ID: 1141199123

View in Genome Browser
Species Human (GRCh38)
Location 16:81883597-81883619
Sequence GAGAAGACTGAGAAGATGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 500
Summary {0: 1, 1: 0, 2: 7, 3: 51, 4: 441}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141199118_1141199123 16 Left 1141199118 16:81883558-81883580 CCTCATGTCGGGCCTCTTTTGAA 0: 1
1: 0
2: 0
3: 34
4: 673
Right 1141199123 16:81883597-81883619 GAGAAGACTGAGAAGATGGCAGG 0: 1
1: 0
2: 7
3: 51
4: 441
1141199120_1141199123 4 Left 1141199120 16:81883570-81883592 CCTCTTTTGAAGGCACACATTGA 0: 1
1: 0
2: 1
3: 9
4: 163
Right 1141199123 16:81883597-81883619 GAGAAGACTGAGAAGATGGCAGG 0: 1
1: 0
2: 7
3: 51
4: 441

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141199123 Original CRISPR GAGAAGACTGAGAAGATGGC AGG Intronic
900430209 1:2597806-2597828 GACAGGAAGGAGAAGATGGCAGG - Intronic
901386444 1:8912346-8912368 GAAAAGACTGAGAAATTGGATGG + Intergenic
901439605 1:9269742-9269764 GGGAAGACTGAGGAAATGGGAGG - Exonic
902179907 1:14679974-14679996 GACAAGAGGGAGAAGGTGGCTGG + Intronic
902753281 1:18532424-18532446 GAGAAGATTGAGGGGAGGGCAGG - Intergenic
903019386 1:20383364-20383386 GAGATGAGTGAGACGATGCCTGG - Intergenic
903286638 1:22281587-22281609 GAGGAGACTGAGAAGTTGGCTGG + Intergenic
904142302 1:28363258-28363280 GGGAAGGCTGAGAGGATGGAAGG - Intergenic
904317640 1:29676108-29676130 GAGAGCACTGAGAAGGAGGCTGG + Intergenic
904802424 1:33103273-33103295 GAGGTGCCTGGGAAGATGGCAGG - Intronic
904854115 1:33483141-33483163 GAGAAAACTGAGATAATGTCAGG - Intronic
904960248 1:34327079-34327101 GAGAAGAGAGAGATGATGGAGGG - Intergenic
905004419 1:34698411-34698433 GAGAAAACTGAGAGGGTCGCAGG + Intergenic
905174299 1:36126226-36126248 AAGGAGACTGAGAAGATGGCAGG + Intergenic
905488983 1:38328851-38328873 GAGGAGACAGAGAAGAGGGAAGG - Intergenic
905489590 1:38333150-38333172 GACAAGAGTGAGAAGATGGGTGG - Intergenic
906479095 1:46188746-46188768 GAGAAGGCTGAGAGGAGGCCTGG + Exonic
906674318 1:47682269-47682291 GTCAAGGCTGAGAAGATGGGAGG - Intergenic
909039754 1:70635194-70635216 GGGAACTCTGAGGAGATGGCTGG - Intergenic
909692508 1:78424574-78424596 GGGAACACTGACAAAATGGCAGG - Intronic
910445952 1:87299181-87299203 TGGAAGACAGAGAAGATGGGTGG + Intergenic
912822450 1:112878886-112878908 GAGAAGGCTGAGAAGCAGGAAGG - Intergenic
913241290 1:116832175-116832197 GAGGAGACTCAGAAGATGGTGGG - Intergenic
914345720 1:146796908-146796930 GAGACGATTGAGAATAAGGCGGG - Intergenic
915768367 1:158390913-158390935 GAGAAAAATGTGAAGAGGGCTGG - Intergenic
915842365 1:159224779-159224801 GAGAAGTCTGAGAGGATCTCAGG + Intergenic
915868674 1:159533889-159533911 TAGAAGACAGAGAAGATCACAGG + Intergenic
917504926 1:175618900-175618922 GAGAAGACTGAGGATTTGGTTGG + Intronic
918932622 1:190875250-190875272 TACAAGACTGAGATGTTGGCAGG + Intergenic
919166769 1:193905510-193905532 GAGATGACTGAGAAGCAGGATGG + Intergenic
919306015 1:195838760-195838782 GATAAAACTGAGGAAATGGCCGG + Intergenic
919687358 1:200496669-200496691 GATAAGACTGAAAAGATGGTGGG - Intergenic
920052162 1:203170860-203170882 CTGAAGACTGTGAAGAGGGCTGG - Intronic
920459544 1:206128698-206128720 GAGAATATTGGGAACATGGCAGG - Intergenic
920669010 1:207988799-207988821 GAGAAGGAGGAGAAGATGGCGGG - Intergenic
920994270 1:210972960-210972982 TAGAAGAGTGAGTAGATGGGAGG - Intronic
921056300 1:211545119-211545141 GAGTAAACTGGGAAGATGGGAGG - Intergenic
921335947 1:214086498-214086520 GAGAAGGCTGAGAAGAAGATAGG - Intergenic
921837180 1:219790350-219790372 GAGAAGACTGAGAACAGAACTGG - Intronic
922580670 1:226695596-226695618 GAGAAGAGAGAGAGGATGGCGGG - Intronic
923978853 1:239297320-239297342 GACATGACTGAGGAGATGCCAGG - Intergenic
923985858 1:239380943-239380965 TAGAAGTCTTAGAAGATGGCCGG - Intergenic
924047823 1:240050464-240050486 GAGAAGACTCAGAAGCTGCTGGG + Intronic
1063267273 10:4467375-4467397 GAGAAGAATGAGAGAATGACGGG - Intergenic
1063735284 10:8746748-8746770 GAGAAGACAGAGAGGGAGGCTGG + Intergenic
1063914490 10:10867729-10867751 GAGAAGACAAAGAACATGACTGG - Intergenic
1063985910 10:11501678-11501700 GAGACCAGTGAGAAGGTGGCAGG - Intronic
1064939408 10:20715865-20715887 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
1065813710 10:29465275-29465297 AACAAGACTGAGAGGAAGGCTGG + Intronic
1065957947 10:30709700-30709722 AACAAGACTGAGAGGAAGGCTGG - Intergenic
1066008722 10:31172297-31172319 GAGCAGACTCACAAGAGGGCAGG - Intergenic
1066332905 10:34444209-34444231 GAGAAGGTTGTGAAAATGGCAGG + Intronic
