ID: 1141180895

View in Genome Browser
Species Human (GRCh38)
Location 16:81752751-81752773
Sequence CAGGGTGCCCAGGGAAGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 524
Summary {0: 1, 1: 0, 2: 3, 3: 44, 4: 476}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141180884_1141180895 3 Left 1141180884 16:81752725-81752747 CCCACTCCTTGCACGGCCAGGGC 0: 1
1: 0
2: 0
3: 10
4: 185
Right 1141180895 16:81752751-81752773 CAGGGTGCCCAGGGAAGTGAGGG 0: 1
1: 0
2: 3
3: 44
4: 476
1141180879_1141180895 30 Left 1141180879 16:81752698-81752720 CCATGAAGGACGTGACTGTAGAC 0: 1
1: 0
2: 0
3: 4
4: 90
Right 1141180895 16:81752751-81752773 CAGGGTGCCCAGGGAAGTGAGGG 0: 1
1: 0
2: 3
3: 44
4: 476
1141180885_1141180895 2 Left 1141180885 16:81752726-81752748 CCACTCCTTGCACGGCCAGGGCC 0: 1
1: 0
2: 0
3: 24
4: 242
Right 1141180895 16:81752751-81752773 CAGGGTGCCCAGGGAAGTGAGGG 0: 1
1: 0
2: 3
3: 44
4: 476
1141180886_1141180895 -3 Left 1141180886 16:81752731-81752753 CCTTGCACGGCCAGGGCCCTCAG 0: 1
1: 0
2: 3
3: 26
4: 244
Right 1141180895 16:81752751-81752773 CAGGGTGCCCAGGGAAGTGAGGG 0: 1
1: 0
2: 3
3: 44
4: 476

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141180895 Original CRISPR CAGGGTGCCCAGGGAAGTGA GGG Intronic
900212319 1:1462207-1462229 CGGGGAGCCCAGGGAAGGGGAGG - Intronic
900918039 1:5652023-5652045 CAGGATGCCCTGGGAAGAGAAGG - Intergenic
901017295 1:6239171-6239193 CAGGGTTCACAGAGCAGTGATGG + Intergenic
901137635 1:7008102-7008124 CACGGTGCCCAGGACAGTGCTGG - Intronic
901669900 1:10850001-10850023 CAGGGAGCACAGGGATGGGAGGG + Intergenic
902086446 1:13866612-13866634 CAGGGTGGTAAAGGAAGTGATGG - Intergenic
902448674 1:16483687-16483709 CCGGGACCCCAGGGAGGTGAGGG - Intergenic
902506105 1:16939673-16939695 CCGGGACCCCAGGGAGGTGAGGG + Intronic
902796358 1:18803220-18803242 CAGGGCGCCCAGGGCACAGAAGG + Intergenic
903155089 1:21437341-21437363 CCGGGACCCCAGGGAGGTGAGGG + Intergenic
903226406 1:21896375-21896397 CTGGGTCCCCCTGGAAGTGAGGG - Intronic
903384653 1:22918448-22918470 TAGGGTGACCAGGGCAGGGATGG - Intergenic
903651928 1:24927778-24927800 GAGGGTGACCAGGGAAAGGAGGG + Intronic
903930773 1:26861305-26861327 CAGGGTTTCCAAGGAAGTAAAGG - Intergenic
904114500 1:28151574-28151596 CGGGTTGCCCAGGGAGGTCAAGG + Intronic
904403586 1:30272583-30272605 AAGGGTGCAGAGGGAGGTGATGG - Intergenic
904467063 1:30714418-30714440 CAGGATTCCCGGGGAGGTGAGGG + Intronic
904468164 1:30720006-30720028 CAGGTAGCCCAGGGTAATGATGG - Intronic
904498810 1:30902432-30902454 CTGGGAGCCAAGGGGAGTGAGGG + Intronic
904612631 1:31733795-31733817 CAGGGAGGCCAGGGAGGTGTAGG - Intronic
905769089 1:40625836-40625858 GAGGGTACCCAGGGGACTGAGGG - Exonic
906575571 1:46886410-46886432 CAGGTTGCCCAGAAAAGGGAGGG + Intergenic
906596405 1:47081486-47081508 CAGGTTGCCCAGAAAAGGGAGGG - Intronic
907431614 1:54415378-54415400 CTGTGTGCCCAGAGAGGTGAAGG - Intergenic
907572622 1:55497975-55497997 CAGGGTGACCAGTGAAGGGCTGG - Intergenic
907975364 1:59426361-59426383 CAGGGTGGGAAGGGGAGTGAAGG + Intronic
911054718 1:93699996-93700018 CAATGAGCCCAGGGAGGTGAGGG + Intronic
913030453 1:114897433-114897455 CAGTTTGCACAGGGAAGGGAGGG + Intronic
913341129 1:117759048-117759070 CAGGCTGTCCAGGGAAATGTGGG - Intergenic
913578014 1:120196956-120196978 GAGGAGGCCCAGGGAACTGACGG + Intergenic
913630158 1:120701396-120701418 GAGGAGGCCCAGGGAACTGACGG - Intergenic
914559930 1:148808376-148808398 GAGGAGGCCCAGGGAACTGACGG + Intronic
914612903 1:149321839-149321861 GAGGAGGCCCAGGGAACTGACGG - Intergenic
914857676 1:151364485-151364507 CCAGGTCCCCAAGGAAGTGAGGG + Exonic
915066063 1:153225076-153225098 CAGGCTGCCCAGGGAATACAGGG + Intergenic
915465583 1:156096006-156096028 CAGGGAGCCCTGGGCAGTGTGGG - Intronic
915494538 1:156272370-156272392 CAGGGTGCCCAGCTGATTGAAGG + Exonic
915744920 1:158148533-158148555 CAGGGAGGGCTGGGAAGTGAGGG - Intergenic
915979575 1:160411400-160411422 CAGCGTTCCCAGGGAAGAGATGG - Intronic
916027673 1:160848771-160848793 CAGTGTGCCCAGGGAAGGCATGG + Intronic
916212611 1:162371092-162371114 CATGGAGCCCAGGGAGGTCAGGG - Intronic
916479684 1:165203782-165203804 CAGGGAGGCCAGGGAAGAGGTGG - Exonic
917480055 1:175404053-175404075 CAGGGTGCTCTGGGCAGTGCAGG + Intronic
917605231 1:176621424-176621446 CAGGGTGCCAAGGGGGATGATGG - Intronic
917734546 1:177908500-177908522 CAGGAAGCCCAAAGAAGTGATGG + Intergenic
917924068 1:179774370-179774392 ATGGATGCCCAGGGAAGTGGTGG + Intronic
918161095 1:181900477-181900499 CAGGGTGCCTAAGAGAGTGATGG + Intergenic
918324304 1:183395015-183395037 CTGGTTGCCCATGGTAGTGAAGG - Intronic
919843524 1:201626505-201626527 CTGGGTCCAAAGGGAAGTGATGG - Intronic
920560710 1:206936516-206936538 CAGGGTGCTCTGGGATGAGAAGG + Intronic
921055795 1:211541557-211541579 GAGAGTGGTCAGGGAAGTGAAGG - Intergenic
