ID: 1141202029

View in Genome Browser
Species Human (GRCh38)
Location 16:81905490-81905512
Sequence TGGGATTCCATTGACCAGGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 199
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 181}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141202029 Original CRISPR TGGGATTCCATTGACCAGGT GGG Exonic
900172943 1:1279084-1279106 TGGGGTTCCATGGAGCAGGTGGG + Intergenic
900172964 1:1279166-1279188 TGGGGTTCCGTGGAGCAGGTGGG + Intergenic
905731172 1:40300419-40300441 TGGGCCTCCATTGCCCAGGCAGG - Intergenic
905934158 1:41810525-41810547 TGGGCTTCCATTGCCAAGGCTGG - Intronic
906735387 1:48121203-48121225 TGGGATTCCATTTAAGAGGTAGG - Intergenic
906935514 1:50211034-50211056 CGGGATTCAAATGGCCAGGTGGG - Intergenic
907167584 1:52428297-52428319 TGGGGTTTCATTCACCATGTTGG - Intronic
907589479 1:55652536-55652558 TGGGATGCCAGTGAACAGATGGG - Intergenic
909800285 1:79797568-79797590 GGGGATTGGTTTGACCAGGTGGG + Intergenic
911928130 1:103863493-103863515 TGAGTTTCAATTCACCAGGTTGG + Intergenic
913226029 1:116699165-116699187 AGGGTTGCCATTGACCTGGTAGG - Intronic
913331522 1:117671906-117671928 TGGGAGGCCATGGACCAGATAGG - Intergenic
914221916 1:145689075-145689097 AGGGATTCCAGTGGCTAGGTTGG + Intronic
917077287 1:171218635-171218657 TGGAATTCGAATGACCAGGTGGG - Intergenic
918229378 1:182514317-182514339 TGGGATCCCACTGACGAGATGGG - Intronic
918802536 1:188990218-188990240 TGGGATGCCATTGGCCAAGAGGG - Intergenic
923379596 1:233402597-233402619 TGGGACTCCATTTACATGGTAGG - Intergenic
1064303455 10:14143802-14143824 TGGGGTTTCGTTGACCAGGCTGG + Intronic
1064650587 10:17505386-17505408 AGGGATACCATTGGCCAAGTGGG - Intergenic
1065311269 10:24417784-24417806 TGGGATTCCATTTCACAGGACGG - Intronic
1066539010 10:36423950-36423972 CGGGATTCCACTGCCCAAGTAGG - Intergenic
1067723218 10:48745814-48745836 TGGGATTCCATCGAACACCTCGG + Intronic
1068709100 10:60113106-60113128 TCGAATTCCATTGACCAGGGAGG + Intronic
1072130030 10:92485024-92485046 TCGCATTCCATTGCCCAGGCTGG - Intronic
1074442979 10:113494954-113494976 TGGCATTCCAATGAGCAGGCTGG - Intergenic
1074661776 10:115667421-115667443 TGCGATTACATTGAACAGGGAGG + Intronic
1077712800 11:4553168-4553190 TGGGATTCCAATGACGAGATGGG + Intergenic
1078602583 11:12746882-12746904 TGGGATGCCACAGACCAGGCGGG + Intronic
1081615990 11:44591518-44591540 TGGGTTTCCTTTGTCCAGTTAGG - Intronic
1081896877 11:46594328-46594350 TGGGAGTCCATAGAACAGTTGGG - Intergenic
1082722048 11:56690377-56690399 GGGGATTCCAGTAGCCAGGTTGG - Intergenic
1083981009 11:66169601-66169623 TGGGGTTTCATTCACCATGTTGG + Intronic
1088561739 11:111122211-111122233 TGGGATTCCTTTGGCCAAGAGGG - Intergenic
1089385036 11:118061843-118061865 TGGGAATCCCTTGAGCAGGGAGG - Intergenic
1089854116 11:121525996-121526018 TCTGATTCCATTGCCCAGGCTGG - Intronic
1090487566 11:127127733-127127755 TGGAATTCAATTGGCTAGGTGGG - Intergenic
1091926571 12:4356036-4356058 TGAGATGCCATTGGCCAGTTTGG + Intergenic
1092737720 12:11599030-11599052 TGGAAGACCATGGACCAGGTGGG - Intergenic