1068020258 10:51573215-51573237 GAGAAAACTCAAAAGATGGCTGG - Intronic
1068757936 10:60675376-60675398 CAGAAAACTGGGAAGATGGGTGG - Intronic
1069285651 10:66711968-66711990 GAGCAGTCAGAAAAGATGGCTGG - Intronic
1070180885 10:74012656-74012678 GAGAGGAGTGAGGAGATGGTGGG + Intronic
1070338017 10:75472105-75472127 GAGAAGACTTGGAAGAGGGAAGG - Intronic
1070470831 10:76777661-76777683 GAGAAGACTGAGAAAATGGAAGG - Intergenic
1070707063 10:78647514-78647536 CAGCAGACTCAGAAGATGGAAGG - Intergenic
1070935284 10:80289416-80289438 GAGAAGTGTGAGAAGATGAATGG - Exonic
1071040647 10:81305590-81305612 GAGATGAATCAGAAGAAGGCAGG + Intergenic
1071186229 10:83049193-83049215 GAGAAGAATGAGAAGAACACAGG - Intergenic
1071310579 10:84339798-84339820 GAGAAGGCTGAGAAGATGAATGG - Intronic
1071761940 10:88617528-88617550 GAGAAGACAGAGAGGAGGGAAGG + Intergenic
1072261029 10:93673319-93673341 GAGAAGAGTGAAAGGATGGGAGG - Intronic
1072740370 10:97905494-97905516 GAGAAGACTAAGAGGCTGTCAGG - Intronic
1073019679 10:100432525-100432547 TAAAAGACTGAGAAGCGGGCTGG - Intergenic
1073163981 10:101427497-101427519 GAGAAGAAAGAGAAGAAGGAAGG - Intronic
1073764868 10:106671020-106671042 AAGAGGACTCGGAAGATGGCTGG - Intronic
1073926296 10:108520104-108520126 GAGAAGACAAAGCAGAAGGCAGG + Intergenic
1075277764 10:121110327-121110349 GAGAAGTCAGAGAGGATGGATGG + Intergenic
1075330149 10:121568122-121568144 GAGAAGGAGGAGAAGACGGCAGG + Intronic
1075680797 10:124329903-124329925 GAGAAGAATGGGATGATGGTGGG - Intergenic
1076230446 10:128816147-128816169 GAGAAGGATGAGTAGATGGGTGG + Intergenic
1076611280 10:131727271-131727293 AAGAAGCCACAGAAGATGGCGGG - Intergenic
1077832589 11:5890847-5890869 GAGAAAACTAAGAATATGCCTGG - Intronic
1077943078 11:6864224-6864246 GAGAAGACTGGGGAGAAGGAGGG - Intergenic
1078189035 11:9076223-9076245 GAGGAGGCAGAGGAGATGGCAGG + Intronic
1078427447 11:11263461-11263483 GGAAAGACTGAGCAGAGGGCAGG - Intergenic
1078873071 11:15367055-15367077 GAGAAGAGTGTGAAGATGTTTGG + Intergenic
1078874090 11:15376505-15376527 AAGGAGACTGAGGAGATGGAGGG + Intergenic
1079389436 11:20008393-20008415 GAAAAGACAGAGAAGATGACAGG - Intronic
1081446995 11:43140207-43140229 GAGAAGCCCAAGAAGATGCCAGG - Intergenic
1081806429 11:45893404-45893426 GAGAACAGTGAGGAGCTGGCAGG + Intronic
1083556306 11:63631362-63631384 AAGAAGACCAAGAAGATGGGTGG - Exonic
1083897046 11:65625195-65625217 CAGAAGACTGAGAAGAGGACAGG - Exonic
1084456762 11:69272348-69272370 GAGTGGGGTGAGAAGATGGCAGG - Intergenic
1084923031 11:72487273-72487295 GAGAAGACTGAGTAGGGAGCTGG + Intergenic
1085482339 11:76833115-76833137 GACAAGACAGAGAGGAGGGCTGG - Intergenic
1085665631 11:78413568-78413590 GAGCCGACTGAGAAGAAGGTGGG + Intronic
1086842759 11:91707895-91707917 GTGAAGACAGAGAAAATGTCAGG - Intergenic
1086898674 11:92341546-92341568 GACAAGACTGACAAGATTTCTGG + Intergenic
1087101463 11:94369479-94369501 GAGAAATCTGAGAAGACTGCGGG - Intergenic
1087951190 11:104221771-104221793 GAGAAGGCTCAGGAAATGGCTGG + Intergenic
1088312716 11:108477019-108477041 GAGAGCACTGAGAAGATGGGAGG + Intronic
1088779942 11:113124186-113124208 GAGAAGACAAAGAAGACAGCAGG - Intronic
1088868459 11:113871308-113871330 GAGAAGACAGTGAAGGTGTCTGG + Intronic
1089117236 11:116105546-116105568 GAGAAAGCTGAGAAGATCACTGG - Intergenic
1089401128 11:118165247-118165269 GAGGAGCCAGAGAAGAGGGCAGG + Exonic
1089573491 11:119424874-119424896 TAGATGAATGGGAAGATGGCTGG - Intronic
1090166067 11:124548873-124548895 GAGAACACTGAGCAGCTGGAAGG - Intergenic
1090791423 11:130093223-130093245 GGGAACACTAAGAAGATGGTTGG - Intronic
1091347860 11:134867242-134867264 GAGGGGACTGAGAGGAAGGCTGG + Intergenic
1091389357 12:116628-116650 GGCAAGACTGGAAAGATGGCAGG - Intronic
1092067355 12:5602579-5602601 GAGAAGACAGAGACAATGGTGGG + Intronic
1092299001 12:7227304-7227326 GATAAGAATGAGAAAATGGTGGG + Intergenic
1092909984 12:13138193-13138215 AAGAGGACTGAGAAGAAGACAGG - Intronic
1093428693 12:19058559-19058581 TAGAAGGCTGGGAAGATGGAAGG + Intergenic
1094540981 12:31363044-31363066 GAGAAGACTGAGGAGATGGAGGG + Intergenic
1096404660 12:51334765-51334787 GAGGAGAGAGAGAAGCTGGCAGG - Intronic
1096511635 12:52133122-52133144 GAGAGGACAGAGAAGAAGTCAGG - Intergenic
1096571998 12:52528849-52528871 GAGCAGATTGAGAAACTGGCTGG - Intergenic
1097068763 12:56339557-56339579 GAGGGGACTGAGAACATGGCTGG + Intronic
1097104290 12:56611979-56612001 GAGACCACTGAGAAGACTGCTGG + Exonic
1097406039 12:59191487-59191509 GAAAAGGCTGTGAAGCTGGCTGG + Intergenic
