ID: 1141183951

View in Genome Browser
Species Human (GRCh38)
Location 16:81773903-81773925
Sequence CCCATCATGCAGGACTTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 488
Summary {0: 1, 1: 0, 2: 0, 3: 33, 4: 454}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141183947_1141183951 -4 Left 1141183947 16:81773884-81773906 CCTCCAACTACACTCTGTGCCCA No data
Right 1141183951 16:81773903-81773925 CCCATCATGCAGGACTTTGATGG 0: 1
1: 0
2: 0
3: 33
4: 454
1141183946_1141183951 8 Left 1141183946 16:81773872-81773894 CCTTTTTGTGTTCCTCCAACTAC 0: 1
1: 0
2: 0
3: 23
4: 223
Right 1141183951 16:81773903-81773925 CCCATCATGCAGGACTTTGATGG 0: 1
1: 0
2: 0
3: 33
4: 454
1141183943_1141183951 11 Left 1141183943 16:81773869-81773891 CCCCCTTTTTGTGTTCCTCCAAC 0: 1
1: 0
2: 2
3: 34
4: 286
Right 1141183951 16:81773903-81773925 CCCATCATGCAGGACTTTGATGG 0: 1
1: 0
2: 0
3: 33
4: 454
1141183944_1141183951 10 Left 1141183944 16:81773870-81773892 CCCCTTTTTGTGTTCCTCCAACT 0: 1
1: 0
2: 0
3: 18
4: 302
Right 1141183951 16:81773903-81773925 CCCATCATGCAGGACTTTGATGG 0: 1
1: 0
2: 0
3: 33
4: 454
1141183942_1141183951 17 Left 1141183942 16:81773863-81773885 CCAAAGCCCCCTTTTTGTGTTCC 0: 1
1: 0
2: 1
3: 41
4: 347
Right 1141183951 16:81773903-81773925 CCCATCATGCAGGACTTTGATGG 0: 1
1: 0
2: 0
3: 33
4: 454
1141183948_1141183951 -7 Left 1141183948 16:81773887-81773909 CCAACTACACTCTGTGCCCATCA 0: 1
1: 0
2: 3
3: 20
4: 235
Right 1141183951 16:81773903-81773925 CCCATCATGCAGGACTTTGATGG 0: 1
1: 0
2: 0
3: 33
4: 454
1141183945_1141183951 9 Left 1141183945 16:81773871-81773893 CCCTTTTTGTGTTCCTCCAACTA 0: 1
1: 0
2: 2
3: 30
4: 316
Right 1141183951 16:81773903-81773925 CCCATCATGCAGGACTTTGATGG 0: 1
1: 0
2: 0
3: 33
4: 454

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141183951 Original CRISPR CCCATCATGCAGGACTTTGA TGG Intronic
901751284 1:11411125-11411147 ACCCTCATGGATGACTTTGAGGG + Intergenic
902954873 1:19918742-19918764 CACAGCATTCAGGACCTTGAGGG - Intergenic
904202191 1:28827668-28827690 GCCCTCATGGATGACTTTGAGGG - Intronic
904605914 1:31697524-31697546 CCATTCATGCTGGGCTTTGAAGG + Intronic
904799090 1:33080478-33080500 GACATTATACAGGACTTTGATGG + Intronic
904863191 1:33555971-33555993 ACCCTCATGCATGACTTTGATGG + Intronic
905654396 1:39676783-39676805 CCGATCATGCAGGACCTGGAGGG + Intergenic
905843310 1:41204438-41204460 CAGATCATGCAGGACTATGTGGG - Intronic
906269685 1:44466356-44466378 ACCCTCATGGATGACTTTGAGGG - Intronic
907548214 1:55281463-55281485 ACCCTCATGGATGACTTTGAGGG + Intergenic
907633058 1:56104209-56104231 GCCATCATGATTGACTTTGAAGG - Intergenic
908036991 1:60066590-60066612 ACCCTCATGGATGACTTTGAGGG - Intronic
908487889 1:64613049-64613071 ACCTTCATGGATGACTTTGAGGG + Intronic
908664001 1:66468997-66469019 CCCAACATTCAAGACTTTTATGG + Intergenic
908975322 1:69890021-69890043 ACCCTCATGGATGACTTTGAGGG - Intronic
910231594 1:84993408-84993430 TCCCTCATGGATGACTTTGAAGG - Intronic
910345308 1:86229697-86229719 GCAATCATCCAGTACTTTGAGGG - Intergenic
910782497 1:90954786-90954808 ACCCTCATGTATGACTTTGAGGG - Intronic
910795565 1:91094385-91094407 CCCATGATGCAGGAGTCTCATGG - Intergenic
911135721 1:94437869-94437891 ACCCTCATGGATGACTTTGAGGG + Intronic
911712596 1:101092258-101092280 ACCCTCATGAATGACTTTGAGGG - Intergenic
915006420 1:152641865-152641887 ACCCTCATGGATGACTTTGAGGG - Intergenic
916076790 1:161205113-161205135 CCCATCATGAAGAATTTTGGTGG + Intronic
917562171 1:176170170-176170192 GCCGTCATGGATGACTTTGAAGG - Intronic
918130601 1:181624690-181624712 ACCCTCATGAATGACTTTGAGGG - Intronic
918361302 1:183761059-183761081 ACCCTCATGAATGACTTTGAGGG - Intronic
918694492 1:187527377-187527399 ACCATCATGGATGACTTTGAAGG + Intergenic
919487768 1:198165173-198165195 ACCCTCATGGACGACTTTGAGGG - Intronic
920869394 1:209781477-209781499 CCCATCATCCAGGGCTTTATGGG - Exonic
921090938 1:211842059-211842081 ACCCTCATGGATGACTTTGAGGG - Intergenic
921224246 1:213001950-213001972 GCCCTCATGGATGACTTTGAGGG - Intronic
921233279 1:213096353-213096375 ACCCTCATGGATGACTTTGAGGG - Intronic
921306833 1:213805635-213805657 TCCCTCATGGATGACTTTGAGGG - Intergenic
921405153 1:214770897-214770919 ACCCTCATGCATGACTTTGAGGG - Intergenic
922333456 1:224598183-224598205 TCCCTCATGGATGACTTTGAGGG + Intronic
922429080 1:225529220-225529242 CAGATCATGCAGGACCTTGCAGG - Intronic
922651120 1:227339450-227339472 TCCATTATGTATGACTTTGAGGG - Intergenic
923014539 1:230116034-230116056 ACCTTCATGGATGACTTTGAGGG - Intronic