921101477 1:211932694-211932716 AAGGGTGCACAGAGAAGTGGTGG - Intergenic
921270965 1:213469502-213469524 CAGGGTACACATGGAAGGGAGGG + Intergenic
921404958 1:214768676-214768698 GAGGGCTCCAAGGGAAGTGATGG - Intergenic
923545194 1:234918725-234918747 GAGGGGGCCCAGGGACGGGAAGG - Intergenic
1063148960 10:3320073-3320095 CTGCCTGCCCAGGGCAGTGAGGG - Intergenic
1063965385 10:11342445-11342467 CAGCATGTCCTGGGAAGTGATGG + Intergenic
1064592841 10:16912593-16912615 CAGAGACCCCAGTGAAGTGAGGG + Intronic
1065590305 10:27256569-27256591 TGGAGTGCCCAGGGCAGTGAGGG + Intergenic
1065695235 10:28373654-28373676 CAGGGGACCCAGGGAAGAGCAGG - Intergenic
1065898430 10:30184421-30184443 CATGGTGCTTAGGGAACTGAGGG - Intergenic
1067451636 10:46385327-46385349 GAGGGAGACCAGGGAGGTGAGGG - Intronic
1067560110 10:47299570-47299592 AAGGATTCCCAGTGAAGTGAGGG - Intergenic
1067585603 10:47474429-47474451 GAGGGAGACCAGGGAGGTGAGGG + Intronic
1068957177 10:62828517-62828539 CAGGGTGACCAAGGAACAGAGGG - Intronic
1069409063 10:68133666-68133688 GAGGGGGCCCAGGGCAGTCAGGG + Intronic
1069660988 10:70123394-70123416 CAGGGTGGCGAGGTGAGTGAGGG - Exonic
1069745589 10:70713016-70713038 GAGAGTGCCCAGGGCAGTGGCGG + Intronic
1069997127 10:72349292-72349314 TGGGCTGGCCAGGGAAGTGAGGG + Intronic
1070119485 10:73561646-73561668 CAGAATGCCCAGGGAAGGAAAGG + Intronic
1070700074 10:78595496-78595518 CAGGATGCCAAGTGAAGTGCTGG + Intergenic
1070717345 10:78732357-78732379 CAGGGTGGCGAGTGAAGGGAGGG + Intergenic
1070789278 10:79180042-79180064 CAGGGTGCCGAGGGTGGAGACGG + Intronic
1070825156 10:79386475-79386497 GAAGGGGCCCAGGGGAGTGAGGG + Intronic
1071458845 10:85872570-85872592 CAGGTTGCCAGGGAAAGTGATGG - Intronic
1071504081 10:86222409-86222431 CTGAGTGCCCAGGGAAGGGGTGG + Intronic
1071568419 10:86683475-86683497 CTGCCTGCTCAGGGAAGTGAGGG + Intronic
1071667986 10:87578726-87578748 AAGGGGTCCCAGGGAAGGGAAGG + Intergenic
1071980689 10:91001995-91002017 CAGGGTGCACAGGCAGCTGAAGG + Intergenic
1073008059 10:100339696-100339718 CAGGGACCCCAGGAAAGGGATGG - Intergenic
1074162415 10:110845609-110845631 TAGGGGGACCAGGGAAGGGAAGG - Intergenic
1075376031 10:121978642-121978664 CCGGCTGCCCTGGGCAGTGAGGG - Intergenic
1075664796 10:124222553-124222575 CAGGTGGCCCAGGGAAGGGGGGG + Intergenic
1075713399 10:124542649-124542671 CAGGGTGCACAGGGCTGGGATGG - Intronic
1076279110 10:129230239-129230261 CATGGTTTCCAGGGAAGTTAGGG - Intergenic
1076724194 10:132405686-132405708 CAGGGTCCACAGGGACGCGAGGG + Exonic
1076726702 10:132417199-132417221 CAGTGTGTCCAGGGAGGGGATGG + Exonic
1076992513 11:282843-282865 CAGGATGCCCTGGGCAGAGACGG + Intronic
1080849939 11:36059501-36059523 CAGAGTGCCCAGGGATGGCAGGG - Intronic
1081080503 11:38733869-38733891 TAGGCTGCACAGGGAAGCGAGGG + Intergenic
1081666547 11:44920101-44920123 CAGGAATCCCAGGGAAGTGTTGG + Intronic
1081702224 11:45159133-45159155 CAGGGTGCTCAGGGAGGGCAGGG - Intronic
1083168171 11:60904705-60904727 TGGGGTGCCCAGGGAAGGCATGG - Intronic
1083595664 11:63917356-63917378 CTGGGAGCCCAGGGACGCGAGGG - Intergenic
1084362504 11:68677898-68677920 CACAGAGCCCAGGGCAGTGAAGG + Intergenic
1084507082 11:69574982-69575004 CAGGGCGCCCAGGCTGGTGAAGG - Intergenic
1084748173 11:71186503-71186525 CACGGTGCCCTGGAAAGTAAGGG - Intronic
1088506189 11:110529899-110529921 CAGGGTGGCCAGGCAAGTCCTGG + Intergenic
1088902680 11:114130060-114130082 CAGGATGCCCAGGGAGGAGCAGG + Intronic
1089100452 11:115958443-115958465 CATGCTGCCCAGGGAGGGGAGGG - Intergenic
1091875138 12:3927532-3927554 CAGTGTGCCCAGGATATTGAGGG - Intergenic
1092287191 12:7135546-7135568 CTGGGTGGCCAGGGAAGCCAGGG - Intronic
1092923946 12:13257166-13257188 CAGGGGCCCCGGGGCAGTGAAGG - Intergenic
1096649276 12:53054003-53054025 CACTCTGCCCAGGTAAGTGAGGG + Exonic
1096773254 12:53949752-53949774 CAGGGAGCACAGGGAAGGGGGGG + Intergenic
1096994356 12:55829641-55829663 CGGGGTCACCAGGGAAGAGACGG + Intronic
1097242868 12:57588145-57588167 AAGGGTGGCCAGGGAAGTACAGG - Intergenic
1097798139 12:63885387-63885409 CGTGGTGCCCAGGGAAGGCATGG - Intronic
1098770415 12:74545541-74545563 CTGTGTTCCCAAGGAAGTGAAGG + Intergenic
1099290199 12:80767463-80767485 CAGAGTGCACAGTGAAGTCATGG - Intergenic
1099738221 12:86597841-86597863 CAGGGTGCCAAGGGAGGAGGTGG - Intronic
1100219478 12:92489046-92489068 TTGGGGGCCCAGGGAATTGAGGG - Intergenic
1100475152 12:94928612-94928634 CAGGTTGCACAGGGAAGCGAAGG + Intronic
1100939455 12:99709892-99709914 CTCTGTGCCCAGGTAAGTGATGG - Intronic
1101083213 12:101209624-101209646 GGGGGTGCCCAGGACAGTGACGG + Exonic
1101200314 12:102428586-102428608 CTGAGTGCCCACAGAAGTGAGGG - Intronic
1101447232 12:104745932-104745954 CAGGGTGATCAGGCAAGAGAAGG - Intronic