1097558255 12:61167157-61167179 TAGAAGACTCAGAAGAAGACAGG - Intergenic
1098067267 12:66631983-66632005 GAGAATACTGAGAGGATCTCAGG + Intronic
1100022883 12:90091076-90091098 CAGTAGACTGAGAAGATTGTGGG + Intergenic
1100207186 12:92363590-92363612 GAGAAGAATGAGGAGGAGGCAGG - Intergenic
1101233944 12:102769289-102769311 TTGAAGACTGAGTAGAAGGCAGG + Intergenic
1101621650 12:106394727-106394749 CAGATTAGTGAGAAGATGGCAGG + Intronic
1101739856 12:107492434-107492456 GGGAAGGCAGAGAAGATAGCAGG + Intronic
1101739863 12:107492498-107492520 GAGAAGCCTGTGAGTATGGCAGG - Intronic
1102671619 12:114624208-114624230 AAGAATACTGTGAATATGGCTGG + Intergenic
1102798789 12:115713439-115713461 GAAAGGACTGAGAAGGTGGGAGG + Intergenic
1103039985 12:117686943-117686965 GAGAGGACTCAGAAGATGCTGGG + Intronic
1103076413 12:117986331-117986353 GGGTACAGTGAGAAGATGGCTGG + Intergenic
1103331573 12:120157988-120158010 GGGAAGACTAAGGAGAAGGCTGG + Exonic
1103552315 12:121746656-121746678 TAGAAAAATGAGAAGAAGGCCGG + Intronic
1104125169 12:125839284-125839306 GAGAAGACTGGGTGGATGGATGG + Intergenic
1106181690 13:27374730-27374752 CAGAAAACTGAGAAGTAGGCAGG - Intergenic
1107078834 13:36352648-36352670 GTGAAAACTGAGAAGAGGCCAGG + Intronic
1107127109 13:36857626-36857648 GAAATGACTGGGAAGAGGGCAGG + Intronic
1107815034 13:44237086-44237108 GAGGAGAATCAGAAGATGACAGG - Intergenic
1108213233 13:48159041-48159063 GTGAGGACTGAGAAGGAGGCAGG + Intergenic
1109305907 13:60641161-60641183 GAGAAGACTGAGATCTTGGGAGG + Intergenic
1111386932 13:87539547-87539569 GAGAAGGCTCAGAAGATAGCTGG + Intergenic
1111601017 13:90474218-90474240 GAGGAGACTAAGAAGATTTCAGG + Intergenic
1112393937 13:99011298-99011320 AAGCAGACTGATAAAATGGCAGG + Intronic
1113059250 13:106303501-106303523 CAGAAGACTGAGCAGGTGGAGGG + Intergenic
1114820474 14:26012092-26012114 GAGAAAAATAAGAAGATGGATGG + Intergenic
1115525349 14:34274696-34274718 GGGAACACTGAAAAGATGGCTGG - Intronic
1116243873 14:42383016-42383038 GAGAGGAATGAGAAGCAGGCTGG - Intergenic
1117245443 14:53880181-53880203 GAGTAGACTCAGAAGTTGGGGGG + Intergenic
1117950062 14:61073865-61073887 GAGGAGGCTGAGAAGAAGGCAGG - Intronic
1118384335 14:65243275-65243297 GAGAGGACTGAGAAGTAGGCAGG + Intergenic
1118622820 14:67629623-67629645 GAGAAGACTGAGAAGTTGATTGG - Intronic
1119151297 14:72361979-72362001 GGGAAGAATGAGAAGATGAAAGG + Intronic
1120095495 14:80383281-80383303 GAGAAGTTTGAGATGATGGAAGG + Intronic
1121451419 14:94010700-94010722 GAGCAGTCTGAGAAGGTGGCTGG + Intergenic
1122447289 14:101779363-101779385 AAGAACACTGAGGAGATGGTGGG + Intronic
1122504760 14:102225379-102225401 GAGATGACCAGGAAGATGGCTGG - Intronic
1122736513 14:103847010-103847032 GAGAGGACCGAGGAGATGACCGG + Intronic
1123200467 14:106658342-106658364 GAGATGCCTGAGGAGAGGGCAGG + Intergenic
1124861959 15:33450440-33450462 GAGAAGCTTGAGATGAGGGCGGG - Intronic
1125816254 15:42587476-42587498 GAGAAGACTCAGTGGAGGGCAGG - Intronic
1127266231 15:57364604-57364626 GAGAAGACTGTGGAGGTGGTGGG - Intergenic
1127543919 15:59971761-59971783 GAGATAACAGAGAAGATGGAGGG + Intergenic
1128414002 15:67427235-67427257 GAGTAGGCAAAGAAGATGGCAGG - Intronic
1128551006 15:68597904-68597926 GTGAGGACTGAGAGGAGGGCAGG + Intronic
1129117862 15:73375240-73375262 GAGAGGACTGAGGGCATGGCAGG - Intergenic
1129126619 15:73447406-73447428 AAGAAGACTGATAAGAGGCCTGG + Intronic
1129515184 15:76152969-76152991 TAGAGGACTGGGCAGATGGCAGG - Intronic
1129568099 15:76646275-76646297 GAGAGGAATGAGAGGATGGGGGG - Intronic
1130354930 15:83120449-83120471 TGGAGGCCTGAGAAGATGGCCGG - Intronic
1130702385 15:86197713-86197735 GAGAACACTAAGAGTATGGCTGG + Intronic
1131051822 15:89353455-89353477 GAGAAGACCGAGAAGGTGATTGG - Intergenic
1131227248 15:90635229-90635251 AAGGACACTGAGAAGCTGGCTGG + Intronic
1131407458 15:92176893-92176915 GAGCAGACTGAGAAGAGGTGTGG - Intergenic
1131699621 15:94920095-94920117 GGGAAGACAGAGAATATGTCTGG + Intergenic
1132054745 15:98641841-98641863 AACAAGATTGAGAAGATGGTAGG - Intergenic
1132697856 16:1209924-1209946 GAGAAGGCTGAGAAGGTGCTGGG + Intronic
1133409787 16:5558667-5558689 CACAAGACTGAGACGATGGCAGG - Intergenic
1133821379 16:9239740-9239762 GAAAAGACTGATAATATGTCGGG - Intergenic
1134099327 16:11440627-11440649 GAGATGTCTGAGGAGGTGGCAGG - Intronic
1134328653 16:13230117-13230139 GAGGAGACAGAAAAGAAGGCAGG + Intronic
1134820114 16:17239911-17239933 GGGATGAATGAGAAGATGGGTGG - Intronic
1135220432 16:20610502-20610524 AAGCTGGCTGAGAAGATGGCAGG + Intronic
1136450055 16:30349142-30349164 GTGAAGCCTGAGAAGCTGTCAGG + Intergenic