923496177 1:234526881-234526903 CCCAGCATGCAGCTGTTTGATGG - Intergenic
924354268 1:243153052-243153074 ACCCTCATGGATGACTTTGAGGG + Intronic
924409566 1:243789555-243789577 ACCCTCATGGATGACTTTGAGGG - Intronic
924532376 1:244904343-244904365 CACACCATGCAGGGCTTTGCTGG - Intergenic
1065358217 10:24863751-24863773 ACCCTCATGCATAACTTTGAGGG + Intronic
1065899668 10:30194582-30194604 CCCTTCATGGATGACTTTGAGGG + Intergenic
1066237824 10:33503761-33503783 ACCCTCATGGATGACTTTGAGGG - Intergenic
1067186589 10:44033981-44034003 GCCCTCATGGATGACTTTGAGGG - Intergenic
1067515411 10:46936658-46936680 ACCCTCATGGATGACTTTGAGGG + Intronic
1067646840 10:48115152-48115174 ACCCTCATGGATGACTTTGAGGG - Intergenic
1069899556 10:71699615-71699637 CCCATCAGCCAGGTCCTTGAAGG - Intronic
1070144732 10:73765523-73765545 CCCTTCATGCAGTTCATTGAAGG + Exonic
1070218365 10:74412098-74412120 ACCCTCATGGATGACTTTGAGGG - Intronic
1070489311 10:76961230-76961252 ACCCTCATGGATGACTTTGAGGG + Intronic
1071683544 10:87731673-87731695 TCCTTCATGGATGACTTTGAGGG + Intronic
1073118635 10:101107968-101107990 CTGGTCATGCAGGACTTTGCTGG - Intronic
1074468189 10:113703264-113703286 ACCCTCATGGATGACTTTGATGG + Intronic
1074493593 10:113959900-113959922 CACAAGATGCAGGAGTTTGAAGG - Intergenic
1075971084 10:126653603-126653625 ACCCTCATGGATGACTTTGAGGG - Intronic
1076206039 10:128604056-128604078 ACCTTCGTGGAGGACTTTGAGGG + Intergenic
1076297459 10:129397664-129397686 CGGATCCTGCAGGACTTTGTGGG - Intergenic
1076316173 10:129543312-129543334 CTCATCATTCACGACTTGGAAGG - Intronic
1077774162 11:5253246-5253268 CCCATGATGCAGAGCTTTCAAGG - Exonic
1078117625 11:8469495-8469517 ACCCTCATGGAAGACTTTGAAGG - Intronic
1078265904 11:9756218-9756240 CCTATCAGCCTGGACTTTGAGGG - Intergenic
1078975751 11:16474213-16474235 ACCCTCATGGATGACTTTGAAGG - Intronic
1078995733 11:16697213-16697235 ACCCTCATGGATGACTTTGAGGG - Intronic
1081071453 11:38615333-38615355 ACCCTCATGAATGACTTTGAGGG - Intergenic
1081261642 11:40969120-40969142 ACCATCATGGATGACTTTGACGG + Intronic
1081695787 11:45108316-45108338 CCCATGATGCAGCAGCTTGAGGG + Intronic
1081925050 11:46819387-46819409 CAGATCATGCAGGACTATGAAGG + Intronic
1083166878 11:60894561-60894583 GCCCTCATGGATGACTTTGAGGG - Intronic
1084761741 11:71277196-71277218 ACCCTCATGGATGACTTTGAGGG + Intergenic
1085367065 11:75958608-75958630 ACCCTCATGGATGACTTTGAGGG - Intronic
1087017846 11:93571930-93571952 CACATCAGGCAGGACCTTAAAGG + Intergenic
1087665572 11:101043434-101043456 TCCCTCTTGCATGACTTTGAGGG - Intronic
1088462984 11:110102342-110102364 ACCCTCATGGATGACTTTGAGGG + Intronic
1088947318 11:114527706-114527728 TCAATCATGCTGGACTTTAAAGG - Intronic
1089212887 11:116817963-116817985 GCCATCCTGCAGGTCTCTGAGGG - Intergenic
1089415522 11:118286204-118286226 ACCCTCATGGATGACTTTGAGGG + Intergenic
1089489659 11:118874283-118874305 AACTTCAGGCAGGACTTTGAGGG - Intergenic
1091561466 12:1617341-1617363 CCCATCATGCTGTTCTTTAAAGG - Intronic
1091993802 12:4977192-4977214 CCCATCATTCAGGATTGTGGTGG + Intergenic
1092364702 12:7867377-7867399 ACCATCATGGATGACTTTGATGG + Intronic
1092382538 12:8009348-8009370 ACCCTCATGGATGACTTTGATGG + Intergenic
1092737353 12:11595093-11595115 CCGATCATGCAGGACATTGTAGG - Intergenic
1093635061 12:21457066-21457088 ACCTTCATGGATGACTTTGAGGG - Intronic
1093686879 12:22066826-22066848 ACCCTCATGGATGACTTTGAGGG - Intronic
1094677210 12:32632566-32632588 CAAATTATGCAGGACTTTGGAGG + Intronic
1094754151 12:33447043-33447065 ACCCTCATGGATGACTTTGAGGG - Intergenic
1095567103 12:43637537-43637559 ACCTTCATGAATGACTTTGAGGG + Intergenic
1097204651 12:57310125-57310147 CTCTTGATGCAGGAGTTTGAGGG + Intronic
1097240596 12:57572485-57572507 CCCTTCATGCAAGACCCTGAGGG - Intronic
1097518276 12:60634965-60634987 ACCCTCATGAATGACTTTGAGGG + Intergenic
1097788416 12:63787414-63787436 ACCCTCATGGATGACTTTGAGGG - Intronic
1098889937 12:75999603-75999625 ACCCTCATGGATGACTTTGAGGG - Intergenic
1099335718 12:81354591-81354613 ACCCTCATGGATGACTTTGAAGG - Intronic
1101562252 12:105868402-105868424 ACCTTCATGGATGACTTTGAGGG + Intergenic
1101886516 12:108668198-108668220 CCCTACATGCAGGCCTTTGTGGG - Intronic
1102438221 12:112941838-112941860 CCCCTCACCCAGGACATTGAAGG - Exonic
1103215873 12:119201066-119201088 CAGATCATGTGGGACTTTGAAGG - Intronic
1103944929 12:124520758-124520780 CCCATCACGCAAGCCTTCGACGG + Intronic
1104143976 12:126014936-126014958 ACTCTCATGCATGACTTTGAGGG - Intergenic
1104533955 12:129600381-129600403 ACCCTCATGGATGACTTTGAGGG - Intronic