1093754179 12:22833965-22833987 TGGAATTTCATTGCCAAGGTAGG - Intergenic
1100467477 12:94859608-94859630 TTGGAGTTCATTCACCAGGTTGG + Intergenic
1102879705 12:116474818-116474840 TGGGATTTCATTCACCATGTTGG - Intergenic
1106497241 13:30291501-30291523 TGGGATTCCATTGACTCTATGGG - Intronic
1107276540 13:38686679-38686701 CGGGATTTCATTGACTAGGGCGG + Intergenic
1108199928 13:48032763-48032785 TGGCATTCCCTTGGCCAAGTTGG + Intergenic
1109991733 13:70067564-70067586 TGGAATTCCTTTGGCCAGGAAGG + Intronic
1112256416 13:97836440-97836462 TGGTATTACATTGACCAATTTGG + Intergenic
1112328642 13:98460511-98460533 TGCGCTTCCATAGTCCAGGTGGG - Intronic
1113742900 13:112723711-112723733 TGGGGTTCCCTTGACCAAGAAGG + Intronic
1113972871 13:114203666-114203688 TGGGATTCCATTTGTGAGGTGGG - Intergenic
1115298789 14:31860271-31860293 TCGCACTCCATTGACCAGGCTGG - Exonic
1115942489 14:38624910-38624932 TGGGATTGCATTGACTAATTGGG - Intergenic
1116682826 14:47996256-47996278 TGCGATTCCACTGATTAGGTAGG + Intergenic
1121960653 14:98256367-98256389 TGGGATTCCCTTGGCCAAGAGGG - Intergenic
1122404390 14:101491302-101491324 TGGGATGCCACTAAGCAGGTGGG + Intergenic
1122647302 14:103203674-103203696 TGGGGTCCCCTTGACCAGGATGG - Intergenic
1125660559 15:41391432-41391454 TGGGGTTTCATTCACCAAGTTGG - Intronic
1126326601 15:47484659-47484681 TGGGATTCCATTTACCTGCCTGG - Intronic
1127468602 15:59269667-59269689 TGGGGTTTCATTCACCATGTTGG - Intronic
1130977802 15:88790578-88790600 TGGGACTCCATGGACAAGCTGGG - Intergenic
1134801124 16:17085735-17085757 TGGGACTTGATTGACCAGGATGG - Intergenic
1135077073 16:19402967-19402989 TGGGATTTGAATGGCCAGGTGGG - Intergenic
1135077623 16:19407708-19407730 TGGGATTTGAATGGCCAGGTAGG - Intergenic
1135607713 16:23837389-23837411 AGGGATTCCAGTGCCAAGGTAGG + Exonic
1137046939 16:35674074-35674096 TGTGTTTCCATTCAACAGGTTGG + Intergenic
1137046997 16:35674932-35674954 TGTGTTTTGATTGACCAGGTTGG + Intergenic
1137049969 16:35700914-35700936 TGGGTTTTGATTCACCAGGTTGG + Intergenic
1137506751 16:49060671-49060693 GGGGATTCCAGTGCCCAGGCTGG - Intergenic
1141008372 16:80374236-80374258 TTGGATTCCCATGACCAGTTTGG - Intergenic
1141089860 16:81122743-81122765 TGGGAGGCCATTGGCCGGGTGGG - Intergenic
1141202029 16:81905490-81905512 TGGGATTCCATTGACCAGGTGGG + Exonic
1142938897 17:3364414-3364436 TGGCAATCCATTGACCAGCATGG - Intergenic
1144874630 17:18390979-18391001 TGGGCTTCCCTGGACCAGGGTGG - Intergenic
1145271450 17:21406989-21407011 TGGGATTGCAGGGACCATGTAGG + Intronic
1145285275 17:21501082-21501104 TGGGATTCCCTTGGCCAAGAGGG - Intergenic
1145309653 17:21694393-21694415 TGGGATTGCAGGGACCATGTAGG + Intronic
1146677045 17:34780844-34780866 AGGGATTCCAATGACAAGGTGGG - Intergenic
1146824481 17:36010857-36010879 TGGGATCCCAATGACAAGATGGG + Intergenic
1149094954 17:52828766-52828788 TGGGATTCGATTGGCCTGGCGGG - Intergenic
1150954415 17:69841193-69841215 TGGGTTTCCATTGTCTAGTTTGG + Intergenic
1151870017 17:76830328-76830350 TCTGATTCCATTGCCCAGGCTGG + Intergenic
1151917429 17:77128647-77128669 TGGGGTTTCATTGGCCAGGCTGG + Intronic
1160039238 18:75330827-75330849 TGGGATTCCACTTTCCAGTTAGG + Intergenic