1136552066 16:30987023-30987045 GGGGAGGCTGAGAATATGGCAGG + Intronic
1137975759 16:53030522-53030544 CAGAAGACAAAGAAGATGACTGG + Intergenic
1138361090 16:56427787-56427809 GAGAGGACTGGGAAGGAGGCAGG + Intergenic
1139328229 16:66168015-66168037 GAGAAGGCTGAGAGGAGGGGAGG + Intergenic
1139988266 16:70918359-70918381 GAGACGATTGAGAATAAGGCGGG + Exonic
1140197723 16:72869097-72869119 GAGAAGACGGAAAGGAAGGCAGG + Intronic
1140904452 16:79398487-79398509 AAGAGGAATGAGAAGATGGAGGG + Intergenic
1140928491 16:79605649-79605671 GTGAAGAAAGAGAAGAAGGCTGG - Intergenic
1141199123 16:81883597-81883619 GAGAAGACTGAGAAGATGGCAGG + Intronic
1141475878 16:84273032-84273054 GAGTAAAATGAGAAGATGGGTGG - Intergenic
1141717750 16:85736449-85736471 GAGGTGAATGTGAAGATGGCAGG + Intronic
1142393640 16:89818484-89818506 GAGAAAACCATGAAGATGGCCGG + Intronic
1142781625 17:2185750-2185772 GAGAAGACGGGGACGAGGGCAGG + Intronic
1143315086 17:6026454-6026476 GAGAAGTCCAAGAAGATGCCGGG - Intronic
1143433017 17:6900687-6900709 GACAGGACTGAGAGGAAGGCTGG - Intronic
1143590079 17:7879895-7879917 GAGCAGACAGAGAAGAGGGATGG + Intronic
1144944034 17:18960722-18960744 GAGATGAATGAGAAGATGTCAGG - Intronic
1146690888 17:34875363-34875385 GAGAGGGCTGGCAAGATGGCAGG - Intergenic
1146768759 17:35548805-35548827 GAGGAAACTGAGCAGATGGAGGG + Exonic
1146837396 17:36123180-36123202 GAGAAGACTGAGCAGACGTTGGG - Intergenic
1146949882 17:36898606-36898628 GAGAAGACTCAGGCCATGGCAGG + Intergenic
1147852514 17:43452765-43452787 GAAAAGACTGAGAGGTTGGATGG + Intergenic
1147917194 17:43895877-43895899 GAGAAAACTGAGCAGATTGGAGG - Intronic
1148020195 17:44548271-44548293 GAGCAGAGTGAGAAGATGGGAGG + Intergenic
1148106400 17:45121124-45121146 ACGAAGACTGAGAGGAGGGCCGG + Exonic
1148691396 17:49528965-49528987 GAGAAGTGTGAGAGGGTGGCAGG - Intergenic
1148796191 17:50198087-50198109 GGGAAGACTGGGATGAGGGCAGG - Intronic
1148837497 17:50473360-50473382 GAGTGGACAGAGAAGATGTCTGG + Intronic
1149259309 17:54861606-54861628 GATAAGACTGAGAAGATGGGCGG - Intergenic
1149649745 17:58269327-58269349 GAGAAGGGAGAGCAGATGGCTGG - Intergenic
1150530969 17:65981110-65981132 AAGAAACCTAAGAAGATGGCCGG - Intronic
1151772790 17:76176372-76176394 GAGATAACAGAGAAGATGGAGGG + Intronic
1152380857 17:79941689-79941711 GGGAACACTGAGAAGGAGGCTGG - Intronic
1152610447 17:81312725-81312747 GAGAAGACCTAGCGGATGGCAGG + Exonic
1153604268 18:6816125-6816147 GAGAAAACTGATGAGATGGCAGG + Intronic
1153666344 18:7370349-7370371 GAGAGGCCTGGGAAGATGGGGGG + Intergenic
1153818621 18:8812985-8813007 GAGAAGACTGAGAACAAGTTGGG + Exonic
1154981429 18:21505534-21505556 GTGTATACTGAGAAGCTGGCAGG + Exonic
1155646200 18:28080948-28080970 GAGAAGACTTTCAAGATGGAAGG - Intronic
1155855439 18:30828767-30828789 GACAAGGCTGAGAAGCTGGGAGG + Intergenic
1157365370 18:47059332-47059354 TGGAAGACTGAGAAGATGCCAGG - Intronic
1157944424 18:51962885-51962907 GAGTAGACTGAGAAGATAAGAGG + Intergenic
1158912102 18:62074803-62074825 GAGAACAATGAGAAAAAGGCTGG + Exonic
1158945124 18:62441465-62441487 GAGCAGGCTGAGAAGGTGGCCGG + Intergenic
1159157790 18:64606771-64606793 GAGAAAAATGAGAAAATGGCTGG + Intergenic
1159677294 18:71301380-71301402 GAGAAGTCTGAAAAGTTGGGAGG - Intergenic
1159679103 18:71325359-71325381 AAGAACAGTGAAAAGATGGCAGG + Intergenic
1160317414 18:77860259-77860281 GAGAAGACTCTGAAGAAGCCTGG + Intergenic
1160657241 19:279877-279899 GAGGAGACTGAGGTGTTGGCTGG + Intergenic
1161338797 19:3729459-3729481 GCGAGGAGTGAGAAGATGCCAGG + Intronic
1163224427 19:15946845-15946867 GAAAAGATTGAGAAGATAGAGGG - Intergenic
1163386714 19:17004505-17004527 GAGACCACAGAGAAGCTGGCGGG + Intronic
1163582719 19:18147858-18147880 GGGAAAACTGAGAAGAGGCCAGG + Intronic
1164441349 19:28282738-28282760 GAGAAGACTGGGGAGAGGGATGG - Intergenic
1164522141 19:28987772-28987794 AAGAAGACTGTTAAGATGGCTGG - Intergenic
1165124950 19:33587538-33587560 CACATGACTGAGAACATGGCTGG + Intergenic
1165682442 19:37789471-37789493 AAGAAGAAGAAGAAGATGGCCGG + Intronic
1166287969 19:41844148-41844170 GCCAAGGCAGAGAAGATGGCGGG + Exonic
1166881127 19:45930740-45930762 AAGAAGACAGAGAAGTTGCCTGG - Intergenic
1166978629 19:46619989-46620011 GAGAAGCCTGTGTGGATGGCAGG + Intergenic
1167270582 19:48503530-48503552 GAGAAGACTGAGAAGAGTCTGGG - Intronic
1168095087 19:54109920-54109942 GAGAAGCCGGAGATGAGGGCCGG - Intronic
925912308 2:8581840-8581862 GAGAACTCTGGGGAGATGGCAGG + Intergenic
926393172 2:12414821-12414843 GAGACCTCTGAGAAGACGGCTGG + Intergenic
