ID: 1141181608

View in Genome Browser
Species Human (GRCh38)
Location 16:81756673-81756695
Sequence GAGGCGTGGACTTCGTGAGG CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 92
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 86}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141181603_1141181608 0 Left 1141181603 16:81756650-81756672 CCCTCATTAATACTGGTGTTGAA No data
Right 1141181608 16:81756673-81756695 GAGGCGTGGACTTCGTGAGGCGG 0: 1
1: 0
2: 0
3: 5
4: 86
1141181599_1141181608 11 Left 1141181599 16:81756639-81756661 CCCAAGTGAACCCCTCATTAATA 0: 1
1: 0
2: 0
3: 5
4: 118
Right 1141181608 16:81756673-81756695 GAGGCGTGGACTTCGTGAGGCGG 0: 1
1: 0
2: 0
3: 5
4: 86
1141181600_1141181608 10 Left 1141181600 16:81756640-81756662 CCAAGTGAACCCCTCATTAATAC 0: 1
1: 0
2: 0
3: 1
4: 75
Right 1141181608 16:81756673-81756695 GAGGCGTGGACTTCGTGAGGCGG 0: 1
1: 0
2: 0
3: 5
4: 86
1141181598_1141181608 17 Left 1141181598 16:81756633-81756655 CCAGGTCCCAAGTGAACCCCTCA No data
Right 1141181608 16:81756673-81756695 GAGGCGTGGACTTCGTGAGGCGG 0: 1
1: 0
2: 0
3: 5
4: 86
1141181602_1141181608 1 Left 1141181602 16:81756649-81756671 CCCCTCATTAATACTGGTGTTGA 0: 1
1: 0
2: 1
3: 8
4: 152
Right 1141181608 16:81756673-81756695 GAGGCGTGGACTTCGTGAGGCGG 0: 1
1: 0
2: 0
3: 5
4: 86
1141181604_1141181608 -1 Left 1141181604 16:81756651-81756673 CCTCATTAATACTGGTGTTGAAG 0: 1
1: 0
2: 0
3: 8
4: 145
Right 1141181608 16:81756673-81756695 GAGGCGTGGACTTCGTGAGGCGG 0: 1
1: 0
2: 0
3: 5
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141181608 Original CRISPR GAGGCGTGGACTTCGTGAGG CGG Intronic
901774503 1:11550848-11550870 GACGCCTGGGCTTCGGGAGGGGG - Intergenic
903049425 1:20589636-20589658 GAGGTGTGGACTTAGTGTTGTGG - Intronic
922816125 1:228450675-228450697 GAGGCCTGGTCTTCGTAAGTAGG - Intergenic
1066307449 10:34159913-34159935 GAGGAGTGGACTCTATGAGGAGG + Intronic
1070949322 10:80418461-80418483 GAGGGGTGCACTGCATGAGGTGG - Intronic
1074572998 10:114641805-114641827 GAGGCATGAAGTTAGTGAGGTGG + Intronic
1077146379 11:1048078-1048100 GAGGTGGGGACTTGGGGAGGTGG + Intergenic
1085272633 11:75279308-75279330 GAGGCGTGGATTCAGTCAGGGGG + Intronic
1092239710 12:6829156-6829178 GGGGCGGGGAGGTCGTGAGGTGG + Intronic
1101365419 12:104065259-104065281 GCGGCGGGGACGTGGTGAGGCGG + Intronic
1101544900 12:105703504-105703526 GAGACGTGGGCTTGGGGAGGAGG - Intergenic
1103397889 12:120622094-120622116 GAGGCCTGGCCTTGGTGAAGAGG + Intergenic
1109058454 13:57582230-57582252 CAGGGGTGGACCTGGTGAGGGGG - Intergenic
1110815413 13:79855258-79855280 GAGGAGTTGACTTAGTGTGGGGG - Intergenic
1113505489 13:110813215-110813237 GTGACGGGGACGTCGTGAGGAGG - Intergenic