1104799691 12:131545753-131545775 ACCCTCATGGATGACTTTGAGGG + Intergenic
1104991811 12:132628850-132628872 ACCCTCATGGATGACTTTGAGGG - Intronic
1105833738 13:24190548-24190570 CCCCTCATGGATGACTTTGAGGG + Intronic
1108770721 13:53697534-53697556 ACCATCATGAATGATTTTGAGGG + Intergenic
1108801581 13:54102741-54102763 ACCCTCATGGATGACTTTGAGGG - Intergenic
1108844904 13:54666338-54666360 TCCCTCATGGATGACTTTGAGGG - Intergenic
1109953375 13:69532247-69532269 ACCTTCATGGATGACTTTGAGGG + Intergenic
1110490887 13:76105289-76105311 CCTTTTATGTAGGACTTTGAGGG - Intergenic
1110724010 13:78798473-78798495 ACCCTCATGAATGACTTTGAGGG - Intergenic
1111936376 13:94562090-94562112 ACCCTCATGGATGACTTTGAGGG - Intergenic
1112622876 13:101069971-101069993 GCCATTATGGATGACTTTGAGGG - Intronic
1113712948 13:112482358-112482380 GTCATCATGGATGACTTTGAGGG - Intergenic
1113722574 13:112571069-112571091 GCCATGATGGATGACTTTGAGGG - Intronic
1113991629 14:16032028-16032050 GCCCTCATGGAAGACTTTGAAGG + Intergenic
1114585677 14:23811025-23811047 GCCCTCATGGATGACTTTGAAGG + Intergenic
1114862304 14:26539184-26539206 CCCAGCATGCAGGACAGTGCCGG + Intronic
1115043580 14:28961159-28961181 ACCATCATGGATGACTTGGAGGG - Intergenic
1115060511 14:29183359-29183381 ACCCTCATGGATGACTTTGAGGG - Intergenic
1115891469 14:38034232-38034254 ACCCTCATGAATGACTTTGAGGG - Intronic
1116299894 14:43165131-43165153 ACCCTCATGGATGACTTTGAGGG + Intergenic
1117887115 14:60376378-60376400 ACCCTCATGGATGACTTTGAGGG + Intergenic
1118125107 14:62893217-62893239 ACCCTCATGGATGACTTTGAGGG + Intronic
1118507845 14:66433988-66434010 CCCCTCATGGTTGACTTTGAGGG + Intergenic
1118509397 14:66454454-66454476 CCAATTTTGTAGGACTTTGAAGG + Intergenic
1118692951 14:68357390-68357412 ACCTTCATGAATGACTTTGAGGG - Intronic
1120482177 14:85064174-85064196 ACCCTCATGGATGACTTTGAGGG + Intergenic
1120577572 14:86202410-86202432 ACCATCATGGGTGACTTTGAGGG + Intergenic
1120665809 14:87305267-87305289 CCCATGATACAGAAATTTGAAGG + Intergenic
1121018541 14:90563971-90563993 ACCCTCATGGATGACTTTGAGGG - Intronic
1121538520 14:94707852-94707874 CCCATCCTGCAGGGCCTTAAAGG + Intergenic
1122585738 14:102805206-102805228 CCCATCATGGGGGAGTTTGGAGG + Intronic
1122818918 14:104331067-104331089 ACCATCATGGATGACTTTGAGGG - Intergenic
1124060441 15:26289183-26289205 CCCTTCAGGCAGTACTTTGAAGG + Intergenic
1124093451 15:26627568-26627590 GCCCTCATGGATGACTTTGAGGG + Intronic
1125465417 15:39946311-39946333 ACCCTCATGGATGACTTTGAGGG + Intronic
1125503668 15:40254302-40254324 CCCATCCTGGAGAGCTTTGAGGG + Intronic
1125875644 15:43141812-43141834 ACCCTCATGGATGACTTTGAGGG + Intronic
1126432103 15:48597391-48597413 CCCATCATGGAACTCTTTGATGG + Intronic
1126828396 15:52574024-52574046 ACCCTCATGGATGACTTTGAGGG + Intergenic
1126971713 15:54120773-54120795 ACCCTCATGGATGACTTTGAGGG + Intronic
1127307824 15:57725357-57725379 ACTCTCATGCATGACTTTGAGGG + Intronic
1127648931 15:60987374-60987396 CCCATCATGCAGTACTGTTTTGG - Intronic
1127952415 15:63822224-63822246 TACATCATGTAGGACTTTGCAGG + Intronic
1128629204 15:69246211-69246233 ACCTTCATGGATGACTTTGAGGG - Intronic
1128722684 15:69962882-69962904 ACCCTCATGGATGACTTTGAGGG + Intergenic
1129120035 15:73390697-73390719 CCCCTCATCCAGGTCTTTGGAGG + Intergenic
1130335378 15:82952981-82953003 TCCATCAGGCAGGATGTTGATGG - Intronic
1134877091 16:17710526-17710548 CCTATAATCCAGCACTTTGAGGG + Intergenic
1135582226 16:23638492-23638514 CCCATCATCCAGATCCTTGAAGG + Intronic
1135819604 16:25671263-25671285 GCCCTCATGGATGACTTTGAGGG + Intergenic
1136629466 16:31481082-31481104 CACATCATGAAGGCCTTTGACGG + Intergenic
1136910937 16:34143599-34143621 GCCCTCATGGAAGACTTTGAGGG + Intergenic
1137416273 16:48283989-48284011 GCCCTCATGGATGACTTTGAGGG + Intronic
1137740476 16:50766705-50766727 ACCCTCATGGATGACTTTGAGGG + Intronic
1139081988 16:63533338-63533360 ACCTTCATGCATGACTTTGAGGG - Intergenic
1140574583 16:76151361-76151383 ACCCTCATGAATGACTTTGAGGG - Intergenic
1140650293 16:77080906-77080928 GCCCTCATGAATGACTTTGAGGG - Intergenic
1141183951 16:81773903-81773925 CCCATCATGCAGGACTTTGATGG + Intronic
1141349490 16:83280498-83280520 ACCCTCATGGATGACTTTGAGGG - Intronic
1144852975 17:18253391-18253413 TCCAACAAGCTGGACTTTGACGG - Exonic
1145315457 17:21729132-21729154 ACCCTCATGGATGACTTTGAAGG - Intergenic
1145713891 17:27001069-27001091 ACCCTCATGGATGACTTTGAAGG - Intergenic
1146096892 17:29938850-29938872 ACCCTCATGGATGACTTTGAGGG - Intronic
1149518304 17:57297982-57298004 ACCCTCATGCATGATTTTGAGGG - Intronic