927553452 2:24017457-24017479 GGGATGACTGTGGAGATGGCGGG + Exonic
927910443 2:26894275-26894297 GAGAAGAGTGTGAAGATGTGGGG - Intronic
928172837 2:29014453-29014475 GAGCAGACTGAGAAAAAGGCAGG - Exonic
928220358 2:29398190-29398212 GAGAGAAATGAGAAGATGGGAGG - Intronic
929511688 2:42569397-42569419 CAGAAGACTGGGAAGGAGGCAGG - Intronic
929995932 2:46826219-46826241 GAAAGGGCGGAGAAGATGGCAGG - Intronic
930186991 2:48420428-48420450 GGGAAGACCCCGAAGATGGCGGG - Intergenic
930284079 2:49406091-49406113 GAGAAGGATGAGAAGTTAGCAGG - Intergenic
930957605 2:57221921-57221943 GAGAAGACTGAGGAGAAGACTGG - Intergenic
931578643 2:63748846-63748868 TTGAAGACTGAGATGATGGTGGG + Intronic
931734397 2:65180868-65180890 GAGAGGACTCAGAAGAGGACAGG + Intergenic
932323459 2:70838602-70838624 GAAAAGACAGAGAAGCAGGCAGG + Intergenic
932702555 2:74001725-74001747 CAGAAGACTGAAAGGAGGGCAGG - Intronic
933177386 2:79190911-79190933 GGGTAGAGTGAGAAGATGGCAGG - Intronic
933872915 2:86587451-86587473 GAAAAGACATGGAAGATGGCTGG + Intronic
935219155 2:100997383-100997405 GTCAAGACTGAGATGTTGGCTGG - Intergenic
936185950 2:110303003-110303025 GAGATGCCTAAGAAGCTGGCTGG - Intergenic
936558225 2:113514365-113514387 GAGAAGCCCAAGAAGATGCCAGG + Intergenic
936861629 2:117027019-117027041 GAGAAGAATAAAAATATGGCGGG - Intergenic
937553657 2:123127567-123127589 ATGCAGTCTGAGAAGATGGCCGG - Intergenic
937621622 2:123994660-123994682 GAGAGAGATGAGAAGATGGCTGG - Intergenic
938181411 2:129188473-129188495 AAGAAGACTCAGAGGATGGCAGG - Intergenic
938468871 2:131542418-131542440 GGGAAGACTGAAAAGACGGTGGG - Intergenic
939098059 2:137858768-137858790 AAGAAGACTCAGAAGATTGAGGG - Intergenic
941491208 2:166144305-166144327 GTGAAAACAGAGAAGTTGGCTGG + Intergenic
941674089 2:168325223-168325245 GATGAGACTGAGAAGATGAATGG + Intergenic
942648151 2:178136966-178136988 AAGAAGACCAAGAAGAGGGCAGG + Intronic
944378901 2:199083291-199083313 AAAAAGACAGAGAAAATGGCAGG + Intergenic
945197553 2:207251444-207251466 GAGAAGGGTGGGAAGATGGAGGG - Intergenic
946056091 2:216903187-216903209 CAGAGGACTCAGAAGAAGGCAGG - Intergenic
946232738 2:218302597-218302619 GAGGAGACTGGGGAGGTGGCAGG + Intronic
946480672 2:220053204-220053226 GAGAAGACTGAGAGGAGTGGGGG - Intergenic
947379603 2:229532541-229532563 GAGAAGACAGTGATGATGGTGGG - Intronic
947938625 2:234028629-234028651 GAGAAGAGTTAGAGGAGGGCAGG - Intergenic
947984371 2:234436478-234436500 GAGAAGCCTGAGAAGCTTCCAGG + Intergenic
948918722 2:241051653-241051675 CAGAGGACTGAGGAGATGCCAGG + Intronic
1168954432 20:1824922-1824944 GGGAAGAGTGAGCAGCTGGCTGG + Intergenic
1169147500 20:3262543-3262565 TAGAAGACTGTGAATCTGGCCGG - Intronic
1170207785 20:13817971-13817993 GAGAAGGCTGAGAAGCAAGCAGG + Exonic
1170329517 20:15193123-15193145 GAGAAGAGAAAGAAGATGGGAGG - Intronic
1170672980 20:18452222-18452244 GAGATGAGTGAGAAGGTGGCTGG - Intronic
1171271795 20:23823882-23823904 GAGAAGACAGAGAAGGCTGCAGG - Exonic
1172080122 20:32333767-32333789 GAGAAGACAGACAAGTTGACAGG + Exonic
1172195216 20:33086902-33086924 GAGAAGCCAAAGAAGAGGGCAGG - Intronic
1172280099 20:33701891-33701913 GAGAAGATTGAGAAGTCGGATGG + Intergenic
1173351401 20:42248753-42248775 GACAACACCGTGAAGATGGCTGG - Exonic
1173638234 20:44579880-44579902 CAGAAGACTGAGTAGGTGTCAGG - Intronic
1173979707 20:47214293-47214315 GGGAAGACTGAGAAGACTGACGG + Intronic
1174183122 20:48687331-48687353 GAGAAGGAGAAGAAGATGGCGGG - Intronic
1174421097 20:50399647-50399669 GACAAGAGTGACAAGAAGGCAGG + Intergenic
1174779564 20:53376426-53376448 AAGAAGTCAGACAAGATGGCAGG - Intronic
1174836745 20:53863007-53863029 GAGAAAACTGAGAAGCTGAGAGG - Intergenic
1175166113 20:57045927-57045949 GAGATAGCTGAGAAGAAGGCTGG - Intergenic
1175594254 20:60217976-60217998 AAGAAGTCTGGGAAGGTGGCTGG - Intergenic
1175615299 20:60393310-60393332 GTGTAGACTCAGAAGATAGCGGG - Intergenic
1176007288 20:62873060-62873082 GAGAAGAGAGAGGAGATGGCGGG + Intergenic
1176690071 21:9895683-9895705 GAAAAGAGTGAGAAGTTGGTGGG - Intergenic
1178407867 21:32339288-32339310 TAAAATACTGAGAAAATGGCCGG - Intronic
1178909971 21:36666541-36666563 GAGAAGGCTGAGAAGAGTGGAGG + Intergenic
1178950047 21:36978673-36978695 GAGAAGAGTGCGAAGCTGGCAGG + Intronic
1179221642 21:39413079-39413101 GACCAGACTGAGAAGAGGCCAGG + Intronic
1179546722 21:42117435-42117457 GAGAATGCTGAGGGGATGGCAGG - Intronic
1182004899 22:26951761-26951783 GAGCAGATTGAAAACATGGCTGG + Intergenic
1182873982 22:33674238-33674260 GGGAAGAATGGGAAGTTGGCTGG - Intronic