1113505566 13:110813540-110813562 GTGACGGGGACGTCGTGAGGGGG - Intergenic
1113543977 13:111131944-111131966 GAGGGGTGGACTCAGTGAGGGGG + Intronic
1116587184 14:46722073-46722095 GAGGAATGGACTTCTTCAGGAGG + Intergenic
1121109570 14:91303344-91303366 GAGGCGGGGGCCTCGTGAGAAGG - Intronic
1124025701 15:25963662-25963684 GAGGCCTGAACTTCGTGGGAAGG - Intergenic
1124883449 15:33662474-33662496 GAGGCATGGACTGCCTGGGGTGG + Exonic
1125070171 15:35545580-35545602 GAGGGGTGGACTTCTTGGGATGG + Intronic
1129257612 15:74342968-74342990 GAGGGGTGGACACGGTGAGGTGG - Exonic
1132482089 16:171882-171904 AAGGGGTGGACTTGGCGAGGGGG - Intergenic
1132495424 16:260989-261011 GAGGCAGGGGCTTCGAGAGGTGG + Intronic
1132666007 16:1081621-1081643 GAGGCGTGGAATTCGTGAACAGG + Intergenic
1141181608 16:81756673-81756695 GAGGCGTGGACTTCGTGAGGCGG + Intronic
1142032499 16:87845534-87845556 TGGGCGTGGACTCCGTGGGGTGG - Intronic
1142313635 16:89329173-89329195 CAGGCGGGGACTCCGTGAGGAGG + Intronic
1142401293 16:89860099-89860121 GAGGTGTGGACTGCAGGAGGAGG + Intronic
1142589163 17:993870-993892 GAGGGGTGGATTATGTGAGGTGG - Intergenic
1142589171 17:993914-993936 GAGGGGTGGATTATGTGAGGTGG - Intergenic
1143647979 17:8244271-8244293 AAGGTGTGGGCTTCCTGAGGAGG + Intronic
1149916432 17:60613910-60613932 GAGGCTTGGGCTGTGTGAGGCGG - Intronic
1151001293 17:70380005-70380027 GAGCAGTGGATTTTGTGAGGTGG + Intergenic
1152637583 17:81436397-81436419 GAGGCCTGGACCTCTGGAGGGGG + Intronic
1152972951 18:182934-182956 GAAGTGTGGACTTCGTGTTGTGG + Intronic
1157445147 18:47738854-47738876 GAGGTGGGGACTTTGGGAGGTGG - Intergenic
1159939893 18:74398769-74398791 GAGGTGGGGCCTTCGGGAGGTGG - Intergenic
1160241948 18:77131439-77131461 GGGGCGTGGACTTCGTTCCGGGG - Intronic
1160702764 19:516301-516323 AAGGCGGGAACTACGTGAGGCGG + Intronic
1163587888 19:18173730-18173752 GGGGCGTGGGCATCGGGAGGCGG + Exonic
1163717298 19:18879745-18879767 GAGGTGGGGCCTTGGTGAGGTGG - Intronic
1163717321 19:18879808-18879830 GAGGTGGGGGCTTGGTGAGGTGG - Intronic
1166565415 19:43762425-43762447 GAGGTGTGGACAGGGTGAGGGGG + Intergenic
1167431740 19:49459098-49459120 GAGGTGTGGACCCCGGGAGGCGG + Intronic
1168065167 19:53915151-53915173 GAGGTGTGGCCTGTGTGAGGGGG + Intronic
1168166983 19:54555333-54555355 GAGCCCTGGGCTTCCTGAGGTGG + Intergenic
929291685 2:40199335-40199357 CAGGCGTGGTCTTCCTGAAGTGG + Intronic
930090752 2:47529727-47529749 GAGGCGTGGACTCAGTGGGCAGG + Intronic
933780228 2:85795974-85795996 GAGGGGTGGCCTCTGTGAGGAGG - Intergenic
937149885 2:119679131-119679153 GGGGCGGGGACTTCGGGAGGCGG - Intergenic
938082907 2:128379740-128379762 GAGGCGTTGCCAGCGTGAGGAGG - Intergenic
