644762-18644784 GATAGGGGGCAGAAGGTTGAGGG + Intronic
1144935104 17:18891739-18891761 GCCGAGGGACAGAAGGTGAAGGG - Intronic
1145886346 17:28384833-28384855 CCCCAGGAGCAGCAGGTGGATGG + Exonic
1145901632 17:28493946-28493968 GCTCAGGGCCACAGGGTGGAGGG - Intronic
1145959468 17:28879100-28879122 CATCACAGGCAGAAGGTGGAGGG - Intergenic
1146376624 17:32298900-32298922 GGGAGGGGGCAGAAGGTGGAAGG - Intronic
1146812339 17:35914041-35914063 GCACATGGTCTGAAGGTGGAAGG + Intergenic
1146816334 17:35944966-35944988 GCTAGGGGGCTGGAGGTGGAGGG - Intergenic
1146906485 17:36621514-36621536 GAGCAGGGGCACAAGGTGCAGGG - Intergenic
1148022930 17:44565629-44565651 GCTCAGGGACAAGAGGTGGAGGG - Intergenic
1148367687 17:47069032-47069054 GTTGAGGGGCAGCTGGTGGAAGG - Intergenic
1148756750 17:49977109-49977131 TCCCAGGGGCAGAAGGTGAATGG - Intergenic
1148798709 17:50210055-50210077 CCTGAGGCCCAGAAGGTGGAGGG + Intergenic
1148852504 17:50561727-50561749 GCGCGGGGTCAGAAGGGGGACGG + Intronic
1149142363 17:53447773-53447795 GGTCATCGGCAGAAGGTGAAGGG + Intergenic
1149259612 17:54864517-54864539 GCTAAGGGGCAGCAGGTCAAAGG - Intergenic
1149884642 17:60328041-60328063 GCTCCTGGGCAGAAGGGGGCAGG + Intronic
1150531199 17:65983643-65983665 ACTCATGGTTAGAAGGTGGAGGG - Intronic
1150650245 17:67005428-67005450 TCAGAGGGGCAGAAGGTGGGTGG - Intronic
1151214271 17:72567202-72567224 GGTCAGGGGCAGGAGGAAGATGG - Intergenic
1151238579 17:72739710-72739732 GCTCTGAGGCTGAAGGTGGCTGG + Intronic
1151482608 17:74379277-74379299 GCTCAGGAGGCTAAGGTGGAAGG + Intergenic
1152190709 17:78885691-78885713 TGTGAGGGGCAGGAGGTGGAGGG + Intronic
1152393396 17:80016593-80016615 GCTCTGGGACAGAGGGTGGGTGG + Intronic
1152603003 17:81274548-81274570 GCTGCGGGACAGAAGATGGATGG + Intronic
1152630323 17:81408083-81408105 ACACAGGGGCAGCAGGAGGAAGG - Intronic
1153895064 18:9551396-9551418 GCCCAGGGCCAGATGGTGGCTGG + Intronic
1153927134 18:9843962-9843984 GCTCTGGGGCAGGTGGAGGAAGG + Intronic
1154507923 18:15060881-15060903 GTTCATGGGCAGAAGGGGGCAGG + Intergenic
1155162032 18:23203913-23203935 CCTCAGTGGCAGAAGGCGGCAGG + Intronic
1155941043 18:31802388-31802410 GGTGAGGGGGAGAATGTGGAGGG - Intergenic
1157021208 18:43784407-43784429 GCACAGAGGCAGAGGGTGGTGGG + Intergenic
1157042918 18:44061225-44061247 GCTCTGGGGCAGAATGGGGCAGG - Intergenic
1157643176 18:49238913-49238935 GCTGAGGGGCAGCATTTGGAGGG - Intronic
1157957457 18:52114390-52114412 GCTCAGGCAAAGAAGGAGGAAGG + Intergenic
1158023393 18:52869562-52869584 GCTCCTGGGCAGAAGGGGGTGGG - Intronic
1158198096 18:54910590-54910612 GCTCCTGGGCAGAAGGGGGCAGG - Intronic
1158896189 18:61915934-61915956 CCTCTGGGGGAGAAGGTGGGTGG - Intergenic
1158931881 18:62330743-62330765 GTGCAGGGGCAGAAGGTGCAGGG + Intronic
1159700644 18:71622377-71622399 GGTCATGGCCAGAGGGTGGAAGG - Intergenic
1159766912 18:72502562-72502584 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
1160158818 18:76455441-76455463 GCTCAGGGACAGATGGAGGCTGG + Intronic
1160494546 18:79364919-79364941 GCTCAGGGGGCTAAGGTGGAAGG + Intronic
1160510815 18:79452388-79452410 GCTCCGGGGCTGAACTTGGAAGG + Intronic
1160727594 19:624504-624526 GCTCAGGGGGACGAGGTGGTCGG - Intronic
1160919182 19:1511928-1511950 GCTCCGGGGCAGCCCGTGGAGGG + Intronic
1161312113 19:3600494-3600516 GCTCAGGGCCAGCAGGTTGGAGG + Exonic
1161367918 19:3891670-3891692 GCTCAGTGGAAGCAGGTTGAGGG + Intronic
1161393307 19:4032297-4032319 GCTGAGGGCCAGGTGGTGGATGG + Intronic