1183442094 22:37829057-37829079 AGGAAGGCTTAGAAGATGGCAGG - Intergenic
1184151316 22:42640747-42640769 GAGAAGGCTGAGGAGGAGGCAGG - Intronic
1184794516 22:46724047-46724069 GAGAAGACGGAGGAGGTGGAAGG - Intronic
949401002 3:3665449-3665471 GGAGAGACTGAGAAAATGGCTGG + Intergenic
950685345 3:14613655-14613677 GAGAAGACTGAGAAGTTAAGGGG + Intergenic
950838424 3:15942879-15942901 TAGAAGAGAGAGAAGAAGGCAGG - Intergenic
950897306 3:16464959-16464981 TAGAAGAGTGGGGAGATGGCTGG - Intronic
950929775 3:16776892-16776914 GAGAATTCTGACATGATGGCAGG - Intergenic
952015382 3:28950646-28950668 GAAAAGCCAGAGAAGATGGAGGG - Intergenic
952211869 3:31236110-31236132 CAGAAGGCAGAGAAGTTGGCAGG + Intergenic
952486500 3:33816853-33816875 GAGAATAAGGAGCAGATGGCAGG + Intronic
953435880 3:42876768-42876790 GAGAAGGCTGAGATGGTGGAGGG + Intronic
955214183 3:56971427-56971449 GACCAGACTGAGAAGTTGGTTGG - Intronic
955909709 3:63847439-63847461 CAGAAGAATGAAAAGAAGGCCGG + Intronic
959545014 3:107585338-107585360 GAGAAGAGAGAGAGGATGGTGGG + Intronic
960585075 3:119313665-119313687 GGGAAGACTTAGAAGCTGTCTGG + Intronic
960812264 3:121636352-121636374 GAGAAGAGCGTGAAGAAGGCTGG - Intronic
961087914 3:124084963-124084985 CAGAAGACTGTGAAGATGTGGGG - Intronic
962436689 3:135373526-135373548 GGGAAGACTGAGAGGATAGAAGG - Intergenic
963488649 3:145969960-145969982 GATAAGAGTAAGAAGATAGCAGG - Intergenic
964517953 3:157533209-157533231 ATAAAGACTGAGAAAATGGCTGG + Intronic
967183365 3:186925790-186925812 CACAAGACTGGGAGGATGGCTGG - Intergenic
967296267 3:187968101-187968123 GAGAAAACTGAGATGCTAGCAGG + Intergenic
968137925 3:196232446-196232468 GCCAAGACTGAGAAGATGGAGGG - Exonic
968652432 4:1765586-1765608 GACAAGCCTGAGCAGAGGGCAGG - Intergenic
968873168 4:3251743-3251765 AAGAAGCCTGAGAGGGTGGCTGG + Intronic
968981364 4:3851543-3851565 GAGAGGAAGGAGAAGATGTCTGG + Intergenic
969088637 4:4675471-4675493 GAAAAGACAGAAAAGATGGGTGG - Intergenic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
970536691 4:17037356-17037378 AAGAAGACAGAGAAGGTGGTAGG + Intergenic
970861162 4:20704101-20704123 GAGAAGATGGAGAAGATGACAGG + Intronic
971849673 4:31968086-31968108 GAGAAGAGAGAGAAGAGGGCTGG - Intergenic
972250024 4:37290046-37290068 GAAAGGGCTTAGAAGATGGCTGG - Intronic
972475315 4:39444436-39444458 GAGAAGAATGAGATGAAGGTGGG - Intronic
973208702 4:47590387-47590409 GAGAAGTCTGAGAGCATAGCTGG + Intronic
973961974 4:56119629-56119651 GAAAAAACTGAGAATAGGGCTGG - Intergenic
974021803 4:56698219-56698241 AAGAAGAAAGAGGAGATGGCTGG + Intergenic
974088217 4:57283424-57283446 GAGAAGACTATGGAGATGGGTGG + Intergenic
974284025 4:59840346-59840368 GAGAACAATGAGAAGATCTCAGG - Intergenic
974807033 4:66894162-66894184 GAGGATTCTGGGAAGATGGCAGG + Intergenic
974922271 4:68256460-68256482 GATAAGACTGAGAAGTTGTCAGG - Intergenic
976689717 4:87855834-87855856 CAGAAGGCTGAGAAGAGAGCTGG + Intergenic
977266915 4:94866400-94866422 GAGAAGACAGATAATATGACTGG - Intronic
977656077 4:99522251-99522273 CTGAAGACTGACAAAATGGCCGG + Intronic
978866743 4:113522227-113522249 GAGAACTCTGAGAAGATAGTAGG + Intronic
980353484 4:131713614-131713636 GAAAAGAGTGAGAAGTTGGTGGG - Intergenic
981602536 4:146506790-146506812 AATAAGATTGAAAAGATGGCAGG - Intronic
982429018 4:155299922-155299944 CATAAGGCTGAGAAGATGGCTGG - Intergenic
983255977 4:165401144-165401166 GAAAAGACTGAGAAGGTGTCAGG - Intronic
985886118 5:2680657-2680679 GACAAGAGTGAGAACTTGGCCGG - Intergenic
986943455 5:12985505-12985527 GAGTAGACTGAGAAGGAGGAGGG - Intergenic
987172935 5:15277509-15277531 TATAAGAATGAGCAGATGGCGGG + Intergenic
987492171 5:18595030-18595052 TTGAAGACTGAGAAGAAGGCAGG - Intergenic
988020690 5:25615973-25615995 GAGAGGTTTGGGAAGATGGCAGG - Intergenic
988252628 5:28780094-28780116 GAAAAGACAGAGAAGAAGGAAGG - Intergenic
988718609 5:33853566-33853588 GAAAAGACTGAGAAGATACATGG - Intronic
989089500 5:37715314-37715336 GAGAAGATTGAGAAGATTTCTGG + Intronic
989224980 5:39016391-39016413 GAAAAGAGTGAGAAGATGAAGGG + Intronic
989510864 5:42286515-42286537 GAGAAGACAGAGAAGGAAGCAGG + Intergenic
990352691 5:54934695-54934717 GGGAAGAATGAGAAGAAAGCAGG + Intergenic
993425541 5:87759748-87759770 GAGTAGAAGGAGAAGATGGGTGG + Intergenic
993786287 5:92141840-92141862 CAGAAGAGTGGGAAGATGCCAGG + Intergenic
995428561 5:112049967-112049989 GAGAACACTGACAGGGTGGCTGG - Intergenic
995524193 5:113037706-113037728 GAGAAGACTCAGAGAATAGCGGG + Intronic
995980243 5:118093160-118093182 GAGAAGAAAGAGAAGAAGGAAGG + Intergenic