1101822236 12:108192832-108192854 GTGGGAGCCCAGGGAAGTGAGGG - Intronic
1102574142 12:113845215-113845237 CAGAGTCACCAGGGCAGTGAAGG - Intronic
1103889756 12:124229339-124229361 CAGGGGGCACAGGGAAGTTTTGG - Intronic
1104841286 12:131827336-131827358 CAGAGTACCCAGGGAAGCGGGGG + Intergenic
1105474903 13:20721112-20721134 CAGGGCTCCCACGGGAGTGAAGG - Intronic
1106127078 13:26909383-26909405 CAGGTTCCAAAGGGAAGTGAGGG + Intergenic
1107028279 13:35825272-35825294 GAAGCTTCCCAGGGAAGTGAAGG - Intronic
1109213650 13:59563465-59563487 GAGGGTGACCAGAGGAGTGAGGG - Intergenic
1110373367 13:74764528-74764550 CAGGGAGCACTGGCAAGTGACGG + Intergenic
1111170469 13:84520610-84520632 TAGGGAGCCTAGGGAAGTTAGGG - Intergenic
1112139595 13:96623755-96623777 CAGGGTGCCCGGGTGAGAGATGG + Intronic
1113372328 13:109734564-109734586 CAGGGTCCCATGGGAGGTGAGGG + Intergenic
1113672074 13:112182368-112182390 CAGACTGCCCAGGGCTGTGAGGG + Intergenic
1113941974 13:114023154-114023176 GAGGGTGACCAGGGATTTGATGG + Intronic
1114692341 14:24595532-24595554 CAGGTTGTCCAGGGAAGTGGGGG + Intergenic
1115151293 14:30288794-30288816 CAGGGTTCACAAGGATGTGATGG + Intergenic
1115290017 14:31760241-31760263 GAGGAAGCCCAGGGAAGTCATGG - Intronic
1117090757 14:52247736-52247758 CAGTGTGGCCAGAGAAGTCAGGG + Intergenic
1118103409 14:62630593-62630615 AAGGGTGCTCAGGAAATTGAGGG + Intergenic
1118660385 14:68003237-68003259 CAGGCTAACAAGGGAAGTGAAGG - Intronic
1119757807 14:77131074-77131096 CAGGGTCCCCAGGGAGGAGCAGG + Intronic
1121015462 14:90546285-90546307 CATGGAGCCCAGGGAAGGGAAGG - Intronic
1122270620 14:100567204-100567226 CAGGGTGCCAGGGGAAGTCGTGG + Intronic
1122309007 14:100783067-100783089 CAGGTTTCCAAGGAAAGTGAGGG + Intergenic
1122540120 14:102493418-102493440 CAGGGGCTCCAGGGAAGGGAGGG - Intronic
1122540520 14:102495498-102495520 CAGGGACTCCAGGGAAGGGAGGG + Intronic
1122564764 14:102645143-102645165 CAAGGAGCCCAAGGAAATGAAGG - Intronic
1122595089 14:102885023-102885045 CACTGTGGCCAGGGAAGAGAAGG - Intronic
1123154437 14:106210798-106210820 CCAGGTGCCCAGGGAGGTTAAGG - Intergenic
1124550803 15:30679813-30679835 CCTGGTGCACAGGGAAGTCAGGG + Intronic
1124680446 15:31725855-31725877 CCTGGTGCACAGGGAAGTCAGGG - Intronic
1125521896 15:40352722-40352744 CAGTGTGCCCAGTGCAGGGACGG - Intronic
1125608169 15:40953825-40953847 AACCGTGCCCAGGGGAGTGAGGG + Intronic
1126230271 15:46315494-46315516 TAGGGTGCCCATGGGAGTGGAGG - Intergenic
1128181850 15:65611514-65611536 GACGGGGCCCAGGGGAGTGAGGG - Intronic
1128237616 15:66078665-66078687 CAGGCTGCCCCTGGAAGTGCAGG + Intronic
1129167543 15:73787293-73787315 CAGGGGGGCCTGGGAGGTGAGGG + Intergenic
1129249511 15:74301172-74301194 CAGGGTGCCCAGAGAGTGGAGGG - Intronic
1129263540 15:74382149-74382171 AGGGGGGCCCAGGGAAGTGGAGG + Intergenic
1129270396 15:74416556-74416578 CAGGGTGAGCAGGGGCGTGAGGG - Exonic
1129663372 15:77565733-77565755 CAGGGTGCAGAGGGAATGGATGG - Intergenic
1129709623 15:77813934-77813956 CAGGGTTGCCTGGGAGGTGAAGG + Intronic
1131047700 15:89326613-89326635 CAGGGTGTCCAGGAAGGTGCTGG + Exonic
1131143889 15:89999841-89999863 CAGGGAGAGCAGGGAAGTGTGGG + Intergenic
1131391312 15:92051173-92051195 CAGGGTCCACAGTGAGGTGAAGG + Intronic
1132337595 15:101058375-101058397 CAGGGTGTCTGGGGACGTGAGGG + Intronic
1132355399 15:101167952-101167974 AAGTGCGCCCAGGGCAGTGAGGG + Intergenic
1132656722 16:1044561-1044583 CTGGGAGCCCAGGGAGGAGAGGG + Intergenic
1132692811 16:1189115-1189137 CAGGGTCCCGAGGGAAGTGGCGG + Intronic
1133278407 16:4651644-4651666 GAGGGTGCTCGGGGCAGTGATGG + Intronic
1134214379 16:12305458-12305480 AAGTGTGCCCAGAGAAGTGAAGG - Intronic
1134242948 16:12519034-12519056 CAGGCTGTCCTGGGGAGTGACGG + Intronic
1135064563 16:19298688-19298710 CAGGGGGCACAGGGAAGGCAGGG - Exonic
1135821543 16:25691043-25691065 CATTTTGCTCAGGGAAGTGAGGG - Intergenic
1135883253 16:26279704-26279726 AAAGGTGGCCAGGGAAGTGGGGG + Intergenic
1135959900 16:26986853-26986875 CAGGCTGGCCAGGGAGGTGGGGG - Intergenic
1136064057 16:27747006-27747028 GATGGTGCCTAGGGAAGAGACGG + Intronic
1136111923 16:28068864-28068886 CACTGTTCCCAGGGAAGGGAAGG + Intergenic
1136241530 16:28947589-28947611 CAGGGTGCCGAGCGAGGTGATGG + Intergenic
1136243915 16:28962351-28962373 AATGGTGCCCAGGGAAGCTATGG - Intronic
1136355938 16:29744860-29744882 CAGGGCCCACAGGGCAGTGAGGG + Exonic
1137668506 16:50265952-50265974 CATGGTGCCCAGGGATGTTGGGG + Intronic
1138262584 16:55635998-55636020 AAGGGAGCCCAGGGAAGTGAAGG + Intergenic
1138291930 16:55855189-55855211 CCCAGTGCCCAGGGAAGTGCAGG + Intronic
1138442322 16:57042476-57042498 CAGGGTGCCCAGGGCTGCCAAGG + Intronic
1138551823 16:57752690-57752712 CAGAGGGCCCAGGGCAGGGAGGG - Intronic
1139425681 16:66878628-66878650 CAGGCTGCCCAGGTAAGCCAGGG + Intronic