1161483892 19:4524606-4524628 GTTCAGGGAGAGAATGTGGAGGG + Intronic
1161554535 19:4933137-4933159 ACTCAGGGGCACAAGGTGGTCGG - Intronic
1161578184 19:5066323-5066345 GCACAGGGGCAGTGGGTGGGTGG - Intronic
1161743734 19:6042074-6042096 GCCCAGGTGCAGTACGTGGAAGG - Exonic
1161819689 19:6522266-6522288 CCTCAGAGGCAGAAGAAGGAGGG + Intergenic
1162310973 19:9907027-9907049 GCTCGGGGGCAGAGGGGGCAAGG + Intronic
1162937139 19:13986905-13986927 GCCCAGGGGCAGGAGGCAGAGGG - Intronic
1163126383 19:15246438-15246460 GACCCGGGGCAGAAGGCGGAAGG + Intronic
1163425712 19:17240078-17240100 GCTCAGGGGACCCAGGTGGACGG - Intronic
1163440977 19:17322435-17322457 GCAAAGGCGGAGAAGGTGGAAGG - Exonic
1163477103 19:17532845-17532867 GCTCAGGGACTGAGGGAGGAAGG + Intronic
1164465614 19:28485114-28485136 ACTAAGGGGCATAAGGTAGAGGG + Intergenic
1164528225 19:29027373-29027395 GAGCAGGGACAGAAGGTGAAGGG + Intergenic
1164635983 19:29791856-29791878 GCTCAGGGCCAGAATGAGCAGGG - Intergenic
1164995794 19:32719938-32719960 GCCCAGGCGCTAAAGGTGGAGGG + Intronic
1165065866 19:33227275-33227297 TCTCTGGGGCTGGAGGTGGAGGG - Intergenic
1165328677 19:35128808-35128830 GCTCAGGGGTAGTGAGTGGAGGG - Intronic
1166210401 19:41303208-41303230 GCTCATGGTCAGATGGGGGAAGG - Intronic
1166226905 19:41401635-41401657 GCTCAGGGAAAGGAGGAGGAAGG + Intronic
1166719169 19:44987665-44987687 GGTCTGGGACAGAAGGAGGAAGG - Intronic
1166996649 19:46722684-46722706 GCTCAGGGCCTGAGGGTGCAGGG + Intronic
1167331479 19:48859072-48859094 GCGCAGGGGCAGAACGGGGACGG + Exonic
1167346221 19:48947125-48947147 GCTCCTGGGCAGAAGGGGGCAGG + Intergenic
1168485645 19:56759927-56759949 GCCCAGGTGCAGCAGGTGCAGGG + Intergenic
925083293 2:1087056-1087078 GCTAAGGAGCAGAAGGAGGGTGG + Intronic
925769158 2:7265516-7265538 GCTCAGTGTCAGGAGGAGGAGGG + Intergenic
925781486 2:7386210-7386232 CATCAGGGGTGGAAGGTGGAAGG + Intergenic
926065797 2:9838825-9838847 GCGCAGGTGCATGAGGTGGAAGG - Intergenic
926128495 2:10286139-10286161 GCCCAGGGGCAGCAGCGGGAGGG + Intergenic
926153290 2:10436234-10436256 GCCCAGGAGCAGAAGCTGGCTGG + Intergenic
926186153 2:10692445-10692467 ACTCAGGAGGATAAGGTGGAAGG - Intergenic
926309642 2:11666228-11666250 CCTCTGGGGCAGCAGCTGGAAGG - Intronic
926561741 2:14425432-14425454 GCTCAGCAGCAGTAGGTGGCTGG - Intergenic
927533879 2:23836999-23837021 GCTCCTGGGCAGAAGGGGGTGGG - Intronic
928394734 2:30934745-30934767 GCTCAGAGGCAGAGCGTTGAGGG - Intronic
928553530 2:32398237-32398259 GCACAGAGGCATAAAGTGGATGG + Intronic
929095862 2:38262736-38262758 GCTCAGGCCAAGAATGTGGAGGG - Intergenic
929835293 2:45391001-45391023 GATCAGGGGCAGAGGTAGGACGG + Intronic
929898279 2:45980178-45980200 GCTCAGTGGCAGAAGGGGCCTGG + Intronic
930611991 2:53554162-53554184 GCTCCTGGGCAGAAGGGGGAGGG + Intronic
931333269 2:61311248-61311270 CCTCACAGGCAGAGGGTGGAAGG - Intronic
932208244 2:69903175-69903197 CTTCAGGGTAAGAAGGTGGATGG + Exonic
934690375 2:96354065-96354087 GCTCAGGGGAAGGAGGAGGCTGG + Intronic
934778839 2:96956132-96956154 ACTCGGGGGCGGAAGTTGGAAGG - Intronic
934782791 2:96982953-96982975 GCTCAAGAGCTGAAGGTGGCAGG - Intronic
935277025 2:101483936-101483958 CATAAGGGACAGAAGGTGGAAGG - Intergenic
935534984 2:104283569-104283591 GCTCAGGAGCAGAGGGAGGGGGG + Intergenic
937026383 2:118701410-118701432 GCTCAGTGGCACAAGAGGGATGG + Intergenic
937032420 2:118751917-118751939 GCTCTGGGGTATATGGTGGAAGG + Intergenic
937122707 2:119451927-119451949 CCACAGGGGCAGAGGGTGGAAGG - Intronic
