ID: 1141198514

View in Genome Browser
Species Human (GRCh38)
Location 16:81879507-81879529
Sequence GACTCTCTGATGCTTCTCAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141198512_1141198514 -5 Left 1141198512 16:81879489-81879511 CCCACACAAACTGATGTGGACTC 0: 1
1: 0
2: 0
3: 11
4: 101
Right 1141198514 16:81879507-81879529 GACTCTCTGATGCTTCTCAGAGG No data
1141198510_1141198514 11 Left 1141198510 16:81879473-81879495 CCAGAAGAAACACACACCCACAC 0: 1
1: 1
2: 25
3: 421
4: 3581
Right 1141198514 16:81879507-81879529 GACTCTCTGATGCTTCTCAGAGG No data
1141198513_1141198514 -6 Left 1141198513 16:81879490-81879512 CCACACAAACTGATGTGGACTCT 0: 1
1: 0
2: 2
3: 11
4: 167
Right 1141198514 16:81879507-81879529 GACTCTCTGATGCTTCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141198514 Original CRISPR GACTCTCTGATGCTTCTCAG AGG Intronic
No off target data available for this crispr