1139607890 16:68032940-68032962 CAGGGTGGCCAGGGCCGAGAGGG + Intronic
1141180895 16:81752751-81752773 CAGGGTGCCCAGGGAAGTGAGGG + Intronic
1141190353 16:81820284-81820306 CAGACTGCAGAGGGAAGTGAGGG - Intronic
1141614343 16:85202173-85202195 CAGGGTTGCCTGGGCAGTGAGGG + Intergenic
1142083733 16:88164959-88164981 CACGGTGCCGAGGGAAGGCAGGG + Intergenic
1142161386 16:88559377-88559399 CAGGGGGCCCAGGGGAGTCAAGG - Intergenic
1142175671 16:88643878-88643900 CAAGGTGCCAAGGGCAGGGAAGG + Intronic
1142406637 16:89893903-89893925 CAGGCGGCCCAGGGCAGTGGTGG - Intronic
1142471595 17:166143-166165 CAGGGTGCTCAGGGAACTGCCGG - Intronic
1142709216 17:1714574-1714596 CAGGGTGGCCGGGGCTGTGAGGG + Intergenic
1143002399 17:3802845-3802867 CAGGGTGCCTCGGGAAGCCAGGG + Intergenic
1143166518 17:4899773-4899795 CAGGGTGTCCAGGGAGCTGGGGG - Exonic
1143956653 17:10675305-10675327 CAGGTTGCCCAGGCGAGAGAAGG - Exonic
1144634724 17:16897756-16897778 CAGGACCACCAGGGAAGTGATGG - Intergenic
1145786234 17:27595665-27595687 CAGGGAGCCCTGGGAAGGGAGGG - Intronic
1146164722 17:30578593-30578615 CAGGACCACCAGGGAAGTGATGG - Intergenic
1146571242 17:33955213-33955235 CATGGTGCCCAGAACAGTGATGG - Intronic
1146599920 17:34205372-34205394 CAGTGTGCCGAGGGGAATGAGGG - Intergenic
1146936838 17:36817328-36817350 CCTGGGGCCCAGGGAGGTGAGGG + Intergenic
1146958508 17:36952113-36952135 CAGGATGCACAAGGAAGTGATGG - Intronic
1147263582 17:39222628-39222650 AATGGGTCCCAGGGAAGTGAGGG - Intronic
1147556929 17:41485632-41485654 CAGGGAGAGCAGGGAGGTGAAGG - Intergenic
1147561737 17:41513522-41513544 TGGGGTGACCAGGGAAGTGAGGG - Intergenic
1147689617 17:42307334-42307356 CAGGTGGCCCAGGAAAGTCAGGG - Intronic
1147745191 17:42690596-42690618 CAGAGTGCCCAGGGCAGAGGTGG + Intronic
1148610530 17:48961698-48961720 CAGGGCGCAGAGGGAAGGGAGGG - Intronic
1148795813 17:50196180-50196202 CAGGGTGCTCGTGGAAATGATGG - Exonic
1149003283 17:51778814-51778836 CAGGCTGCTCAGGGAGGAGAGGG + Intronic
1149867264 17:60157802-60157824 CCGGGTTCCCCGGGAAGTGGGGG - Intronic
1150659508 17:67063099-67063121 TAGGGTGCCCATCAAAGTGAGGG - Intergenic
1151439414 17:74118596-74118618 GAGGCTGCACTGGGAAGTGAGGG + Intergenic
1151837569 17:76593289-76593311 CAGGGTGCCCAGGAAGGGCATGG + Intergenic
1152071787 17:78137784-78137806 CAGGGTGACCAGGAAGGCGAAGG - Exonic
1152236483 17:79141685-79141707 CAGGACCCCCAGGGAGGTGAAGG - Intronic
1152324553 17:79627960-79627982 GAGGCAGCCCAGGGGAGTGATGG - Intergenic
1152349037 17:79773002-79773024 CAGGTTCCCCAGGTGAGTGAGGG - Intergenic
1152431875 17:80252833-80252855 CAGGTAACCCAGGGAAGAGAAGG + Exonic
1152887502 17:82860938-82860960 CAGGGTGGCCAGGGACTTGGCGG + Intronic
1152962204 18:86648-86670 CTGGGAGGCCTGGGAAGTGATGG + Intergenic
1155029253 18:21969837-21969859 CAGGGTGCTGTGGGAAGTGCAGG + Intergenic
1156396676 18:36705439-36705461 CACGGTGCCCTGGGAAGGCATGG - Intronic
1157488766 18:48107820-48107842 ACAGGTGCCCAGTGAAGTGAGGG + Intronic
1157973579 18:52299501-52299523 CATGGGGCCCATGGCAGTGATGG - Intergenic
1158309147 18:56140011-56140033 CAGCCTGCCCATGGAAGAGATGG + Intergenic
1158404471 18:57148772-57148794 CAGGGTGTCCAGGATAGTCATGG - Exonic
1158872687 18:61703489-61703511 CAGGGTGCCGAGTGAGGAGATGG - Intergenic
1159703935 18:71663532-71663554 CAGTGTGGCCATGGAGGTGATGG + Intergenic
1159956233 18:74520130-74520152 CAACTTGCCCAGGGAAGTGGAGG + Exonic
1161055364 19:2188297-2188319 CAGGGTGGCCAGGGCAGGGCAGG + Intronic
1161251468 19:3282582-3282604 CACAGTGCCCAGGGAACAGAAGG + Intronic
1161288704 19:3481597-3481619 CATTGTGCCCAGGAAAGTCAAGG + Intergenic
1161422483 19:4183518-4183540 CAGAGGGCACAGGGCAGTGAGGG + Intronic
1161719720 19:5896105-5896127 CAGGGTGGTCAGGACAGTGAGGG + Intronic
1162143830 19:8600898-8600920 CTGCGTGCCCAGGGAGGGGAAGG + Intronic
1162385320 19:10357501-10357523 CAGAGTGACCAGGGCAGCGATGG - Intronic
1162829829 19:13277511-13277533 CAGGATGCCCAGGAAAGCAAGGG - Intronic
1163700793 19:18785582-18785604 CAGGGTGCCTAGGGCTGTCACGG - Intronic
1163837155 19:19581970-19581992 GAGAGTGCCCTGGGATGTGAAGG + Intronic
1164531914 19:29055307-29055329 GAGGGTGCTCTGGGAAGGGAGGG + Intergenic
1164781489 19:30896938-30896960 CAGAAGGCCCAGGGAATTGAAGG + Intergenic
1164941198 19:32253251-32253273 CCTGGTGACCAGGGAAGAGAAGG - Intergenic
1165268353 19:34680641-34680663 CAAGCTGCCCAGGCAACTGAAGG + Intronic
1165274554 19:34736863-34736885 CAGGCTGCCCAGACAACTGAAGG + Intronic
1165393787 19:35552997-35553019 GAGGGAGCCCAGGGATGGGATGG + Intronic
1165429996 19:35767094-35767116 CTGGGTCCCCAGAGAACTGAGGG - Intronic
1165501643 19:36194222-36194244 CATGGTGCCCAGGTAAGCGAGGG - Exonic
1165772203 19:38386312-38386334 CAGGAAGCCGAGGGAGGTGATGG - Exonic
1165995839 19:39843340-39843362 GATGGTGACCAGGGAAGTGCCGG + Intronic