937468742 2:122157315-122157337 CCTCAGGGACAGAAGGAGCAAGG + Intergenic
937921538 2:127135086-127135108 GCTCAGGGGCGGGGGGTGGGGGG - Intergenic
939577771 2:143916748-143916770 CCTCAAGGGCAGAAGGCAGAAGG + Intergenic
940283541 2:152011283-152011305 CCTCAAAGGAAGAAGGTGGAGGG - Intronic
940289658 2:152066217-152066239 GCTCTGGAGCAGGAGGTGAAAGG - Intronic
940405852 2:153301085-153301107 ACTCAGGGGCCTGAGGTGGAAGG + Intergenic
940753652 2:157657218-157657240 GCTCAGGAGCACAGGGTGAATGG - Intergenic
940854886 2:158722324-158722346 CCTCAGGGGCAGCAGGTCCAGGG + Intergenic
940868438 2:158839468-158839490 ACTGAGGGGCATAAGGTAGAGGG - Intronic
941588198 2:167385618-167385640 GCTGAGGGGCAGAGGGTTTATGG + Intergenic
941688421 2:168471252-168471274 GCTCAGGGCCAAAAGGTAAAAGG - Intronic
941915922 2:170813916-170813938 GCTCAAAGGCAGAAGAAGGAGGG - Intronic
942795497 2:179814148-179814170 CCTCAGGGGCAGAAGGGGCTGGG + Intronic
945128152 2:206536413-206536435 TACCAGGGGCAGGAGGTGGAGGG + Intronic
946149624 2:217755489-217755511 GGGTAGGGGTAGAAGGTGGAGGG - Intronic
946178039 2:217933788-217933810 GCACACGGGCAGAAGCTGGGTGG + Intronic
946307581 2:218864996-218865018 GGGCAGGGGCAGAAGGAGGCTGG + Intronic
947156887 2:227171729-227171751 ACTGAGGGGCAGAAGGCTGAAGG + Intronic
947161751 2:227222231-227222253 GCTCAGGGGCAGGGGGCTGAAGG - Intronic
948091780 2:235301718-235301740 GATGAGGGGGAGAAGGGGGAAGG - Intergenic
948424893 2:237880983-237881005 GGGCAGGGGCAGGAGGAGGAGGG - Intronic
948526819 2:238575936-238575958 GCGCAGTGGCTGAAGGAGGAGGG - Intergenic
948575419 2:238946760-238946782 GCTCCTGGGCAGAAGGGGGAGGG - Intergenic
949022342 2:241748695-241748717 CACCAGGGGCTGAAGGTGGAGGG - Intronic
949061033 2:241957443-241957465 GGTGAGAGCCAGAAGGTGGAGGG + Intergenic
1168889044 20:1281948-1281970 GCCATGGGGCAGAGGGTGGAGGG + Intronic
1169318014 20:4609205-4609227 GAGCAGGGGCAGAAGGAAGAGGG + Intergenic
1170024364 20:11872923-11872945 GCTCAGGGGCAGCCTTTGGAAGG - Intergenic
1170044633 20:12072253-12072275 GGTCAGAGGCAGAGGCTGGAGGG + Intergenic
1170255193 20:14334642-14334664 CCTCTGGGGCAAAAGGTGGGGGG + Intronic
1171112012 20:22492787-22492809 GCTCAGGGAGAGAAAGTGTATGG + Intergenic
1171236923 20:23534938-23534960 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
1171491945 20:25526131-25526153 TCACAGGGGCAGAATGGGGAAGG - Intronic
1172046562 20:32084565-32084587 CCACAGGGCCAGAGGGTGGAGGG + Intronic
1173047087 20:39522837-39522859 GCTCAGGGTGAGAATGTGTAAGG + Intergenic
1173833469 20:46108902-46108924 GCTCTGGGGCAGAAGGTCACAGG + Intergenic
1173884585 20:46446012-46446034 GCTCCTGGGCAGAAGGGGGCAGG - Intergenic
1174403008 20:50285961-50285983 CCTCTGGGCCAGAAGGTGAAAGG + Intergenic
1174458788 20:50668329-50668351 CATCAGGGGCAGGAGGAGGAAGG - Intronic
1175190732 20:57210768-57210790 GCCCAGGGGCAGGAGGCTGAAGG - Intronic
1175631005 20:60536385-60536407 ACTGAGGGGCAGAAGGCAGAAGG + Intergenic
1175939815 20:62532767-62532789 GCTGGGGGGCTGAAGGTGCAAGG + Intergenic
1175986691 20:62767726-62767748 GCTCAGAAGCAGATGGTGGCTGG - Intergenic
1176790160 21:13310918-13310940 GTTCATGGGCAGAAGGGGGCAGG - Intergenic
1178467104 21:32858787-32858809 GCTCCTGGGCAGAAGGAGGTGGG - Intergenic
1179211082 21:39324945-39324967 GGCCAGGGGCTGGAGGTGGAAGG + Intergenic
1179481424 21:41681270-41681292 GCTCAGGGCGAGGAGGCGGAAGG - Intergenic
1179639514 21:42738136-42738158 GCACAGGGACAAAGGGTGGATGG - Intronic
1179640587 21:42745155-42745177 TCTCAGAGGCAGAAGGTGAAGGG + Intronic