1150217261 17:63477523-63477545 CCCAGCATGCACGAGTTGGATGG + Intergenic
1150316004 17:64169504-64169526 CTCAACATGCAGGAATTAGATGG + Intronic
1150912301 17:69401050-69401072 ACCCTCATGGATGACTTTGAGGG + Intergenic
1152981634 18:283387-283409 ACCCTCATGGATGACTTTGAGGG + Intergenic
1153634437 18:7101331-7101353 CACATCCTGAAGGAATTTGATGG + Intronic
1154096482 18:11421052-11421074 ACCTTCATGGATGACTTTGAGGG - Intergenic
1154227749 18:12523152-12523174 ACCCTCATGGATGACTTTGAGGG + Intronic
1156181898 18:34614577-34614599 ACCCTCATGAATGACTTTGAGGG + Intronic
1156444784 18:37228012-37228034 ACCCTCATGGATGACTTTGAGGG + Intronic
1157371744 18:47119609-47119631 ACCCTCATGGATGACTTTGAGGG - Intronic
1158230512 18:55249412-55249434 CCCCACCTGCAGGACTCTGAAGG + Intronic
1158870227 18:61679705-61679727 TCCATTAAGCAGGATTTTGAAGG + Intergenic
1159139507 18:64376214-64376236 GCTAACATGCAGGGCTTTGATGG + Intergenic
1160166030 18:76513263-76513285 ACCCTCATGCATGACTTGGAGGG - Intergenic
1160905023 19:1447901-1447923 CCCATCAGGCAGGGGTTTGGGGG - Intronic
1161657167 19:5523396-5523418 CAAATCATGCAGGCCTTTGTGGG - Intergenic
1161669424 19:5597015-5597037 CACATCACCCAGCACTTTGATGG + Intronic
1163477078 19:17532753-17532775 CACACCATGTAGGGCTTTGAGGG + Intronic
1168191589 19:54742174-54742196 CCCATGATGCAAGACCTTGCAGG + Exonic
1168376916 19:55887713-55887735 CCTATCTTACAGGGCTTTGATGG + Intergenic
1168533327 19:57147826-57147848 ACCCTCATGGATGACTTTGAGGG + Intergenic
925200350 2:1962868-1962890 ACCCTCATGGACGACTTTGAGGG - Intronic
925527983 2:4824986-4825008 TCCCTCATGGATGACTTTGAGGG + Intergenic
926979287 2:18550238-18550260 ACCCTCATGGATGACTTTGAGGG + Intergenic
927298964 2:21488249-21488271 ACCTTCATGGATGACTTTGAGGG - Intergenic
928657357 2:33466353-33466375 ACCCTCATGGACGACTTTGAGGG + Intronic
929982254 2:46692464-46692486 CAGATCATGCAGAACTTTGAAGG - Intergenic
930322047 2:49867806-49867828 ACCCTCATGGATGACTTTGAGGG - Intergenic
930491930 2:52084900-52084922 ACCCTCTTGCATGACTTTGAGGG - Intergenic
930507295 2:52299491-52299513 ACCCTCATGGATGACTTTGAGGG + Intergenic
930991673 2:57663680-57663702 GCCCTCATGCATGACTTTAAGGG - Intergenic
931934610 2:67182754-67182776 CCCATCATGAAGAACCTTGTAGG + Intergenic
932760893 2:74438589-74438611 CAGATCATGCAGGGCCTTGAAGG - Intronic
934043965 2:88155953-88155975 ACCCTCATGGATGACTTTGAAGG + Intergenic
935641860 2:105298510-105298532 CATATCCTACAGGACTTTGAAGG - Exonic
936256964 2:110924709-110924731 ACCCTCATGGATGACTTTGAGGG - Intronic
936920341 2:117682271-117682293 ACCCTCATGAATGACTTTGAGGG + Intergenic
937662266 2:124444707-124444729 CCCACTATGCAGGACTTTGTAGG - Intronic
937950595 2:127384518-127384540 GCCCTCATGGATGACTTTGAGGG + Intronic
938621420 2:133058481-133058503 ACCCTCATGAATGACTTTGAGGG + Intronic
938678504 2:133663784-133663806 ACCTTCATGGATGACTTTGAGGG - Intergenic
938960828 2:136339802-136339824 ACCTTCATGGATGACTTTGAGGG + Intergenic
939185834 2:138859880-138859902 ACCCTCATGGATGACTTTGAGGG - Intergenic
939730405 2:145777571-145777593 CTCATCATGCTGGACATGGAGGG - Intergenic
940236046 2:151511983-151512005 CCTATGATGCAGGAATTTTAAGG - Intronic
942110400 2:172676443-172676465 ACCTTCATGGATGACTTTGAGGG + Intergenic
943330806 2:186556691-186556713 TCCTTCATGTATGACTTTGAGGG - Intergenic
943822332 2:192341352-192341374 CCAAGCATACAGGATTTTGAAGG - Intergenic
943957455 2:194210520-194210542 ACCCTCATGGATGACTTTGAAGG + Intergenic
944003689 2:194875586-194875608 ACCCTCATGGATGACTTTGAGGG + Intergenic
944138297 2:196425548-196425570 ACCCTCATGGATGACTTTGAAGG + Intronic
944325777 2:198401825-198401847 CAGATCATGCAGGACCTTGTAGG - Intronic
944415988 2:199480263-199480285 CCCTTCATCCTGGACTCTGAAGG - Intergenic
945126283 2:206514350-206514372 ACCGTCATGGATGACTTTGAGGG + Intronic
946063261 2:216963759-216963781 ACCCTCATGGATGACTTTGAGGG + Intergenic
947050501 2:226037505-226037527 ACCCTCATGGATGACTTTGAGGG + Intergenic
947060827 2:226163221-226163243 CCCATCACGCAGCATTCTGATGG - Intergenic
947665823 2:231904743-231904765 CCCAACATGAAGGCCTTTGATGG - Intergenic
948098932 2:235358466-235358488 CCCAGCCTTCAGGACTGTGACGG - Intergenic
948379163 2:237541077-237541099 CCCAGCATGCACGGCTCTGAAGG + Intronic
1169849964 20:10037389-10037411 CCCATCATCCAGAACTATGAGGG - Intronic
1170116812 20:12869280-12869302 GCCATGATGCAGGACATGGAAGG + Intergenic
1170429982 20:16267013-16267035 CCTATTATGTGGGACTTTGAAGG + Intergenic
1170753487 20:19173992-19174014 ACCCACATGGAGGACTTTGAGGG - Intergenic
1171182616 20:23101984-23102006 GCCATCCAGCAGGGCTTTGATGG + Intergenic