998400887 5:141848631-141848653 GAGAAGTTGGAGAAGAAGGCAGG - Intergenic
998979774 5:147689401-147689423 GAGAAGACTGAGCATAAGGGTGG + Intronic
999524491 5:152389176-152389198 GAGAAGAATGAGAAGAGGGAGGG - Intergenic
1000420607 5:161034400-161034422 GAGAAGCCTGAGGATAAGGCTGG + Intergenic
1001273065 5:170330309-170330331 GAGAGGACAGAGATGAAGGCAGG + Intergenic
1001434428 5:171688275-171688297 GAGAAGAGTAGGAAGATGGGAGG + Intergenic
1002320721 5:178373986-178374008 GAGAAAACTGAGAAGTTGAAGGG - Intronic
1002853633 6:1019047-1019069 GATAAGACAGGCAAGATGGCAGG + Intergenic
1003034726 6:2632833-2632855 GAAAAGACAGAAAAGCTGGCAGG - Intronic
1003163746 6:3658240-3658262 GAGGAGGCTGAGAAGGTGGGTGG + Intergenic
1003256055 6:4475836-4475858 CAGCAAACTGAGAAGATGGTGGG + Intergenic
1004441178 6:15656226-15656248 GAGAAGACCAAGAATAGGGCTGG - Intronic
1004651900 6:17618035-17618057 GCTAAGATTGGGAAGATGGCTGG - Intronic
1005509583 6:26500513-26500535 GAGAAGAGAGAAAAGATGGGAGG - Intergenic
1005869636 6:29965274-29965296 GAGAATGCTGAGAGGTTGGCAGG + Intergenic
1005884544 6:30086621-30086643 GAGAAAACTGAGAAGATGGGGGG - Intergenic
1005991908 6:30908465-30908487 GCGAAGAGTGAGAGGAAGGCAGG + Intronic
1006393318 6:33771610-33771632 GAGCAGGCTGAGGAGCTGGCGGG + Exonic
1008043680 6:46829877-46829899 GCCAAGACTGAGAAAATGGATGG + Intronic
1008128062 6:47690807-47690829 GAGGAGAGTGACAAGGTGGCTGG + Intronic
1010060745 6:71620038-71620060 GAGAAGGCTGTGGAGATGGCAGG - Intergenic
1010282382 6:74036606-74036628 GGGATGACTGTGAAAATGGCAGG - Intergenic
1010322162 6:74524556-74524578 GAGAGAACTGAGGAGAAGGCAGG + Intergenic
1011218649 6:85031854-85031876 GAGAAGAGAGAGAAGAGGGCAGG + Intergenic
1011629496 6:89310488-89310510 GGGTAGAGAGAGAAGATGGCTGG - Intronic
1012151959 6:95764917-95764939 TAGAAGAGTGAATAGATGGCAGG + Intergenic
1013659542 6:112281012-112281034 GAGTAGCTTGAGAAGCTGGCCGG + Intergenic
1016893683 6:149032331-149032353 GGGAAGACTGGGAAGACAGCAGG - Intronic
1016916497 6:149248823-149248845 GACAAGACAGAGAAAATGGCAGG - Intronic
1017717675 6:157223711-157223733 GGGAACACAGAGAAGGTGGCTGG + Intergenic
1017986819 6:159450965-159450987 GAGCAAACTGAGGAGGTGGCAGG - Intergenic
1018089338 6:160332028-160332050 GTGAAGACTGGGAATATGGGGGG + Intergenic
1018181403 6:161226595-161226617 GAGAAGTGAGAGAAGATGGAGGG - Intronic
1018435767 6:163757564-163757586 GAGCAGCCTGAAAAGAAGGCAGG - Intergenic
1018528824 6:164742110-164742132 GGGAAGAGTGAGAAGATGGGAGG - Intergenic
1021912693 7:25401934-25401956 GAGAAGACAGAGAAAATTTCAGG + Intergenic
1022607618 7:31831746-31831768 GAGATGATGGAGAAGATGGAGGG + Intronic
1022845619 7:34206892-34206914 GAGAAAAAAGAGAAAATGGCAGG + Intergenic
1023685745 7:42733299-42733321 GAGAAAAGTGTGAAGATGGCTGG + Intergenic
1024096535 7:45987042-45987064 AAGAGGACTGAGAATGTGGCTGG + Intergenic
1024674303 7:51624197-51624219 GATAAGAGTGAGGAGCTGGCCGG + Intergenic
1025041168 7:55646959-55646981 GAGAAGCCTGAGGTGATGGGGGG - Intergenic
1025236676 7:57239398-57239420 CAGAGGCCTGAGCAGATGGCTGG - Intergenic
1026135251 7:67654662-67654684 CAGAAGACTGTGATGTTGGCTGG + Intergenic
1026809344 7:73449313-73449335 AAGAAGACAGAGAATGTGGCTGG + Intronic
1026891959 7:73987579-73987601 GATGAGACTGAGAGAATGGCTGG + Intergenic
1027337938 7:77174011-77174033 GATCAGACTGAGAATATGGTGGG - Intronic
1027952651 7:84837037-84837059 GAGAAGCCATATAAGATGGCAGG + Intergenic
1028067901 7:86411421-86411443 GAGAAAACTCTGAAGATTGCCGG - Intergenic
1028256210 7:88600968-88600990 TAGAAGACTGAGAAAATGGGTGG + Intergenic
1028491975 7:91422811-91422833 TAGAAGACTGAGACTATGGCAGG + Intergenic
1028909772 7:96195003-96195025 GAGTAGAGTGAGAAGATGTGAGG - Intronic
1029031141 7:97468429-97468451 GAGAAGAGTGAGCAAATAGCAGG + Intergenic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1029777798 7:102696800-102696822 GATCAGACTGAGAATATGGTGGG + Intergenic
1029945018 7:104523574-104523596 GAGAAGATAGAAAAGATGCCTGG - Intronic
1030744545 7:113149139-113149161 GGGAAGGCTGAGCTGATGGCTGG + Intergenic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032444919 7:131974076-131974098 TGGAAGACTGAGAAGAGGGGAGG - Intergenic
1033163649 7:139019219-139019241 GAGAAGACAGAGAGAATGGCAGG + Intergenic
1033613329 7:142986909-142986931 GAGATGACCCAGAAGCTGGCTGG + Intergenic
1034830437 7:154303743-154303765 AAGAAGTCTGGGTAGATGGCTGG - Intronic
1034913235 7:155015587-155015609 GAGAAGCCTGAGCAGAGGCCTGG + Intergenic
1035884538 8:3277746-3277768 GAGAAGCCTGGGAGGCTGGCTGG + Intronic