1180075424 21:45459279-45459301 GGTGAGGGGCAGGAGGAGGAGGG + Intronic
1181214116 22:21311268-21311290 GCTCAGGTGGAGAACGTGAAGGG - Intergenic
1181728455 22:24827583-24827605 GCTCATGGGCATCAGGTGAACGG - Intronic
1182058369 22:27378954-27378976 GCCCAGTGGCTGCAGGTGGAGGG - Intergenic
1182414194 22:30210473-30210495 GTTTTGGGGCGGAAGGTGGAAGG + Intergenic
1182657784 22:31903676-31903698 GCTTAGGTGTGGAAGGTGGAGGG - Intronic
1183032031 22:35113672-35113694 GCTCAGTGGCACCAGGGGGAAGG - Intergenic
1183175992 22:36225135-36225157 GCTCAGGGAGTCAAGGTGGAAGG + Intergenic
1183182352 22:36268598-36268620 ACTCAGGGGGTCAAGGTGGAAGG - Intergenic
1183933248 22:41248063-41248085 GCTCAGGCGCAGACGGGGGCTGG + Intronic
1184100317 22:42338507-42338529 GCTCAGGGGCTGCGAGTGGAAGG + Intronic
1184109911 22:42388619-42388641 GCTCAGAGGCAGGAGGAGGGCGG + Intronic
1184664202 22:45978766-45978788 GCGCAGGGGCTGGAGGTGGCGGG + Intergenic
1184805633 22:46793294-46793316 ACTCAGTGGCAGGAGGGGGAGGG - Intronic
1185011587 22:48317610-48317632 GCCCAGGGGTAGAAGGTGGCAGG + Intergenic
1185303397 22:50097219-50097241 GCTCAGGTGGCTAAGGTGGAAGG - Intronic
949983508 3:9519665-9519687 GCTCAGGAGGATGAGGTGGAAGG - Intronic
950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG + Intergenic
950572635 3:13811523-13811545 GCTCTGGCTCAGAGGGTGGAAGG + Intergenic
952220584 3:31320287-31320309 TCTCAGGTGCAGAAGTTGAAAGG - Intergenic
952830683 3:37562257-37562279 GCTCCGGGGCAGAAATAGGAGGG - Intronic
952906626 3:38143324-38143346 GCTCAGGGGCTGGAGTTGGGGGG - Intergenic
954281266 3:49580187-49580209 ACTCAGGGGAATAAGGTGGGAGG - Intronic
954407130 3:50351498-50351520 GCCCAGGGCCACAAGGTGGGCGG - Exonic
954418233 3:50404602-50404624 GCTCAGGGGCAGGACATGGGAGG + Intronic
954447963 3:50556861-50556883 GCTAGAGGGCAGAAGGTGGGTGG + Intergenic
954626578 3:52025153-52025175 GCTCCGGGGCAGGAGAGGGATGG + Intergenic
954646222 3:52133203-52133225 CCTCACATGCAGAAGGTGGAAGG - Intronic
955980800 3:64525362-64525384 GTGCAGGCGCAGAGGGTGGAGGG - Intronic
956115236 3:65911391-65911413 GCTCTGGGGCTGCTGGTGGAGGG - Intronic
956462330 3:69484983-69485005 CCTCCTGGGCAGAAGGTGGGGGG - Intronic
956494994 3:69815402-69815424 GCTGAGGGGGAGAAGGAAGAGGG - Intronic
956786534 3:72647509-72647531 GCCAAGGGGCAGCAGGTGCAGGG + Intergenic
957387986 3:79521782-79521804 TCTCAGGAGCAGACCGTGGATGG - Intronic
957426996 3:80051677-80051699 GCTCCTGGGCAGAAGGAGGCTGG + Intergenic
958781110 3:98543440-98543462 ACTGAAGAGCAGAAGGTGGAAGG - Intronic
959562751 3:107801281-107801303 GGTTAGTGGTAGAAGGTGGAAGG + Exonic
959991071 3:112632831-112632853 GCCCGGGGCCAGAACGTGGAGGG - Intronic
960149159 3:114232822-114232844 GCTCAGAGGCACCAGCTGGAGGG + Intergenic
960365920 3:116772234-116772256 GCTCAAGGGCAGCAGGAAGAAGG - Intronic
960551582 3:118981894-118981916 CCTCAGGGCCAGCAGGAGGAAGG - Intronic
960634257 3:119768189-119768211 GCTCCTGGGCAGAAGGGGGCAGG - Intergenic
960655686 3:120001459-120001481 AATCATGGGCAGAAGGTGAAGGG - Intronic
961173779 3:124817564-124817586 CCTCAGTGGGAGAGGGTGGAAGG + Intronic
961174338 3:124821474-124821496 CCTGAAGGACAGAAGGTGGATGG + Exonic
961805221 3:129484276-129484298 CCTGGGGTGCAGAAGGTGGAGGG - Intronic
961826362 3:129601324-129601346 GTTCTCGGGAAGAAGGTGGAGGG + Intronic
962110758 3:132444119-132444141 TCTCATGTGCAGGAGGTGGATGG - Intronic
962350476 3:134652148-134652170 GATAAGGGTGAGAAGGTGGAGGG - Intronic