1166582021 19:43909416-43909438 GAGGGTGCCTGGGGAAGTAAAGG - Intergenic
1166725596 19:45025465-45025487 CAGGGTGAGCACGGAAGTCAAGG - Intronic
1166983726 19:46647934-46647956 CAGAGTGCCCTGGGAAGGGAAGG - Exonic
1167103523 19:47418292-47418314 CAGGGTGCCCAGCCAGGCGAGGG - Intronic
1167514375 19:49914543-49914565 CCGGGTTCCCAGGGCTGTGAAGG - Intronic
1167960913 19:53103537-53103559 CAGGGACCCCAGGGAAGGAACGG + Intergenic
1168284667 19:55324928-55324950 GAGGGAGCCCAGGGGAGGGAGGG + Intronic
925161489 2:1687238-1687260 CAGGGTGCCCGGGGAGGAGAGGG - Intronic
925234665 2:2267312-2267334 CAGTTTCCCCATGGAAGTGAGGG - Intronic
925346640 2:3176475-3176497 GAGGGTCCCCAGGGCAGTGGTGG + Intergenic
925880181 2:8345746-8345768 CAGGGTGCCCAGAGGAGGCATGG - Intergenic
926150835 2:10424845-10424867 CAGGGTGGCCAGGGAAGTTGGGG - Intronic
927639348 2:24836906-24836928 CAGGATGCCCAGGTATGTGCAGG - Exonic
927844558 2:26464783-26464805 GAGGTTCCCCAGGGAAGTGTGGG + Intronic
927887050 2:26725071-26725093 CGGTGGGCCCAGGGAAGTCACGG + Intronic
928228614 2:29476714-29476736 GAGGCTGCCCAGGGAAGACAGGG + Intronic
928624247 2:33123141-33123163 CAGGGGTCTCAGGGAACTGATGG - Intronic
929917616 2:46149189-46149211 CATGGTGGCCAGGGAAGAGGAGG - Intronic
929999383 2:46850644-46850666 CAGGGTCCCCAGAAAAGTGAGGG + Intronic
930019644 2:46993765-46993787 CAGTTTGCCCAGGGAAGCGCTGG - Intronic
930914122 2:56666836-56666858 CAGGGTTTCCAGGCAAGTGGAGG - Intergenic
932881536 2:75506766-75506788 GAAGGTGCCCAGTGAAGTGCTGG + Intronic
934122030 2:88849622-88849644 TAGGGAGCCCAGGGAGGTGGAGG - Intergenic
934676785 2:96254927-96254949 CAGGATGCCCAGGAAACAGAAGG + Exonic
934985222 2:98880529-98880551 CAGGATGCCCAGAGAAGGGGGGG - Intronic
937196199 2:120159023-120159045 CTTGGTTTCCAGGGAAGTGAAGG + Intronic
937532174 2:122842611-122842633 TAGGGTGCCAAGTGAAGAGATGG - Intergenic
937702627 2:124881364-124881386 CAGAGTACCCAGGGAAGGAATGG + Intronic
938102180 2:128504691-128504713 TAGGGTGTCCAGGGCAGTGCAGG + Intergenic
938260997 2:129895186-129895208 CAGGATGCCCAGGGGAGGGTCGG - Intergenic
938946214 2:136214298-136214320 CAGGCTGCTCAGAGAAGTCAGGG + Intergenic
939688992 2:145234578-145234600 CAGGGTCAGCAGGGAAGTGAAGG + Intergenic
941702091 2:168614601-168614623 CAGGTTGGTCAGGGAAGTGGGGG - Intronic
942779341 2:179622842-179622864 CAGGGTGCCTAGCAAAGGGAGGG + Intronic
945127280 2:206526548-206526570 CAGGGTTGCCATGGAAGAGAGGG + Intronic
945362305 2:208906690-208906712 AAGGGTCACCAGGGAAGTGGGGG - Intergenic
947531381 2:230910675-230910697 CAGGGTGCACAGGGACGGGAAGG + Exonic
947727661 2:232410002-232410024 CAGGGTGCACCGGGAGGGGAAGG - Exonic
948405535 2:237715613-237715635 AGGTGTGCCCAGGGAAGGGAAGG + Intronic
948450756 2:238069654-238069676 CAGGGAGCCCAGTGCAGTGAGGG - Intronic
948840496 2:240646496-240646518 CTGGGCGTCCAGGCAAGTGAAGG + Intergenic
948860971 2:240752445-240752467 CGGGGTGCCCTGGGGAGGGAAGG - Intronic
948900364 2:240953683-240953705 CAGGTTCCTCAGGGAAGTGTGGG - Intronic
948901050 2:240957071-240957093 GAGGGTGCCCTGGGCAGGGAGGG + Intronic
948981637 2:241497707-241497729 CAGGGTGAGCAGGGCAGTGCAGG + Intronic
1168986771 20:2055930-2055952 CAGGGAGCCCAGGGAGCTGTGGG - Intergenic
1169011612 20:2255948-2255970 TAGGATGCCCAAGGATGTGACGG + Intergenic
1170061695 20:12265817-12265839 CAGGGTGCCCAGTGAGGGCAGGG + Intergenic
1170358246 20:15516527-15516549 AAGGGTGCCCAGGGCAGTGCGGG + Intronic
1170816752 20:19720615-19720637 CAGTGTCCCCAGGGGAGTGGGGG + Intronic
1171409289 20:24935315-24935337 CAGGGTTCCCAGTGCAGAGAAGG + Intergenic
1172486584 20:35301988-35302010 CAGTGTGCTCAGAGAAGAGATGG + Intergenic
1174254786 20:49246460-49246482 CAGGGTGCCCAAGGAGGGCAGGG + Exonic
1174265589 20:49329397-49329419 CAGGGAGCCTAGGGAAGAGGTGG + Intergenic
1174280333 20:49434524-49434546 CAGGGAGCCCAGGAAGATGATGG - Intronic
1174588155 20:51624641-51624663 CAGGGAGCCCAGTGGAGTCAGGG + Intronic
1174602493 20:51736038-51736060 ATGGGTGGCCAGGGAGGTGAGGG + Intronic
1175610499 20:60347385-60347407 AAGAGGGCCCAGGGAAGGGAGGG + Intergenic
1176120389 20:63451891-63451913 CAGGGCGTCCAGGGCAGGGAAGG + Intronic
1176388375 21:6151036-6151058 CAGGAGGCTCAGGGAAGCGAAGG - Intergenic
1177331259 21:19666529-19666551 CAGAGTGTACAGGGAAGAGAAGG + Intergenic
1177578865 21:22994076-22994098 CCGGGTTTCCAGGGAAGTGGGGG - Intergenic
1178422232 21:32451996-32452018 CAGGGTGCCCTGCGTAGAGAAGG - Intronic
1178486161 21:33021122-33021144 CAGTGCTCCCAGGGAGGTGATGG + Intergenic
1179220019 21:39398362-39398384 GAGCGTGCCCAGGGAACTGCTGG + Intronic
1179584080 21:42364188-42364210 CAGGGTGCCCAGGGTAACCACGG + Intronic
1179735097 21:43387212-43387234 CAGGAGGCTCAGGGAAGCGAAGG + Intergenic
1180159858 21:45994182-45994204 CAGGGTGATCAGGGAAGAGAAGG + Exonic
1180559510 22:16603283-16603305 AAGGGTGCGCTGGGACGTGAAGG + Intergenic