1037408103 8:18565259-18565281 GAGCAGACTGTGAACAGGGCCGG + Intronic
1037419265 8:18684724-18684746 TAGGAGACTGAGAAAATGACTGG + Intronic
1037837768 8:22224289-22224311 GAGAAAGCTGAGCAGATCGCAGG - Exonic
1038447312 8:27612934-27612956 GAGGAGGAGGAGAAGATGGCGGG + Intronic
1038697447 8:29818864-29818886 GAGGAGACAGAGAAACTGGCAGG - Intergenic
1039526805 8:38224252-38224274 AAGAAGACAGAGAAAAGGGCCGG - Intergenic
1040875393 8:52146353-52146375 GAGAAGAATGAAGAAATGGCAGG - Intronic
1041320096 8:56603834-56603856 GAGATGACTAAAAACATGGCCGG - Intergenic
1041347883 8:56920442-56920464 GAGAAGACGGAGAAGGAGGAAGG + Intergenic
1043028927 8:75106649-75106671 GGGAAGGCTGTGGAGATGGCTGG + Intergenic
1043090976 8:75903501-75903523 GTGAAGCCTGAGAATATGACTGG + Intergenic
1043710663 8:83413937-83413959 GAGAAGAATGAGAAAATGTTTGG - Intergenic
1044247497 8:89966337-89966359 GAGGAGTCTGGCAAGATGGCTGG + Intronic
1044532726 8:93326122-93326144 GAGAAGACCGAGAAGGTGGCAGG - Intergenic
1046021273 8:108668171-108668193 GAACATACTGAGGAGATGGCTGG - Intronic
1046659475 8:116933703-116933725 GAGAACACTTAGAAGAGAGCAGG - Intergenic
1047361915 8:124177136-124177158 GATAAGACAGAGAAGAATGCCGG + Intergenic
1047778523 8:128092869-128092891 TGGAAGACTGAATAGATGGCAGG - Intergenic
1047812922 8:128429784-128429806 GAGAGGACTGGAAAGATGGTTGG + Intergenic
1048141339 8:131797596-131797618 GAGAAGACAGGGAATAAGGCTGG + Intergenic
1049894636 9:101901-101923 GAGAAGCCCAAGAAGATGCCAGG - Intergenic
1050288390 9:4128356-4128378 TATAAAAGTGAGAAGATGGCAGG - Intronic
1050720622 9:8584893-8584915 GAGAAGAATGAGCAAAGGGCGGG + Intronic
1051755496 9:20395190-20395212 GAGAAGATTAAGCAGATGTCAGG - Intronic
1051776246 9:20637360-20637382 CAGAGGACAGAGAAAATGGCTGG + Intergenic
1052665087 9:31486029-31486051 GAGAGAACTGAGAAAATGGAAGG - Intergenic
1052850125 9:33373169-33373191 GAGAGGCCAGAGAAGGTGGCAGG + Intergenic
1053330434 9:37201346-37201368 GAAAAGAATGAGAAGGTGGAAGG - Intronic
1053626799 9:39880228-39880250 GAAAAGAGTGAGAAGTTGGTGGG - Intergenic
1053735842 9:41101891-41101913 GAGAAGCCCAAGAAGATGCCAGG - Intergenic
1053779189 9:41585792-41585814 GAAAAGAGTGAGAAGTTGGTGGG + Intergenic
1054167149 9:61796033-61796055 GAAAAGAGTGAGAAGTTGGTGGG + Intergenic
1054217088 9:62370475-62370497 GAAAAGAGTGAGAAGTTGGTGGG + Intergenic
1054670398 9:67784865-67784887 GAAAAGAGTGAGAAGTTGGTGGG - Intergenic
1054692532 9:68329507-68329529 GAGAAGCCCAAGAAGATGCCAGG + Intronic
1054874552 9:70081644-70081666 GAGAAGACTGAGAATTTGTAAGG - Intronic
1054892117 9:70261993-70262015 GAGAAGAAAGAGAAGGTAGCTGG + Intronic
1055968202 9:81885747-81885769 GAAAAAACTGAGAGGATTGCAGG + Intergenic
1056181725 9:84090222-84090244 GAGAGAGATGAGAAGATGGCTGG + Intergenic
1056943799 9:90976873-90976895 CTGAAGACTGAGACGATGGTGGG + Intergenic
1059686968 9:116647015-116647037 GAGGAGAATGAGAACATTGCTGG - Intronic
1060189507 9:121583089-121583111 TAGAAAACGGAGAAGCTGGCCGG + Intronic
1060301403 9:122376475-122376497 GAGGAGACTGAGACCAGGGCAGG + Intronic
1060816427 9:126637869-126637891 GAGAAGACAGAGAGGAGGGGAGG - Intronic
1060960445 9:127677008-127677030 GACAAGACAGATAAAATGGCGGG - Intronic
1061059733 9:128244530-128244552 AGGAAGACTGAGAGGATGGGGGG - Intronic
1185638238 X:1570867-1570889 GAGAAGACTAGGAAACTGGCTGG - Intergenic
1186535558 X:10343668-10343690 GCAAAGACTGGGAAGATGGCTGG + Intergenic
1186646893 X:11516846-11516868 GAGATGACAGAGAAGGAGGCTGG - Intronic
1186677647 X:11835757-11835779 GATAATACTGGGAAGAGGGCAGG - Intergenic
1186689465 X:11959766-11959788 GAGAAACCTGAGAAGCTGACAGG - Intergenic
1188705672 X:33326594-33326616 GATTAGACTGAGCACATGGCAGG + Intronic
1188847908 X:35096444-35096466 ATGAGGACTGAGAAGATTGCTGG + Intergenic
1189121317 X:38398146-38398168 AAGAAGACTGAAAAAAAGGCAGG - Intronic
1190059131 X:47199633-47199655 GAGAAAACTGGGCAGAAGGCTGG - Intronic
1191026316 X:55917632-55917654 CAGAAGAGTGAGTAGATGACAGG - Intergenic
1192605530 X:72512886-72512908 AAGAGGACTGAGAAGTAGGCAGG - Intronic
1194210695 X:91065969-91065991 GAGATGAGTGAAATGATGGCAGG + Intergenic
1197798447 X:130322897-130322919 CAGCAAACGGAGAAGATGGCAGG - Intergenic
1198062079 X:133056273-133056295 GAGAAGAGTTAGAAAATGGGAGG - Intronic
1198322390 X:135531490-135531512 GATAAGCCAGAGAAGATGGAAGG - Intronic
1199519696 X:148721743-148721765 TAGAAGACTGCGGTGATGGCAGG + Intronic
1199751806 X:150826735-150826757 GAAAAGACAGAGAAGTTGTCAGG - Intronic
1200843008 Y:7802807-7802829 TAGAAGAGTGGGGAGATGGCTGG - Intergenic