962650218 3:137480915-137480937 GCCCAGGGGCAGGGGGTGGGTGG - Intergenic
963230743 3:142906654-142906676 ACTGAGGGGCATATGGTGGAAGG - Intergenic
963785613 3:149531550-149531572 GCGCAGGTGCAGGAGGTGGGAGG - Intronic
964292490 3:155196758-155196780 GCTCAGAGGCAGAAGGTCCCTGG - Intergenic
966923164 3:184627667-184627689 GCCCAGGGGCAGAAGGAGAGAGG + Intronic
967120030 3:186374502-186374524 GCTCAGGGACTGAAGGTGGAAGG - Intergenic
968022922 3:195410890-195410912 CCTCAATGGCAGAAGGTGGAAGG - Intronic
968470219 4:777562-777584 ACTTTGGGGCCGAAGGTGGAAGG + Intergenic
968921415 4:3524007-3524029 GCCCAGGGGCAGCAGTTGGGTGG + Intronic
968969866 4:3788184-3788206 GCAGAGGGGCAGGAGCTGGAGGG - Intergenic
969209742 4:5677675-5677697 GCTCAGGAGGAGGAGGTGGCTGG - Intronic
969479768 4:7441669-7441691 GGGCTGGGGCAGGAGGTGGAGGG - Intronic
970410291 4:15799868-15799890 GCTCAGGCACAGAGGGAGGAGGG + Intronic
970609058 4:17708965-17708987 GCTCAGGTCCGGAAGCTGGAAGG - Exonic
970905425 4:21210721-21210743 CTTCATGGGCTGAAGGTGGAAGG - Intronic
971270641 4:25141628-25141650 GGGCAAGGGCAGAAGCTGGATGG - Intronic
971421774 4:26480535-26480557 GTTAAGTGGCAGAAGGTGCATGG - Intergenic
972279511 4:37588548-37588570 GATGAGGAGAAGAAGGTGGAAGG - Intronic
972527613 4:39931196-39931218 GCTCAGGGGGCTGAGGTGGAAGG - Intronic
972546950 4:40089057-40089079 ACTCAGGAGCCTAAGGTGGAAGG - Intronic
974250397 4:59377126-59377148 GCTCAGGGATAAGAGGTGGAAGG - Intergenic
975040884 4:69743547-69743569 GCTCCTGGGCAGAAGGGGGTGGG - Intronic
975421790 4:74173152-74173174 GGACAGGGGCAGAAGGAAGAAGG + Intronic
975913453 4:79297018-79297040 GCTCAGGGACAGAAGGCACAGGG - Intronic
976700770 4:87966595-87966617 GCTCCTGGGCAGAAGGGGGCAGG + Intergenic
976789277 4:88859441-88859463 GCCCAGAGGCAGGTGGTGGAGGG + Intronic
978153723 4:105466556-105466578 ACTGAGGGGCAGAAGGCAGAAGG + Intronic
979093490 4:116517010-116517032 GCTAACGGGCACAAGGTGGCTGG + Intergenic
980243106 4:130202315-130202337 GCTCATAGGCAGAAGGGGGTGGG + Intergenic
980878439 4:138685842-138685864 CCTCAGGGGCATCAGGTGAAAGG - Intergenic
982064802 4:151644775-151644797 GAACAGGGGCAGCAGGTTGAGGG - Intronic
982164908 4:152605404-152605426 GCTCTGGGGCAGACGCTTGAGGG + Intergenic
982737396 4:159020528-159020550 GCCCAGGGGCAGAAGGTCCAAGG - Intronic
982821701 4:159948420-159948442 GAGCAGGGGCAGAAAATGGAAGG + Intergenic
983763229 4:171440437-171440459 GTGTAGGGGCAGAAGGGGGATGG - Intergenic
984864943 4:184273315-184273337 GCTCAGGAACAGAAGGTGGGAGG - Intergenic
985223390 4:187732042-187732064 GCTGAGGGGGAGGAGGAGGACGG - Intergenic
985842710 5:2320726-2320748 GCTCAAGAGCAGAAGCTGCAGGG - Intergenic
986788936 5:11142014-11142036 GGTTGAGGGCAGAAGGTGGAAGG - Intronic
988208868 5:28176445-28176467 GAACAGGTGCAGAAGGTAGAAGG + Intergenic
988629672 5:32915304-32915326 GCTGAGGGGCAGAAGGTAGATGG - Intergenic
988717352 5:33841220-33841242 GTTGTGGGGCAGGAGGTGGAGGG - Intronic
988933288 5:36058348-36058370 TATCAGGGGCTGAAGGTGGAGGG + Intronic
989383944 5:40836099-40836121 ACTCAGGGGGTGGAGGTGGAGGG + Intergenic
990245241 5:53857808-53857830 GCTTAAGGCCAGAATGTGGAAGG + Intergenic
991484845 5:67124189-67124211 ACCCAAGGGTAGAAGGTGGAGGG - Intronic
992622872 5:78610778-78610800 GCACAGGAGAGGAAGGTGGAGGG - Intronic
995191399 5:109322443-109322465 ACTGAGGGGCATAAGGTAGAAGG - Intergenic
996065375 5:119073169-119073191 CCTCAGGAGCCTAAGGTGGAAGG - Intronic
998140316 5:139696391-139696413 GCTCAGGGCCAGCTGCTGGAAGG - Intergenic