1180696501 22:17754410-17754432 CAGGGTGCCCAGGGAGGGCAGGG + Intronic
1180918611 22:19506605-19506627 CACGGTGCCAGGGGCAGTGATGG + Intronic
1181045322 22:20211567-20211589 CAGGATGCCTGGGGAAGTGCAGG - Intergenic
1181874673 22:25930753-25930775 CAGGGTGTCCAGGGAAGATGTGG - Intronic
1183061697 22:35340195-35340217 CAGGGAGTCCGGGGGAGTGAGGG + Intronic
1183280517 22:36929658-36929680 CAGGGTGGCCTGGGAGGTGTTGG - Exonic
1183589205 22:38770111-38770133 CAGGGAGCCCAGAGGAGTGGAGG - Intronic
1184128447 22:42503123-42503145 CAGGGTCCCCAGGGAAAGGCGGG + Intergenic
1184137239 22:42556438-42556460 CAGGGTCCCCAGGGAAAGGCGGG + Intronic
1184298824 22:43543116-43543138 CAGGGAGCCAAGGGGAGGGACGG + Intronic
1184374754 22:44104710-44104732 CAGGGTGGCTGGGGCAGTGAAGG - Intronic
1184529136 22:45043358-45043380 CTGGGTGCCCAGGGAAGGTGTGG + Intergenic
1184728693 22:46361100-46361122 CAGGGTGGCCGTGGAAGGGACGG - Exonic
1185000544 22:48242788-48242810 GAGAGTGCCCAGGGGATTGAAGG + Intergenic
1185026212 22:48414734-48414756 CAGGGACCTCATGGAAGTGAAGG - Intergenic
1185063114 22:48617286-48617308 CAGGGAGCCCAGGGGTGTGGCGG + Intronic
949376254 3:3393235-3393257 CAGGGGGCCAAGGTAAGTAATGG - Intergenic
949929736 3:9069354-9069376 CAGTGTGCCCAGGGCTGGGAAGG + Intronic
951440333 3:22715369-22715391 CTGTGTTCCCAGGGAACTGAGGG - Intergenic
952673676 3:36000796-36000818 CAGAGTGCCCAGGGGAAGGAGGG - Intergenic
954177548 3:48856595-48856617 CATGGTGCTCAGGGAAGAGAGGG + Intergenic
954464514 3:50646716-50646738 TAGGGGGGCCAGGGAAGAGAGGG - Intronic
954682179 3:52351684-52351706 CAAGGTGCCCAGTGTAGTGATGG - Intronic
955113133 3:55969554-55969576 CTGGCTGCTTAGGGAAGTGAAGG - Intronic
955405134 3:58621064-58621086 CATGGTTCCCAGGGAAGGGGAGG + Intronic
955466067 3:59238533-59238555 AAGGGCACCCAGGCAAGTGAAGG - Intergenic
956392463 3:68788238-68788260 TAGTGTGGCCAGGGTAGTGAGGG - Intronic
956412696 3:68995111-68995133 CAGTTTGCCCAGGGAAGAGCAGG - Intronic
957971700 3:87390649-87390671 CAGGGTTGTCAGGGAAGTGAGGG - Intergenic
959111198 3:102124509-102124531 CAGGGTTCCTAGGGAGGTGAGGG - Intronic
960945120 3:122961115-122961137 AAGTGTGCCCAGGGGAGTGTGGG - Intronic
961210352 3:125120616-125120638 CAGGGAGCCCAGGGGAATGCTGG + Exonic
961473278 3:127131854-127131876 AAGGGTGCCCAGAGCAGGGAGGG + Intergenic
961491013 3:127257020-127257042 CAGGGTGGCCAGGGAGGAGGCGG - Intergenic
961986152 3:131137324-131137346 CAGGGTGGACAGGGAAGGGATGG + Intronic
962215276 3:133515578-133515600 CATGGGCCCAAGGGAAGTGATGG - Intergenic
962279164 3:134037368-134037390 CAGGTTGGCCAGGGTGGTGAAGG - Intronic
962387722 3:134946142-134946164 GTGGGTGCCCAGGCAAGAGATGG - Intronic
962531311 3:136283429-136283451 CAGGGTGCCAAGATAAGTGTTGG + Intronic
964415885 3:156446982-156447004 CAGTGTGGCCAGAGAAGAGAAGG - Intronic
965011382 3:163096628-163096650 CAGGGTTCCTAGGGATTTGAGGG - Intergenic
966357756 3:179099918-179099940 CAGGGAGTCCAGGGAGGTTAAGG + Intergenic
966861542 3:184233470-184233492 CAGGGTACCCAGGGATGGGAAGG + Intronic
966885952 3:184378262-184378284 CAGGGGCTCCAGGGAAGAGAAGG - Intronic
966930549 3:184672878-184672900 TAGGGTGACAAGGGCAGTGATGG + Intronic
967062205 3:185882260-185882282 CAGGGTGCCCAGAGGGGGGAGGG + Intergenic
967246374 3:187491224-187491246 ATGGGTCACCAGGGAAGTGAGGG - Intergenic
968074401 3:195808693-195808715 CAAGGTGCACAGGGAAGAGCAGG - Intronic
968485379 4:858443-858465 CCGGCTGCCCAGGGCAGTCAAGG + Intronic
968603019 4:1519377-1519399 CAGGGAGCAGAGGGGAGTGAGGG - Intergenic
968651406 4:1761596-1761618 GAGAGTGCAGAGGGAAGTGACGG - Intergenic
968799691 4:2733787-2733809 CAGGGTTGCCATGGAGGTGATGG - Intergenic
968830308 4:2930237-2930259 CAGGGTGTCCAGGGAACTGCTGG + Intergenic
969418047 4:7073923-7073945 GAGGGGGCCCAGGAAAGTGGGGG - Intergenic
969592542 4:8130225-8130247 CAGGGTGGCCAGGGTGGTGCTGG + Intronic
969691260 4:8705400-8705422 CAGGGTGGCCTGGGGAGAGAGGG + Intergenic
970817898 4:20179285-20179307 CAGTGGGCCCTGGGCAGTGAGGG - Intergenic
972075225 4:35079087-35079109 CAGGGAGGCCAGGGGACTGAGGG + Intergenic
975365216 4:73520990-73521012 ACAGGTCCCCAGGGAAGTGAGGG + Intergenic
975674492 4:76812591-76812613 GAGGGGGCACAGGGAAGTGAGGG - Intergenic
978033733 4:103969673-103969695 CAGGGTGCCCATAGAACTGCTGG + Intergenic
978618596 4:110619048-110619070 CAAGGTGCCCCGGGAAGGGTTGG - Intronic
982744045 4:159087849-159087871 AATGGTGCCCAGGGAAGCAATGG + Intergenic
985569512 5:637298-637320 GAGGGTGCCGAGGGAAGAAAGGG - Intronic
985784097 5:1885291-1885313 CTGGCTGCCCTGGGAAGTGGAGG - Intronic
986737249 5:10676950-10676972 CAGGGAGAGTAGGGAAGTGATGG - Intergenic
986748346 5:10762842-10762864 CAGGGTGGCCAGAGAACTGGAGG - Intergenic
987236887 5:15951592-15951614 CTGTGTGCCCAAGGATGTGAAGG + Intergenic