938829633 2:135037555-135037577 GAGGGGTGGACATTGTTAGGAGG + Intronic
947184045 2:227439066-227439088 TAGGTGAGGACTTGGTGAGGAGG + Intergenic
1174214400 20:48904930-48904952 GTCCCCTGGACTTCGTGAGGTGG + Intergenic
1176286440 21:5021573-5021595 GAGGCGGGGGCTCCGGGAGGAGG + Intergenic
1177866882 21:26522962-26522984 GAAGTCTGGACTTCGTCAGGAGG + Intronic
1178436781 21:32567125-32567147 CAGGAGTGGACCTGGTGAGGGGG - Intergenic
1179870741 21:44241902-44241924 GAGGCGGGGGCTCCGGGAGGAGG - Intergenic
1184595629 22:45512370-45512392 GAGGCGTGGAGTTGGCGTGGGGG + Intronic
950515674 3:13463439-13463461 GAGGGGTGAGCTTGGTGAGGAGG + Intergenic
954584476 3:51721333-51721355 GAGGCGGAGACATCTTGAGGGGG - Intergenic
958736210 3:98012024-98012046 GTGGGGTGGAGTTGGTGAGGAGG + Intronic
961075455 3:123977805-123977827 GTGGAGTGGACTTCGTTTGGGGG + Intronic
961674467 3:128556062-128556084 GAGGCGGGAACTTGGTGGGGTGG - Intergenic
962310945 3:134326468-134326490 GAGTCGTGGCCTCCGGGAGGGGG - Intergenic
962751181 3:138435583-138435605 GAGGCCTGGACTGCGGTAGGGGG + Intronic
962866438 3:139451479-139451501 GAGGCCTGCACTTCCTCAGGAGG + Intergenic
963605605 3:147409953-147409975 CAGGCTAGGACTTCGCGAGGTGG + Exonic
963735827 3:149016709-149016731 GAGGAATGGACTTGCTGAGGTGG - Intronic
968508924 4:986965-986987 GGGGCGGGGCCTTGGTGAGGGGG - Intronic
968630775 4:1649867-1649889 CAGGCGTGGTGTTTGTGAGGTGG + Intronic
968630803 4:1650066-1650088 CAGGCGTGGTGTTTGTGAGGTGG + Intronic
968630814 4:1650149-1650171 CAGGCGTGGTGTTTGTGAGGTGG + Intronic
968630833 4:1650290-1650312 CAGGCGTGGTGTTTGTGAGGTGG + Intronic
968947444 4:3672794-3672816 GAGGTGAGGACTTTGGGAGGTGG - Intergenic
982324808 4:154119437-154119459 GAGGCAGGGACTCCCTGAGGGGG - Intergenic
994031490 5:95149101-95149123 CAGAAGTGGACTTGGTGAGGGGG - Intronic
998106645 5:139473156-139473178 GAGGGAGGGACTTTGTGAGGTGG - Intergenic
1017007488 6:150038237-150038259 GGAGCATGGACGTCGTGAGGCGG + Intergenic
1017725287 6:157272720-157272742 GAGGCATGGAGTTGGTGGGGGGG + Intergenic
1019157722 6:170050344-170050366 GACGCGTGGTGTTGGTGAGGAGG - Intergenic
1037405301 8:18536347-18536369 GAGGCCTGGACTACCTGGGGAGG - Intronic
1037935858 8:22914646-22914668 CAGGCGTGGACTCTGAGAGGAGG - Intronic
1049582832 8:143420574-143420596 GACGCGTGGACAAGGTGAGGAGG + Intronic
1052924392 9:34002780-34002802 GGGGGGTGGAGTGCGTGAGGTGG - Intronic
1053259319 9:36647994-36648016 GAGTCATGTACTTTGTGAGGGGG + Intronic
1060389476 9:123267134-123267156 GTGGCGTGGAGTGTGTGAGGTGG - Intronic
1062500345 9:136849405-136849427 GAGGAGGGGACTCCGGGAGGAGG + Exonic
1189993622 X:46618047-46618069 GAGGGGTGGAATTTGAGAGGAGG + Intronic
1198277709 X:135112400-135112422 CAGGAGTGGACTTGGTGAGGAGG - Intergenic