998192198 5:140035785-140035807 GATCAGGGAAAGAAGGTGTAAGG + Intronic
998352879 5:141512567-141512589 ACCCAGGGGCAGAAGGGGGTGGG - Exonic
998390288 5:141783087-141783109 CCACAGGGGCAGGAGGTGGAGGG - Intergenic
999255663 5:150208850-150208872 GGTCAGAGGCAGAAGGAGGCAGG + Intronic
1000020232 5:157311817-157311839 GCCCAGGGCCAGAAGGGGTAAGG + Intronic
1003380527 6:5620790-5620812 GATCAGAGGCAGTTGGTGGATGG + Intronic
1004015645 6:11729483-11729505 TCTCAGGGACAGGAGGGGGAAGG - Intronic
1004581981 6:16963206-16963228 GCACAGGTACAGAAAGTGGAAGG - Intergenic
1005519186 6:26583853-26583875 AGTCAGGGGCAGAAGCAGGAAGG - Intergenic
1005766150 6:29014238-29014260 GCTCAGGGCCAGAATCAGGAGGG + Intergenic
1006302138 6:33199345-33199367 GCCCAGGAGGAGAAGGGGGAGGG + Exonic
1006338261 6:33432044-33432066 GCTGAGGGGCAGAGGGAGGTGGG + Intronic
1006387484 6:33739410-33739432 GGGAAGGGGCAGAAGGAGGAGGG + Intronic
1006427383 6:33974901-33974923 GTTCAGGGGCAGTAGGAGCAGGG - Intergenic
1006798845 6:36746819-36746841 GCACAGGGGCAGAAGGAAGTGGG - Intronic
1007000501 6:38307818-38307840 TTTGAGGGGCAAAAGGTGGAGGG - Intronic
1007095090 6:39208062-39208084 GCACAGGGGGAGAGGGAGGAGGG - Intronic
1007373203 6:41440318-41440340 GCAGAGGGGCAGAAGATGTAGGG - Intergenic
1007500347 6:42292300-42292322 GCTCAGGGGCAGAAATTGCCAGG + Intronic
1007595163 6:43046629-43046651 GCACAGGGGCAGAAGGAACACGG + Intronic
1007605941 6:43118165-43118187 GCTCAGGGGCCATAGGTGGCTGG - Intronic
1008102473 6:47406803-47406825 GCTGAGGGAAAGAAGGTGGCAGG + Intergenic
1012813774 6:103995552-103995574 GCTTAGGGACAGAGGGTAGAGGG - Intergenic
1013188719 6:107783956-107783978 GGGCAGGGGCAGGAGGTGGCAGG - Intronic
1014167753 6:118245219-118245241 GCTAAGTAGCAGTAGGTGGAGGG + Intronic
1014805111 6:125820730-125820752 GCTCATGGGCTGAAAGTGGGAGG - Intronic
1015556390 6:134465918-134465940 GCTCAGGAGGAAAAGGAGGAGGG - Intergenic
1017085023 6:150705720-150705742 CCTCAGGAGCATAAGGAGGAGGG - Intronic
1017159484 6:151351449-151351471 ACTCCGGTGCAGGAGGTGGAAGG + Exonic
1018054319 6:160038726-160038748 GCCCAGGAGGTGAAGGTGGAAGG + Intronic
1018083336 6:160277595-160277617 GGTCAGGGGGAGAAGATGGCAGG - Intronic
1018590631 6:165417735-165417757 GCTGAGGGGCAGACAGTGGTGGG + Intronic
1018602875 6:165563985-165564007 GATCAGTGGGAGAGGGTGGAGGG - Intronic
1018697945 6:166405395-166405417 GCTCAGGGGGTGAGGGTGGGAGG - Intergenic
1019476791 7:1248263-1248285 GCCCAGGGGCAGGCGGAGGAAGG - Intergenic
1019769812 7:2876600-2876622 GCCCACGGGCAGCAGGAGGATGG + Intergenic
1019817732 7:3213422-3213444 ACTGAGGGGCATAAGGTAGAAGG - Intergenic
1021270059 7:18574547-18574569 GCTCCTGGGCAGAAAGGGGAGGG - Intronic
1022300808 7:29100430-29100452 GCCAAGGGTCTGAAGGTGGATGG + Intronic
1023263237 7:38379285-38379307 GCTGAGGGGGAGAAGGCGGGTGG + Intergenic
1023797802 7:43808272-43808294 GTTCAGAGGGAGAAGGTGGCTGG - Intergenic
1023835170 7:44063692-44063714 GCTCAGGGGCTGCAGGAGGCAGG - Intronic
1023888172 7:44375395-44375417 GCATCGGGGCAGAAAGTGGACGG - Intergenic
1024609014 7:51046815-51046837 ACCCAGGGGCAGCAGGAGGAGGG + Intronic
1024657989 7:51468068-51468090 GCTCAGGGGCTGAAGGTCTGGGG - Intergenic
1024676008 7:51638445-51638467 GGGCAGGAGGAGAAGGTGGAAGG + Intergenic
1027616557 7:80431302-80431324 ACTGAGGGGCATAAGGTAGAAGG - Intronic
1028339725 7:89703819-89703841 GATCCAGGGCAGAAGGTGGTGGG + Intergenic
1028529168 7:91819141-91819163 ACTCTGGGGGAAAAGGTGGAGGG - Intronic
1029306726 7:99625107-99625129 GGTCAGGGTCAGCAAGTGGAGGG - Intronic