990217687 5:53552314-53552336 CTGGGCACCCAGGGCAGTGAAGG + Intergenic
992124481 5:73626419-73626441 CAGGGTCCCCAGGGATGCGAGGG + Intronic
992927343 5:81602382-81602404 CAGGGAGCCCAAGGTAGAGAAGG - Intronic
993621813 5:90177483-90177505 CAGGGTAATCAGGCAAGTGAAGG + Intergenic
994094409 5:95835879-95835901 GAGGGTGCACCGGGAAGGGAGGG + Intergenic
996803924 5:127433539-127433561 CATGGTGCCCAGGGAAGGGAAGG - Intronic
996820632 5:127622868-127622890 CAGGGTTCCCAGGTAAATAAGGG + Intergenic
998531451 5:142889007-142889029 CAGGGGGCCCAAGGATGTGATGG + Intronic
998606608 5:143641818-143641840 CTGAGTGCACAGGGAAATGAGGG + Intergenic
998712297 5:144841021-144841043 CAGGCTGCCCTGAGAAGAGAGGG + Intergenic
999119206 5:149196025-149196047 CAGAGGCCCCAGAGAAGTGAGGG + Intronic
1001495363 5:172184431-172184453 CCCGGTGCCCAGAGAAGAGAAGG - Intronic
1001837340 5:174843462-174843484 CAGGATGGCCAGGGGAGTCAAGG + Intergenic
1002055860 5:176597598-176597620 GAGGGTGCCAGGGGCAGTGAAGG - Exonic
1002057359 5:176606139-176606161 CAGGGTCCCCAAGGAGGAGAAGG - Intronic
1003363348 6:5449969-5449991 CAGGTTCCTCAGGGAAGTGCAGG - Intronic
1003715635 6:8643054-8643076 CAGGGTGCCAGGGGAAATGGAGG + Intergenic
1004014211 6:11717721-11717743 CAGGGAGGACAGGGAACTGAGGG + Intronic
1004320672 6:14629037-14629059 GAGGGTGACCAAGGAAGGGAGGG - Intergenic
1006096829 6:31661374-31661396 CAGGGTGATAAGGGAAGTCAAGG - Exonic
1006173382 6:32108136-32108158 CTGGGTCCCCAGGGACTTGAAGG + Intronic
1006471854 6:34234120-34234142 CAGGGTGGTCAGGGAAGTCCTGG - Intergenic
1007387232 6:41528195-41528217 CAGGGAAGCCAGGGAAATGAAGG - Intergenic
1009858621 6:69295493-69295515 CAGGCTGCCCAGGATATTGATGG + Intronic
1009936623 6:70241990-70242012 CAGGGGGCCCAGGCAAGCCAGGG + Exonic
1011173629 6:84535344-84535366 CAGGGTGGCAAGAAAAGTGAGGG - Intergenic
1012247275 6:96939656-96939678 CAGAGAGCCAAGGGCAGTGAAGG + Intronic
1013270093 6:108537393-108537415 CAGGGTGCCCTGGGATCAGAAGG + Intergenic
1016384194 6:143515071-143515093 CAGGGTGCCCAGGCGGGAGATGG + Intergenic
1016810819 6:148259567-148259589 CTGGGTGCCCCGGGAAGGCAGGG + Intergenic
1017876566 6:158529733-158529755 CAGGGAGAGCAGGGAAGAGATGG - Intergenic
1018757443 6:166862570-166862592 GAGCGTGGCCAGGGAAGGGAGGG - Intronic
1019162275 6:170076588-170076610 CAGGGAGCCCAGGGCAGGGTAGG - Intergenic
1019553553 7:1617156-1617178 CAGGAGGCCCAGGGCAGGGAGGG + Intergenic
1019563015 7:1667261-1667283 CAGGCTGCCCAGGGAGGAGCAGG + Intergenic
1019922827 7:4173794-4173816 CTGGATGGCCAGGGGAGTGAGGG + Intronic
1021567385 7:22028792-22028814 CAGCCGGCCCCGGGAAGTGAGGG + Intergenic
1023486885 7:40697299-40697321 CACAGTGCCCAGTGAAATGAAGG + Intronic
1023816342 7:43953119-43953141 CTGGGTGCCCAGGGCAGAGCAGG + Exonic
1024007908 7:45241089-45241111 TGGGATGCCCAGGGAAGAGAGGG + Intergenic
1024064204 7:45719097-45719119 CAGGGCTCCCAGGGCTGTGAAGG + Exonic
1024395497 7:48862165-48862187 CTGGGCTCCCTGGGAAGTGAGGG - Intergenic
1024399734 7:48910111-48910133 CTGGGCTCCCTGGGAAGTGAGGG + Intergenic
1024572203 7:50732596-50732618 AAGGGTGCCCAGAGTGGTGAGGG + Intronic
1024735833 7:52303166-52303188 CCGCAAGCCCAGGGAAGTGATGG - Intergenic
1025015930 7:55439165-55439187 TAAGGTTACCAGGGAAGTGAGGG + Intronic
1026117505 7:67508414-67508436 CAGGGTGCACATTGAAATGAAGG + Intergenic
1028753397 7:94408333-94408355 TAGGGTGCCCGTGGCAGTGATGG + Exonic
1029974251 7:104817632-104817654 CTGAGTTCCCAGGGATGTGAGGG - Intronic
1031048479 7:116920981-116921003 CTGGGTAAGCAGGGAAGTGAGGG + Exonic
1031961932 7:127997936-127997958 CAGGGTGCTGTGGGAACTGATGG - Intronic
1032487766 7:132300823-132300845 CAGGGTCCCCAGGGGAGTGCTGG + Intronic
1032922664 7:136567091-136567113 GTGGGTTGCCAGGGAAGTGAAGG + Intergenic
1033289538 7:140071628-140071650 AAGGGTGGCCAGGGAACTGCCGG - Intergenic
1033445538 7:141418552-141418574 AAGGGTCACCATGGAAGTGAAGG - Intronic
1033906756 7:146214923-146214945 CAGGGGGCCGAGGGAGGTAAGGG - Intronic
1034272120 7:149808401-149808423 GGTGGTGCCCAGGGAAGTTAGGG + Intergenic
1034617726 7:152434538-152434560 AAGGGTGCGCTGGGACGTGAAGG - Intronic
1034676067 7:152893903-152893925 CAGGGTGCCCTGGGAGGTCCAGG - Intergenic
1034676074 7:152893922-152893944 CAGGGTGCCCTGGGAGGTGCAGG - Intergenic
1034676079 7:152893941-152893963 CAGGGTGCTCGGGGAGGTGCAGG - Intergenic
1034960783 7:155363034-155363056 CAGTGAGCCCAGGGGAGTGTTGG - Intronic
1035595336 8:853378-853400 CACGGTGCCCAGGGTTGTGCTGG + Intergenic
1035604403 8:920198-920220 CATGGTGCCCAGGGTCGTGCTGG + Intergenic
1035822794 8:2612425-2612447 CATGGCGCCCATGGAAGTGAGGG + Intergenic
1035945044 8:3953659-3953681 CTGGGAGCCTGGGGAAGTGATGG + Intronic
1037072681 8:14671571-14671593 CAGGGTGCCCAGGTGAGAAAAGG + Intronic
1037572907 8:20173505-20173527 AGGGGTGCCCAGGGAAGAGCAGG + Intronic