1171236600 20:23531454-23531476 ACCATCATGAATGACTTTGAGGG - Intergenic
1171812952 20:29760440-29760462 GCCCTCATGGAAGACTTTGAGGG - Intergenic
1171824355 20:29880508-29880530 GCCCTCATGGATGACTTTGAGGG + Intergenic
1171906281 20:30901866-30901888 GCCCTCATGGAAGACTTTGAGGG + Intergenic
1172601707 20:36188335-36188357 CTTCTCATGCAGGACTCTGAGGG + Exonic
1173447099 20:43129027-43129049 ACCCTCATGCAGGACCTTCAAGG - Intronic
1173559552 20:43993150-43993172 CGGATCATGCAGGACTTTGCAGG + Intronic
1173707267 20:45120415-45120437 ACCCTCATGAATGACTTTGAGGG - Intergenic
1174608342 20:51777984-51778006 ACCCTCATGGATGACTTTGATGG - Intergenic
1175088201 20:56479121-56479143 CCCCTCATGGACGACTTGGAGGG - Intronic
1175412557 20:58780354-58780376 TGCATCATGCAGGACTTCTAGGG + Intergenic
1175464199 20:59179002-59179024 CCCAGCATGAAGGACTTGAAGGG + Intergenic
1176689652 21:9889282-9889304 ACCTTCATGGATGACTTTGAGGG - Intergenic
1177167415 21:17618326-17618348 ACTATCATGAATGACTTTGAGGG - Intergenic
1177461237 21:21414253-21414275 ACCCTCATGGATGACTTTGAGGG - Intronic
1177626604 21:23670308-23670330 CCAATCATGCAGGTCTTAGAGGG + Intergenic
1177869316 21:26551545-26551567 GCCCTCATGGATGACTTTGATGG + Intronic
1178100438 21:29262751-29262773 ACCCTCATGCATGACTTTGAGGG - Intronic
1178967624 21:37137415-37137437 GCCCTCATGGATGACTTTGAGGG + Intronic
1180083200 21:45496111-45496133 CCCAGCATGGAGGGCTTGGAGGG - Intronic
1180315641 22:11275498-11275520 GCCCTCATGGAAGACTTTGAAGG - Intergenic
1180339703 22:11607984-11608006 GCCCTCATGGAAGACTTTGAGGG + Intergenic
1180900271 22:19366526-19366548 ACCCTCATGAATGACTTTGAGGG + Intronic
1180932431 22:19601629-19601651 ACCCTCATGGATGACTTTGAGGG - Intergenic
1181515908 22:23412777-23412799 ACCCTCATGGATGACTTTGAGGG + Intergenic
1183476651 22:38039371-38039393 CCCACCTTGCAGGGCTGTGAGGG - Intronic
1183757977 22:39788324-39788346 ACCCTCATGGATGACTTTGAGGG + Intronic
1184082903 22:42237456-42237478 GCCCTCATGGATGACTTTGAGGG - Intronic
949728790 3:7082768-7082790 ACCCTCATGGATGACTTTGAGGG + Intronic
950246228 3:11421582-11421604 ACCCTCATGGATGACTTTGAGGG - Intronic
951923984 3:27887152-27887174 TACATCATGCAGAACTTTGTAGG - Intergenic
953436177 3:42879690-42879712 ACCCTCATGAATGACTTTGAGGG + Intronic
953484134 3:43278557-43278579 ACCCTCATGGATGACTTTGAGGG + Intergenic
954748096 3:52798402-52798424 CCAATCATCCAGGACTTCCAGGG + Intronic
954854469 3:53631496-53631518 ACCCTCATGGATGACTTTGAGGG - Intronic
955414776 3:58681639-58681661 CCACTCCTGCAGGACTTTGTGGG + Intergenic
955593646 3:60564602-60564624 GCCCTCATGGATGACTTTGAGGG + Intronic
956063438 3:65371959-65371981 ACCTTCATGGATGACTTTGAGGG - Intronic
956180373 3:66512257-66512279 ACCCTCATGGATGACTTTGAGGG - Intergenic
956411638 3:68985837-68985859 CCCATCCTGCAGAACTGTAAGGG - Intronic
958452214 3:94287726-94287748 ACCTTCATGGATGACTTTGAGGG + Intergenic
958959532 3:100495690-100495712 CCCAACCTGCAGGACCTGGATGG - Intronic
959511288 3:107215543-107215565 GCCTTCATGGATGACTTTGAAGG + Intergenic
959546462 3:107602629-107602651 CCCCTCATGGATGACATTGAGGG + Intronic
959689431 3:109182632-109182654 CAGATCATGCAGGGCCTTGAAGG - Intergenic
959999888 3:112720150-112720172 CACATCATACAGGATTTTGTCGG + Intergenic
960382834 3:116985655-116985677 ACCCTCATGAATGACTTTGAGGG + Intronic
961962907 3:130870520-130870542 ACCCTCATGGATGACTTTGAGGG + Intronic
962711793 3:138092923-138092945 GCCATCGTGGATGACTTTGAGGG - Intronic
962828938 3:139122889-139122911 CCCATCTCGCTGGCCTTTGAGGG - Intronic
963054120 3:141170486-141170508 ACCCTCATGGATGACTTTGAGGG + Intergenic
963494810 3:146045497-146045519 ACCATCATTCAGGAATCTGAAGG + Intergenic
964398720 3:156275845-156275867 GCCCTCATGGATGACTTTGAGGG - Intronic
964466227 3:156996442-156996464 CACATCATGCAGGGCCTTGCAGG + Intronic
964596855 3:158442583-158442605 CCCCTCATGGATGATTTTGAAGG - Intronic
964909581 3:161763160-161763182 ACCCTCATGAATGACTTTGAAGG + Intergenic
965352400 3:167629748-167629770 ACCCTCATGGAAGACTTTGAGGG + Intronic
965403573 3:168243469-168243491 ACCCTCATGGATGACTTTGAGGG + Intergenic
965595636 3:170408191-170408213 ACCCTCCTGCATGACTTTGAGGG + Intergenic
966061890 3:175767915-175767937 GTCATCATGCAGGATTTGGAAGG - Intronic
966633128 3:182101068-182101090 ACCCTCATGAACGACTTTGAGGG - Intergenic
966750714 3:183319373-183319395 ACCCTCATGGATGACTTTGAAGG - Intronic
967936801 3:194735038-194735060 ACCTTCATGGATGACTTTGAAGG - Intergenic
968029264 3:195469074-195469096 CCGATCATGCAGACCTTTGCTGG + Intergenic