1029446025 7:100613118-100613140 CCTCCGGGGCAGAAGGCAGAGGG + Intronic
1029465561 7:100722601-100722623 GCTGAGGGGCAGGAGGGAGAGGG + Intronic
1029973191 7:104809435-104809457 CCTCAAAGGCAGAACGTGGATGG - Intronic
1030463800 7:109874512-109874534 GTGCAGGGGCAGGAAGTGGATGG + Intergenic
1031836435 7:126685803-126685825 GCTCCTGGGCAGAAGGGGGAAGG + Intronic
1031969854 7:128056299-128056321 GTTCAGGGGCAGTAGCTGGAAGG + Intronic
1033058114 7:138078899-138078921 GCTCAGGGGCAAAATGTAGTGGG - Intronic
1033087587 7:138356805-138356827 GCTCAGGAGGCTAAGGTGGAAGG - Intergenic
1034210783 7:149360207-149360229 GCTCTGGGGCAGTGGGTGGGTGG - Intergenic
1034502871 7:151462310-151462332 GCTCAGGGGCAGAGGTTTGGAGG - Intergenic
1035259181 7:157650685-157650707 GCACTGGGTCTGAAGGTGGAGGG + Intronic
1035327906 7:158076682-158076704 TCTCAGGGGCTGAAGGTGAGAGG - Intronic
1035330973 7:158097233-158097255 GCACTGGGGAAGGAGGTGGAGGG + Intronic
1036458458 8:8930345-8930367 GCTATGGGGCAGATGGTCGAGGG + Intergenic
1036632583 8:10525744-10525766 GTACAGGGGCAGAAGGGGCATGG + Intronic
1036760452 8:11505379-11505401 GCTCAGGGACAAGGGGTGGAGGG - Intronic
1037930694 8:22878360-22878382 GCTCTGCGGGAGAGGGTGGAGGG + Intronic
1037945633 8:22987819-22987841 GATCTGGGGCAGGAGGTGGAGGG + Intronic
1038922463 8:32099907-32099929 ACTCAGTGGATGAAGGTGGAGGG + Intronic
1039442634 8:37605604-37605626 ACACAGGGACAGAATGTGGAAGG - Intergenic
1039443546 8:37612345-37612367 GCCCATGGGGAGAAGGAGGAAGG + Intergenic
1039907029 8:41794218-41794240 GCACAGGTGCAGAAGATGCAGGG - Intronic
1040797222 8:51299572-51299594 GCTCATAGGCAGAAGGTGAGAGG - Intergenic
1041151953 8:54944242-54944264 CTCCAGTGGCAGAAGGTGGAGGG + Intergenic
1041430446 8:57776037-57776059 GCCCATGGGCAGGAGCTGGAAGG - Intergenic
1041696323 8:60740821-60740843 GCTCAGGGGAATAAGGTTAAGGG + Intronic
1042337070 8:67640223-67640245 GCTCCTGGGCAGAAGGGGGCAGG - Intronic
1042643099 8:70956542-70956564 GTTCCTGGGCAGAAGGGGGAAGG - Intergenic
1043344567 8:79285159-79285181 GCTGAGGGGCATAAGGCAGAAGG + Intergenic
1043568141 8:81570942-81570964 GCTCCTGGGCAGAAGGGGGTGGG - Intergenic
1043848043 8:85183703-85183725 TCACAGGGGCAGAAAGTAGAAGG + Intronic
1044726697 8:95200272-95200294 GAGCAGGGGCAGCATGTGGAGGG + Intergenic
1045236162 8:100354210-100354232 GGTCAGGGGCAGGAGGTTGATGG - Intronic
1045439028 8:102191684-102191706 GATAAGAGGCAGAAGTTGGAAGG - Intergenic
1046395297 8:113632869-113632891 GCTCCTGGGCAGAAGGGGGCAGG - Intergenic
1046447921 8:114347418-114347440 GTGCAGGGGGAGAAGGAGGAAGG - Intergenic
1046612909 8:116445311-116445333 GGGGAGGGGCAGAAGGTGGAGGG + Intergenic
1047206564 8:122806993-122807015 GCTCACTGGTAGAGGGTGGAGGG + Intronic
1048716102 8:137272030-137272052 GCTTGGGGGCAGAGGGTGGGAGG + Intergenic
1048949521 8:139483822-139483844 GCTCAGGGACAGAAGGGAAATGG - Intergenic
1049724699 8:144140313-144140335 CCACAGGGGCAGAGGGTGGCTGG - Exonic
1050217719 9:3346697-3346719 GCTCAGGTGCAGTATGTGGAAGG - Exonic
1050241995 9:3646409-3646431 GCTCAGCAGCAGAAGCAGGAAGG - Intergenic
1050588624 9:7139857-7139879 ACTCAGGGGCATAAGGCAGAAGG + Intergenic
1051436617 9:17040419-17040441 GAACAGGAGCAGAAGGTGGGTGG - Intergenic
1051851894 9:21519007-21519029 TCACATGGCCAGAAGGTGGAAGG - Intergenic
1053390308 9:37730180-37730202 GCTCAAAGGCAGCAGGTGCAAGG - Intronic
1053806430 9:41806792-41806814 GCTCTGAGCCAGAAGGTGGAAGG - Intergenic
1054713069 9:68530682-68530704 GCTATGGGCCAGATGGTGGAGGG + Exonic