1161708439 19:5833457-5833479 TAGAATTCCATTGCCCAGGCTGG - Intronic
1161900374 19:7114246-7114268 GGGGATTCCATGGAACAGGTGGG + Intronic
1164377606 19:27702539-27702561 TGCGTTTTGATTGACCAGGTTGG - Intergenic
1165500781 19:36187551-36187573 TGGGGTTTCACTGACCAGGATGG + Intronic
1166169819 19:41019747-41019769 TGGGATTCCACAGACAAGCTTGG + Intergenic
1167784204 19:51624127-51624149 TCTGACTCCATTGCCCAGGTTGG - Intronic
926242620 2:11100188-11100210 TTGCATCCCATTGAACAGGTAGG - Intergenic
926799676 2:16649035-16649057 TGGAATTCAACCGACCAGGTTGG + Intronic
927669078 2:25053714-25053736 TGGGGTTTCATTCACCATGTTGG - Intronic
929694143 2:44099836-44099858 TGGGATTGCATTGAGGAGGAAGG - Intergenic
930085523 2:47494570-47494592 TGGGCTTCCAGGGCCCAGGTGGG - Intronic
930396621 2:50829625-50829647 GGGGATTCCAGTAGCCAGGTTGG + Intronic
932684471 2:73856616-73856638 TGGGCATCCATGGACAAGGTAGG - Intronic
934920114 2:98336269-98336291 TGTGATTCCATGGAGCAGGAAGG - Intronic
939639679 2:144624590-144624612 TGTGAGTCAATTCACCAGGTGGG - Intergenic
939943352 2:148378843-148378865 TGGCTTTCCATTGACCAGTTTGG + Intronic
940704128 2:157082739-157082761 TGGGATCCCCTTGACCAAGATGG - Intergenic
942916902 2:181320919-181320941 TTGGTTTCTATTGCCCAGGTTGG + Intergenic
944336978 2:198545601-198545623 AGGGCTCCCATAGACCAGGTGGG + Intronic
946483389 2:220077869-220077891 TGGGATTCCTTTGATTAAGTGGG + Intergenic
948261692 2:236608805-236608827 TGTGAGACCATTGAACAGGTAGG + Intergenic
948309579 2:236974983-236975005 GGGGATTGGTTTGACCAGGTAGG - Intergenic
1169381257 20:5109392-5109414 GGGGATTCCAGTAGCCAGGTTGG + Exonic
1170395104 20:15917230-15917252 TGGGAGTCCTTTTATCAGGTTGG + Intronic
1172521952 20:35573221-35573243 TGGGGTTTCATTCACCATGTTGG - Intergenic
1173921959 20:46752972-46752994 TGGTATTTCATTGACAAGGCTGG - Intergenic
1176166923 20:63679254-63679276 TGGGATTCCCCCGACCAGGTCGG - Intronic
1178208489 21:30499352-30499374 TGTGATGCCATTGACCACTTAGG + Intergenic
1178400005 21:32277670-32277692 TGGGGTTTCATTCACCATGTTGG + Intronic
1181335247 22:22124236-22124258 TGGGGTTGCATTGCCTAGGTGGG + Intergenic
1182559397 22:31147945-31147967 TGGGGCTTCATTGTCCAGGTAGG - Intergenic
952192906 3:31042807-31042829 TGGGATTCAAATGACCAGGCGGG + Intergenic
952582571 3:34852001-34852023 TGTGCTTCCTTTGCCCAGGTAGG - Intergenic
954207558 3:49071569-49071591 TGGGGTTTCATTCACCATGTTGG - Intronic
957492695 3:80949715-80949737 TGTGTTTCAATTCACCAGGTTGG - Intergenic
957493122 3:80955334-80955356 TGTGATTTAATTCACCAGGTTGG - Intergenic
958963011 3:100528333-100528355 TGGGCTGCCACTGCCCAGGTTGG - Intronic
959820559 3:110730141-110730163 TGGAATTCAATTGGCCAGGAGGG + Intergenic
960674471 3:120181182-120181204 TGTGAGTCCAAAGACCAGGTTGG + Exonic
961796489 3:129412600-129412622 TGGTATGCCATGGACCAGGTGGG - Intronic
963729751 3:148959792-148959814 AGGGTTTCCACTGAGCAGGTGGG + Intergenic
963740267 3:149072404-149072426 TGGAATGTCATTGACCTGGTAGG - Intronic
968946408 4:3666877-3666899 GGGAATTCCATTGCCCAGGTTGG + Intergenic
969343609 4:6557822-6557844 TGGGTCTCCAGTGCCCAGGTGGG - Intronic