1038216320 8:25564809-25564831 CAGGGTGCCAAGACAAGGGATGG + Intergenic
1039330188 8:36529368-36529390 AAGGCTGCCCAGTGAAGAGAAGG - Intergenic
1040747635 8:50664600-50664622 CATGGTGCCCAGAGAGATGAGGG - Intronic
1040787860 8:51187967-51187989 CAGGCTGCACAGAGAAGTGGTGG - Intergenic
1040997895 8:53420159-53420181 CAGGCTATCCTGGGAAGTGAGGG + Intergenic
1041285028 8:56252089-56252111 TAGGCTGCCAAGGGAAGTGAAGG + Intergenic
1042020406 8:64368393-64368415 CAGGGTGCCCAGAGCAGAGTTGG + Intergenic
1043876609 8:85493011-85493033 CAGGGTGCCCAGGACTGTGCTGG - Intergenic
1044335894 8:90984937-90984959 CAGGGTCCACAGGGTACTGAAGG + Intronic
1045491599 8:102674396-102674418 CAAGGTGCCTAGGGAGGTGGTGG - Intergenic
1047290341 8:123524278-123524300 CTAGGTGCCCACGGAAGTGGGGG - Intronic
1048542166 8:135352543-135352565 CAAGGTGCACAGGTAAGTGAAGG - Intergenic
1048613456 8:136049242-136049264 CATTGTCCTCAGGGAAGTGAGGG + Intergenic
1048616549 8:136081228-136081250 CAGGGAGCTCAGGGAGCTGAAGG - Intergenic
1048856860 8:138693680-138693702 CAGGGTGCCAAGGGACAGGAAGG - Exonic
1049488293 8:142877653-142877675 CACTGTGCCCAGGGCAGGGAAGG - Intronic
1049683872 8:143931523-143931545 CAGGATGCCCAGGTGAGGGAGGG - Exonic
1050293494 9:4180928-4180950 CAGGATGCCCAGGGAGATGGTGG - Intronic
1051715425 9:19977941-19977963 CAGGGTGGACAGATAAGTGATGG + Intergenic
1051956344 9:22699707-22699729 GGGGGTGACCAGGGTAGTGAAGG + Intergenic
1052399734 9:27985754-27985776 CAGGATGGCCTGGGAAGTGTTGG - Intronic
1053032398 9:34792337-34792359 AAGGTTGCCCAGGGATGGGAAGG + Intergenic
1053104660 9:35399378-35399400 CTGGGTGCCCTGGGCAGAGAGGG - Exonic
1053299980 9:36942061-36942083 CAGTGTGCCCAGGCAGCTGATGG + Intronic
1053432454 9:38052085-38052107 CAGGATGTCCAGGCAAATGATGG - Intronic
1053543928 9:39003306-39003328 CACTGTGCCCAGGGAGTTGATGG - Intergenic
1053808359 9:41826803-41826825 CACTGTGCCCAGGGAGTTGATGG - Intergenic
1054622233 9:67360625-67360647 CACTGTGCCCAGGGAGTTGATGG + Intergenic
1054765747 9:69041131-69041153 CAGGGAGGACAGGGCAGTGATGG - Intronic
1055322093 9:75092228-75092250 GAGGCTGCCCAGGGAAGTCCCGG + Intronic
1057143885 9:92745622-92745644 CTGGGTGCCCAGGGGAGGGAGGG + Intronic
1057629144 9:96705883-96705905 CAAGATGCACAGGGATGTGAGGG - Intergenic
1058887328 9:109331357-109331379 CAGGGGGCCCAGGGAGGAAAGGG + Intergenic
1059328509 9:113519777-113519799 GAGCATGCCCAGAGAAGTGATGG - Intronic
1060038474 9:120279571-120279593 CAGGATGTTCAGAGAAGTGATGG + Intergenic
1060113927 9:120926446-120926468 CGATGTGCCCAGGGAAGTGGGGG - Intronic
1060295291 9:122339122-122339144 CAGGGAGGCAAGGGAAGGGATGG - Intergenic
1060730442 9:126033663-126033685 CAGGGTGCAGAGGGCAGAGAGGG + Intergenic
1060919084 9:127407719-127407741 CAGGGTGTCCTGGGCAGTGATGG - Exonic
1061195238 9:129103662-129103684 CAGGGTACCCTGGGAAGGGCCGG - Intronic
1062156430 9:135051387-135051409 CTGGGTACCCAGGGAAGTTCAGG - Intergenic
1062216943 9:135394305-135394327 CAGCGTGTTCAGGGAAGGGAAGG + Intergenic
1062446695 9:136598240-136598262 CTGGGGGCCCAGGGCAGAGACGG + Intergenic
1062484949 9:136770050-136770072 GAGGCTGCCCAGGGAAGGGGAGG - Intergenic
1062735936 9:138137469-138137491 CTGGGAGGCCTGGGAAGTGATGG - Intergenic
1186225616 X:7396067-7396089 CAGGGTGCTAAGTGAAGAGATGG + Intergenic
1186951295 X:14628590-14628612 CAGTTTTCCCAAGGAAGTGAAGG + Intronic
1188004476 X:25007503-25007525 CAGCGCGCCAAGGGAAGGGACGG - Intronic
1188442156 X:30223277-30223299 AAGGGTAACAAGGGAAGTGAGGG + Intergenic
1188526710 X:31095245-31095267 AAGGCTGCCCAGGGGAGGGAGGG + Intergenic
1189272280 X:39759950-39759972 GAGGGTGCCGGGGGAGGTGAAGG - Intergenic
1189381650 X:40506644-40506666 GAGGTTGCCCAGGGAAGGAATGG - Intergenic
1191105075 X:56767600-56767622 CTGCCTGCCCAGGGCAGTGAGGG + Intergenic
1192151434 X:68715124-68715146 GAGGGTGCCCAGGGAGTTCAGGG - Intronic
1197774363 X:130110210-130110232 CTGGGGGCCCAGGGAAGGGCGGG - Intronic
1198562636 X:137867315-137867337 CCTGGAGCCCAGGGAAGTCAGGG + Intergenic
1199728362 X:150606873-150606895 GAGGGAACCCAGGGAAGGGAGGG - Intronic
1199728370 X:150606891-150606913 GAGGGAACCCAGGGAAGGGAGGG - Intronic
1199950022 X:152699633-152699655 CAGGGTGACCAGAGAGTTGAGGG + Intronic
1199959652 X:152768828-152768850 CAGGGTGACCAGAGAGTTGAGGG - Intronic
1199963801 X:152801279-152801301 CAGGCTGCGCAGGGAAATGCTGG + Intergenic
1200063977 X:153496081-153496103 CAGGGGGCCCAGGGATCTGCAGG + Intronic
1200149103 X:153942788-153942810 CAGGGTGCCCAGGGGAGTGGGGG + Intronic
1200154210 X:153966786-153966808 GAGGGTGCTCAGGGGAGTGAGGG - Intronic
1200398154 X:156003288-156003310 CTGGGAGGCCTGGGAAGTGATGG - Intronic
1201420636 Y:13794798-13794820 GAGGGTGACCTGGGAAGTCATGG - Intergenic
1201595222 Y:15660693-15660715 CAGGGTGCTGAGTGAAGAGATGG + Intergenic