1055275906 9:74615398-74615420 GCTCAGGCGCAGAAGGTGGGAGG - Intronic
1055402830 9:75942588-75942610 GCACGGTGGCAGAAGGTGGAGGG + Intronic
1055460072 9:76511342-76511364 GTTCTGGGGAAGAAGGTGGATGG - Intergenic
1056746065 9:89304138-89304160 GCTCAGGCACAGAAGGAGGTTGG + Intergenic
1056757303 9:89389895-89389917 GGTCACGGGCAGCAGGTGAAGGG + Intronic
1056955418 9:91077200-91077222 ACTCCATGGCAGAAGGTGGAAGG + Intergenic
1057225138 9:93289176-93289198 GCTCAGGTGCAGGAGGTGGCAGG - Exonic
1057276911 9:93680918-93680940 GCTGCGGGGCTGAAGGTGCAGGG - Intergenic
1057293854 9:93824250-93824272 GGTTGGGGGGAGAAGGTGGAGGG + Intergenic
1057747434 9:97763183-97763205 CCTTAGAGGCAGAATGTGGAGGG + Intergenic
1057919281 9:99083214-99083236 GCTGAGGGGCAGAAGGGCGCTGG + Intergenic
1057971780 9:99565630-99565652 ACTCAGGGGAAGAAGTTGGCAGG + Intergenic
1058354424 9:104066071-104066093 GCTGAGGTGCAGAAGGATGAAGG - Intergenic
1058492814 9:105520060-105520082 TCCCAGCGGCAGAAAGTGGAGGG - Intronic
1059140842 9:111851794-111851816 GCCCAGGGGGAGAGAGTGGATGG - Intergenic
1059393716 9:114017427-114017449 GCTCACGGGCACCAGGAGGATGG - Intronic
1060044383 9:120328090-120328112 TGTGAGGGGCAGAAGGTGGGGGG + Intergenic
1060547886 9:124471330-124471352 TCTCAGGGCCAAAAGGTGGGTGG + Intronic
1060722978 9:125990507-125990529 GCTCGGGGACAGAGGGTGGCGGG - Intergenic
1060861212 9:126956319-126956341 CCTCAGGGACTGAAGTTGGATGG + Intronic
1061909287 9:133714314-133714336 CTTGAGGGGCAGAAGGTGGCAGG + Intronic
1062125819 9:134861805-134861827 GCCGAGGGGCAACAGGTGGAAGG + Intergenic
1062303629 9:135889713-135889735 GCTCAGGGGAAGGAGGAGGAGGG - Intronic
1062340262 9:136090950-136090972 GCACAGGGGCAGGAGCTGGGCGG + Intronic
1062363357 9:136197777-136197799 TCTGAGGGGCCGCAGGTGGAGGG - Intronic
1186505886 X:10091787-10091809 AGTCAGGGGCAGTAGGAGGATGG - Intronic
1188370565 X:29365170-29365192 GCTCAGGCAGAGAAGGTGAAAGG + Intronic
1188897108 X:35682742-35682764 GCTCAGGGTCAGATGGAGGCTGG - Intergenic
1188989795 X:36803573-36803595 GCTGAGGGGCATAAGGCAGAGGG - Intergenic
1189308711 X:40005824-40005846 TCCCAGGGTCAGAAGGTAGAAGG - Intergenic
1190128242 X:47724403-47724425 GGTCAGGGGCAGGATGTGGGTGG + Intergenic
1190526355 X:51332812-51332834 GCTCGGGGGCAGACGGCAGACGG + Intronic
1190931457 X:54952143-54952165 GCTCAGGGGCTAATGGTGGTAGG + Intronic
1191663549 X:63674792-63674814 GCTCAGGCACAGAAGGAGGTAGG - Intronic
1192193930 X:69016208-69016230 GGTCTGGGGCAGGAGGAGGAGGG + Intergenic
1192279345 X:69667841-69667863 ACTCCATGGCAGAAGGTGGAAGG + Intronic
1192326014 X:70133174-70133196 GCTGAAGGGCACAGGGTGGAAGG + Intergenic
1192808764 X:74531835-74531857 GCTCTGGGGGAGGAGGAGGATGG + Exonic
1193693775 X:84681058-84681080 GCTCAGGCTCTGAAGGCGGAAGG + Intergenic
1194413057 X:93578958-93578980 GCTTTGGGGCAGAAGGGGGTGGG + Intergenic
1195705564 X:107735698-107735720 GCTGAGGGGAAGAAGGAGAAGGG - Intronic
1196818663 X:119685738-119685760 GGTCAGGGGCAGAAGGGTCAAGG + Intronic
1197666887 X:129233920-129233942 GGTCAGGGGTAGAGGGGGGATGG - Intergenic
1197977129 X:132177906-132177928 GCGCCTGGTCAGAAGGTGGAGGG + Intergenic
1198742747 X:139858089-139858111 GCCCCATGGCAGAAGGTGGAAGG - Intronic
1199717199 X:150515277-150515299 GCTCAGGGGCAGCAGGGGTGGGG + Intergenic
1199982821 X:152930166-152930188 GCTATGGTGCAGAAGGTGGAAGG - Intronic
1200366220 X:155667500-155667522 GCACAGAGGCAGAAAGTGTAGGG + Intronic
1202019312 Y:20448647-20448669 ACTCAGGGATAAAAGGTGGAAGG + Intergenic