968153785 3:196361131-196361153 ACCCTCATGGATGACTTTGAGGG + Intronic
971046120 4:22806963-22806985 CTCATCATATAGGACTTTGAAGG + Intergenic
971295322 4:25384322-25384344 ACCCTCATGGATGACTTTGAGGG - Intronic
971666233 4:29489168-29489190 ACCATTATGCAGGATTTTGGAGG + Intergenic
971830975 4:31694004-31694026 ACCTTCATGGATGACTTTGAGGG + Intergenic
972263971 4:37440723-37440745 ACCATCATGCAGGACTTGAAAGG - Intronic
972586153 4:40438571-40438593 CGCCTCATGATGGACTTTGACGG - Exonic
974423147 4:61704991-61705013 ACTTTCATGCATGACTTTGAAGG - Intronic
974531354 4:63111572-63111594 ACCCTCATGGATGACTTTGAGGG + Intergenic
974791641 4:66698142-66698164 AACATCATGGATGACTTTGAGGG - Intergenic
975024393 4:69530956-69530978 CCCCTGAGGCAGGACTGTGAAGG - Intergenic
975217239 4:71769882-71769904 CCACTAATGCAGGACTTTAAAGG + Intronic
976458175 4:85274562-85274584 ACCTTCATGGATGACTTTGATGG + Intergenic
976468606 4:85400660-85400682 ACCCTCATGGATGACTTTGAAGG + Intergenic
977104108 4:92858402-92858424 ACCATCATACATGACTTTTAAGG + Intronic
978703011 4:111672210-111672232 CCAATCATTCAGGCCTTTGTAGG - Intergenic
979247539 4:118526586-118526608 ACCCTCATGGATGACTTTGAGGG - Intergenic
979345526 4:119582440-119582462 GCCTTCATGGATGACTTTGAAGG - Intronic
979695147 4:123604567-123604589 AACATCATGGATGACTTTGAGGG + Intergenic
979729344 4:124005108-124005130 ACCCTCATGCATGACTTTGAGGG - Intergenic
980353056 4:131707141-131707163 ACCCTCATGGATGACTTTGAGGG - Intergenic
980546677 4:134272538-134272560 ACCTTCATGGATGACTTTGAGGG + Intergenic
981764435 4:148232049-148232071 TCCATCATGGATGACTTTGAGGG - Intronic
982036501 4:151351197-151351219 ACCCTCATGGATGACTTTGAGGG + Intergenic
983333049 4:166356143-166356165 ACCCTCATGGATGACTTTGAGGG - Intergenic
984305927 4:177990551-177990573 CCCAACATTCGGGACTTTGTGGG + Exonic
984454024 4:179942222-179942244 ACCTTCATGAATGACTTTGAGGG - Intergenic
984567191 4:181345355-181345377 ACCCTCATGGATGACTTTGAGGG + Intergenic
985338089 4:188917463-188917485 ACCCTCATGGATGACTTTGAAGG - Intergenic
985369478 4:189270296-189270318 GCCCTCATGGATGACTTTGAGGG + Intergenic
985564761 5:609899-609921 CCCCTCCTGCAAGACTGTGAAGG - Intergenic
985606779 5:862154-862176 CTGATCCTGCAGGACTTAGAGGG - Intronic
987089059 5:14495106-14495128 ACCCTCATGGATGACTTTGAAGG + Intronic
987124602 5:14800061-14800083 ACCCTCATGGATGACTTTGAGGG + Intronic
987522660 5:19006805-19006827 ACCATCCTGCAGGATGTTGAAGG - Intergenic
988220240 5:28335735-28335757 CCCATCATGCAAAACTTCCAGGG - Intergenic
989128676 5:38082306-38082328 ACCCTCATGGATGACTTTGAGGG + Intergenic
989760192 5:45006261-45006283 ACCTTCATGGATGACTTTGAGGG + Intergenic
990222538 5:53608729-53608751 ACCCTCATGAATGACTTTGAAGG - Intronic
990887189 5:60607940-60607962 CAGATCATGCAGAACTTTGTAGG + Intronic
991603245 5:68374409-68374431 ACCATCATTCTTGACTTTGAAGG - Intergenic
992179630 5:74183703-74183725 GGCCTCATGCATGACTTTGATGG - Intergenic
992216802 5:74533241-74533263 ACCCTCATGGATGACTTTGAGGG + Intergenic
993787497 5:92161332-92161354 ACCCTCATGTATGACTTTGAAGG + Intergenic
993946214 5:94119901-94119923 CAGATCATGCAGGACTTTATAGG - Intergenic
994899897 5:105758383-105758405 ACCCTCATGGATGACTTTGAGGG - Intergenic
995339434 5:111041153-111041175 ACCCTCATGGATGACTTTGAGGG - Intergenic
996526204 5:124482678-124482700 ACCCTCATGGATGACTTTGAGGG - Intergenic
996673304 5:126144946-126144968 ACCCTCATGGAGGACTTTGAGGG + Intergenic
997094200 5:130892301-130892323 CACATCATGCAGTGCTTTGCAGG + Intergenic
998012799 5:138708880-138708902 CCCCTGACGCAGGACTTAGATGG - Intronic
998652195 5:144133350-144133372 GCCATCATTCAGCACCTTGATGG + Intergenic
999688170 5:154121286-154121308 ACCCTCATGGATGACTTTGAAGG + Intronic
999825588 5:155270602-155270624 GCCATCATTCAGGACAGTGAGGG + Intergenic
1000129434 5:158281356-158281378 ACCATCATCAATGACTTTGAGGG + Intergenic
1000312463 5:160058307-160058329 ACCCTCATGGATGACTTTGAGGG - Intronic
1001703540 5:173724590-173724612 CCCATCATCCAGGGATTTTATGG + Intergenic
1001804375 5:174570754-174570776 CACATCACACAGGACTTTGTAGG + Intergenic
1001837980 5:174848079-174848101 CCGAGGATGCAGGACTTTAAAGG - Intergenic
1001996992 5:176170132-176170154 CAAATTATGCATGACTTTGAAGG - Intergenic
1003365993 6:5475587-5475609 CCCATGATGCAGAGCCTTGAAGG - Intronic
1003394374 6:5740721-5740743 CACATTATCCAGGACATTGAAGG + Intronic
1005073427 6:21883955-21883977 CACATCATCCTGGACTGTGAAGG + Intergenic
1005469411 6:26147304-26147326 TCCATGATTCAGGAATTTGAGGG - Intergenic
1008125970 6:47668647-47668669 ACCCTCATGAATGACTTTGAGGG + Intronic
1008254955 6:49286766-49286788 ACCCTCATGGATGACTTTGAGGG - Intergenic
1008319521 6:50091082-50091104 ACCCTCATGGATGACTTTGAAGG + Intergenic
1008916983 6:56798859-56798881 ACCCTCATGGATGACTTTGAAGG + Intronic
1010724443 6:79317359-79317381 CCCCTCATGGATGATTTTGAGGG - Intergenic
1010898563 6:81397348-81397370 ACCTTCATGAACGACTTTGAGGG + Intergenic
1011060779 6:83264615-83264637 ACCCTCATGGATGACTTTGAGGG + Intronic
1011391664 6:86860195-86860217 ACCCTCATGGATGACTTTGAGGG - Intergenic
1011772870 6:90694392-90694414 AAGATCATGCAGGACTCTGAAGG + Intergenic
1012182996 6:96178080-96178102 CCCATGATGCCAGACTTTGCTGG + Intronic
1012188126 6:96247298-96247320 CAGATCATGTAGGACTTTGTAGG + Intergenic
1012702284 6:102474851-102474873 CCCATCATGTGGGACATTCAGGG + Intergenic
1012930839 6:105314696-105314718 CCCTTCAGGAATGACTTTGAGGG - Intronic
1013823857 6:114187392-114187414 ACCCTCATGGATGACTTTGAGGG + Intronic
1013922687 6:115427644-115427666 ACCCTCATGGATGACTTTGAGGG - Intergenic
1014337398 6:120154483-120154505 ACCCTCATGGATGACTTTGAGGG - Intergenic
1014698392 6:124652658-124652680 CACAACAAGAAGGACTTTGATGG - Intronic
1015746290 6:136513555-136513577 ACCTTCATGAATGACTTTGAGGG - Intronic
1016572336 6:145528950-145528972 ACCATCATGGATAACTTTGATGG + Intronic
1016579423 6:145613359-145613381 ACCATCCTGAATGACTTTGAGGG - Intronic
1017068974 6:150555627-150555649 ACCCTCATGGATGACTTTGAGGG + Intergenic
1017533267 6:155318971-155318993 ACCCTCATGGATGACTTTGAGGG - Intergenic
1019986516 7:4660338-4660360 CCCAGGATGCAGGACTTTTGTGG + Intergenic
1020423949 7:8042431-8042453 CCCTTAATGGATGACTTTGAGGG + Intronic
1020523406 7:9224550-9224572 ACCCTCATGGATGACTTTGAGGG + Intergenic
1021376433 7:19913539-19913561 TCCCTCATGGATGACTTTGAGGG - Intergenic
1021732943 7:23614439-23614461 ACCCTCATGGATGACTTTGAGGG - Intronic
1022063351 7:26823710-26823732 ACCCTCATGGATGACTTTGAGGG + Intronic
1022146478 7:27547071-27547093 CACATCATGTAGGGCTTTGTAGG - Intronic
1022606271 7:31817440-31817462 CAGATCATGCAGGGCTTTGGAGG + Intronic
1023514703 7:40989932-40989954 ACCCTCATGAATGACTTTGAGGG - Intergenic
1024877222 7:54039463-54039485 CCCCTCATGAATGACTTTGAGGG - Intergenic
1026569133 7:71514209-71514231 CCCATCATGCAGTTTTTTGTTGG - Intronic
1026590495 7:71690720-71690742 ACCCTCATGGATGACTTTGAGGG + Intronic
1027057959 7:75063305-75063327 CACAGGATGCAGGACTTCGATGG - Exonic
1027553180 7:79627305-79627327 CCCATAATTCTGCACTTTGAGGG - Intergenic
1027596291 7:80178052-80178074 ACCCTCATGAATGACTTTGAGGG + Intronic
1028870684 7:95768371-95768393 ACCCTCATGGATGACTTTGAGGG + Intergenic
1029674362 7:102057555-102057577 ACCCTCATGGATGACTTTGAGGG + Intronic
1030190599 7:106806758-106806780 CCCATGAGGCAGTCCTTTGATGG - Intergenic
1030487526 7:110189091-110189113 CAGATCATGCAGGACTTTGTAGG + Intergenic
1031234568 7:119157982-119158004 ACCTTCATGGATGACTTTGAGGG - Intergenic
1032427762 7:131835209-131835231 CCCAGCATTCAGAACTTTGCAGG + Intergenic
1034210909 7:149361711-149361733 ACCCTCATGGATGACTTTGAAGG + Intergenic
1035387245 7:158481959-158481981 ACCCTCATGCATGACTTTCAGGG + Intronic
1037120571 8:15281123-15281145 GTCCTCATGCATGACTTTGAGGG + Intergenic
1037327722 8:17710576-17710598 ACCGTCATGGATGACTTTGAGGG - Intronic
1039702014 8:39971669-39971691 ACCCTCATGGATGACTTTGAGGG + Intronic
1040058194 8:43079873-43079895 GCCCTCATGGATGACTTTGAGGG + Intronic
1040732298 8:50463190-50463212 ACCCCCATGGAGGACTTTGAGGG - Intronic
1041055544 8:53982270-53982292 ATCATCATGGATGACTTTGAGGG + Intronic
1041099988 8:54386592-54386614 ACCCTCATGGATGACTTTGAGGG - Intergenic
1041626774 8:60038471-60038493 ACCCTCATGGATGACTTTGAGGG + Intergenic
1042943728 8:74133632-74133654 ACCCTCATGGATGACTTTGAGGG + Intergenic
1043800896 8:84608330-84608352 CACCTCATGCAGGACTGGGATGG + Intronic
1043944680 8:86236211-86236233 ACCCTCATGGATGACTTTGATGG - Intronic
1044089685 8:87983740-87983762 ACCATCATGAATGACTTTGAGGG - Intergenic
1044616055 8:94142917-94142939 ACCCTCATGGATGACTTTGAGGG - Intronic
1044807837 8:96026803-96026825 ACCCTCATGGATGACTTTGAGGG + Intergenic
1044889359 8:96816442-96816464 ACCCTCATGGATGACTTTGAGGG - Intronic
1045218935 8:100178150-100178172 CCCAAGATGCAGGACTTCAAAGG - Intronic
1045232837 8:100321511-100321533 ACTCTCATGCATGACTTTGAGGG - Intronic
1045355295 8:101382762-101382784 ACCATCATGAATGACTTTGAAGG - Intergenic
1045842698 8:106598112-106598134 ACCATCATGTAGGACTCTAAAGG - Intronic
1046029369 8:108765318-108765340 TCCATCATCCTGGACTTTAAGGG + Intronic
1046201373 8:110932580-110932602 ACCCTCATGGATGACTTTGAGGG - Intergenic
1046653021 8:116860032-116860054 ACCCTGATGCATGACTTTGAGGG + Intronic
1046841140 8:118858527-118858549 CCCATAGTGCAGGGCTTTGTGGG - Intergenic
1048817882 8:138351011-138351033 CCCATAATGTAAGACTTTCAGGG - Intronic
1049182308 8:141229287-141229309 GGCATGAGGCAGGACTTTGAGGG - Intronic
1050057440 9:1670519-1670541 CCCAACAAGCAGGAGCTTGAAGG + Intergenic
1050383678 9:5060675-5060697 ACCCTCATGGATGACTTTGAGGG - Intronic
1050541760 9:6676381-6676403 CACATCATATAGGACTTTGTGGG - Intergenic
1050967512 9:11825149-11825171 GCCTTCATGGATGACTTTGAGGG + Intergenic
1051123947 9:13782674-13782696 ACCCTCATGGATGACTTTGAGGG + Intergenic
1051601593 9:18880170-18880192 GCCCTCATGGATGACTTTGAGGG - Intronic
1051875986 9:21793897-21793919 CCCATCATCCAGGTCCTTCATGG + Intergenic
1053250557 9:36570878-36570900 ACCCTCATGGATGACTTTGAGGG + Intergenic
1053296675 9:36919938-36919960 GCCCTCATGGATGACTTTGAGGG + Intronic
1053748852 9:41233689-41233711 GCCCTCATGGATGACTTTGAGGG - Intergenic
1053779608 9:41592200-41592222 ACCCTCATGGATGACTTTGAGGG + Intergenic
1054167564 9:61802441-61802463 ACCCTCATGGATGACTTTGAGGG + Intergenic
1054337525 9:63819698-63819720 GCCCTCATGGATGACTTTGAGGG + Intergenic
1054669978 9:67778459-67778481 ACCCTCATGGATGACTTTGAGGG - Intergenic
1055547352 9:77393330-77393352 ACCATCATGGATGACTTTGAGGG - Intronic
1055873887 9:80919213-80919235 CTCATCATTGATGACTTTGAAGG - Intergenic
1059049718 9:110910744-110910766 ACCCTCATGGATGACTTTGAAGG + Intronic
1059158300 9:112009675-112009697 ACCCTCATGGATGACTTTGAGGG + Intergenic
1059175445 9:112166195-112166217 CCTATTCTGCAGGACTTTGCGGG + Intronic
1059423921 9:114209249-114209271 CCCTACATCCAGGACCTTGAAGG + Intronic
1059711936 9:116876185-116876207 ACCCTCATGAATGACTTTGAGGG + Intronic
1059810056 9:117846465-117846487 GCCATCATTCTGGATTTTGATGG - Intergenic
1060066547 9:120506644-120506666 ACCCTCATGGATGACTTTGAGGG + Intronic
1060463655 9:123882931-123882953 CAGATCATGTAGGACTTTGTAGG - Intronic
1060565363 9:124586320-124586342 ACCCTCATGGATGACTTTGAGGG + Intronic
1060844133 9:126821505-126821527 ACCCTCATGGATGACTTTGAGGG + Intronic
1061204888 9:129157113-129157135 CCCACCATGCTGGCCTTTGTAGG - Intergenic
1062083630 9:134637401-134637423 TCCAGCATCCAGGACTGTGAGGG + Intergenic
1203363928 Un_KI270442v1:241435-241457 GCCCTCATGGAAGACTTTGAAGG - Intergenic
1203377426 Un_KI270442v1:386948-386970 GCCCTCATGGATGACTTTGAGGG + Intergenic
1186953384 X:14653415-14653437 ACCCTCATGGATGACTTTGAGGG + Intronic
1186977971 X:14928593-14928615 CTCATCATTCAGGACTTTGTAGG - Intergenic
1187273248 X:17797755-17797777 CCCCTCATCCAGGCGTTTGATGG - Intergenic
1187760226 X:22575229-22575251 GCCCTCATGGATGACTTTGAGGG + Intergenic
1187814844 X:23220129-23220151 GCCCTCATGGATGACTTTGAGGG - Intergenic
1189395144 X:40614696-40614718 CCCATCAAGCAGGATTTCGTAGG + Intergenic
1190460622 X:50669901-50669923 CCCCTCATAAATGACTTTGAGGG - Intronic
1192028449 X:67482503-67482525 ACCATCATGGAAAACTTTGAGGG - Intergenic
1194169839 X:90567315-90567337 CCAATCATACAGGTATTTGATGG - Intergenic
1194286374 X:92015747-92015769 CCGCTCATGGATGACTTTGAGGG - Intronic
1195011193 X:100733695-100733717 ACCCTCATGGATGACTTTGAAGG + Intergenic
1195138083 X:101931440-101931462 CTCATGAGGCAGGAGTTTGAAGG - Intronic
1195231086 X:102848738-102848760 ACCCTCATGGATGACTTTGAGGG - Intergenic
1195725717 X:107913912-107913934 AAAATCATGCAGGACTTTGTAGG - Intronic
1195819060 X:108923069-108923091 ACCCTCATGAATGACTTTGAGGG + Intergenic
1195987729 X:110648906-110648928 ACCCTCATGGATGACTTTGAGGG - Intergenic
1196003794 X:110813914-110813936 CAGATCATGTAGGGCTTTGAAGG + Intergenic
1196504860 X:116429755-116429777 ACCCTCATGGATGACTTTGAGGG + Intergenic
1196721672 X:118860100-118860122 ACCTTCATGGATGACTTTGAGGG + Intergenic
1197358369 X:125466318-125466340 ACCCTCATGAATGACTTTGAGGG - Intergenic
1197456271 X:126679549-126679571 ACCCTCATGAATGACTTTGAGGG - Intergenic
1198144880 X:133845046-133845068 CCCACCAAGGAGGACTGTGAGGG - Intronic
1198318742 X:135497330-135497352 CCGTTCATGTAGGACTTTGTAGG - Intergenic
1198885467 X:141331057-141331079 GCCATCATGGAAAACTTTGAAGG + Intergenic
1199762078 X:150912721-150912743 CCCGGCATGCTGGACTCTGATGG - Intergenic
1200020354 X:153199125-153199147 ACCCTCATGAATGACTTTGAGGG + Intergenic
1200516080 Y:4145089-4145111 CCAATCATACAGGTATTTGATGG - Intergenic
1200603920 Y:5240299-5240321 CCACTCATGGATGACTTTGAGGG - Intronic
1200923585 Y:8634558-8634580 CACATCATGAATGCCTTTGAGGG - Intergenic