970080782 4:12282631-12282653 TGTGATTTGATTCACCAGGTGGG - Intergenic
970080884 4:12283832-12283854 TGTGATTTGATTCACCAGGTGGG - Intergenic
970397523 4:15684194-15684216 TGTGATTCCATAACCCAGGTGGG - Intronic
972287600 4:37663698-37663720 CGGGATTCCATTGTCTGGGTTGG - Intronic
972724768 4:41737160-41737182 CGGGCTTCCAGTGACAAGGTAGG + Intergenic
973550393 4:52029259-52029281 TGGGATGCCACTGACTAGATTGG + Intronic
973714249 4:53659315-53659337 TTGCATTTCAGTGACCAGGTTGG + Intronic
975908040 4:79239110-79239132 TAGGATTCCATTGAGCGAGTTGG + Intronic
976341235 4:83947366-83947388 TGGAATACCAATGACCAGGCTGG - Intergenic
976826237 4:89263491-89263513 TGGGATTCAAATGGCCAGGCAGG + Intronic
977352886 4:95910862-95910884 TGGGATTCAATCGGCCAGGCAGG - Intergenic
977987368 4:103398988-103399010 TGGGATTCCCTTGGCCAAGAGGG + Intergenic
979749388 4:124258701-124258723 TGGGATTCCCTTGTGCAGGCAGG + Intergenic
979871905 4:125834044-125834066 TGTGACTCCATTAACCAGGTTGG + Intergenic
980350349 4:131675872-131675894 TGGGATTTCACTCACCATGTTGG - Intergenic
980951561 4:139383974-139383996 TGTGATACTATTTACCAGGTGGG + Intronic
987892914 5:23904994-23905016 TGTGTTTTCATTCACCAGGTTGG + Intergenic
987892953 5:23905520-23905542 TGTGTTTCTATTCACCAGGTTGG + Intergenic
996460776 5:123739715-123739737 ATGGATTCCATTGTCCAGGCTGG + Intergenic
997158957 5:131587028-131587050 TGGGATTCAATCTGCCAGGTGGG + Intronic
999073033 5:148767892-148767914 TGGAATTACATAGAACAGGTTGG + Intergenic
999224105 5:150005785-150005807 GGAGGTGCCATTGACCAGGTTGG + Intronic
1005608267 6:27497422-27497444 CGGGATTTCATTCACCATGTTGG - Intergenic
1007219080 6:40264398-40264420 TGGGCTTGCACAGACCAGGTTGG + Intergenic
1009498954 6:64386702-64386724 TGGAATTTTAATGACCAGGTTGG - Intronic
1010849946 6:80761306-80761328 TAGGATTCAATTGACTTGGTAGG + Intergenic
1010873009 6:81064665-81064687 TGGGATTCAATCTATCAGGTGGG - Intergenic
1011206135 6:84900629-84900651 TGGGATTGCATTGAATATGTAGG + Intergenic
1015078748 6:129196906-129196928 TGGGATTCCCTTGGCCAAGAAGG - Intronic
1019305104 7:330401-330423 TTGGCTTCCATCAACCAGGTTGG + Intergenic
1021596587 7:22323521-22323543 TGTGATTGCATTAACCAGGGAGG - Intronic
1022315485 7:29241356-29241378 TGAGATTCCAAAGGCCAGGTGGG - Intronic
1024655469 7:51448048-51448070 TGGGATTCGAATGGCCAGGCGGG + Intergenic
1024849098 7:53689100-53689122 TGGCATTCCATTGAGCTGGTAGG - Intergenic
1025171614 7:56763383-56763405 TGGGACTCCATTGACAAACTGGG - Intergenic
1028821091 7:95212843-95212865 TGGGATTTCTTTAACCAGTTGGG + Intronic
1030268563 7:107646242-107646264 TGGGATGCCATTCACCAAGATGG + Intergenic
1032917781 7:136511250-136511272 TGGGATCCCAGTGACAAGATGGG - Intergenic
1033795641 7:144841750-144841772 TGGGATTACAGTACCCAGGTGGG - Intergenic
1036783389 8:11666783-11666805 TGAGATTTCATTCACCATGTTGG - Intergenic
1038208299 8:25490537-25490559 TGGGATTCCCATGAACAGGCCGG - Intronic
1043540816 8:81260253-81260275 TAGGATGCCATTGGCAAGGTTGG - Intergenic
1046877544 8:119272613-119272635 TGGGAATCCATTGATAAGATTGG - Intergenic
1048192355 8:132301404-132301426 TAGGACTTTATTGACCAGGTGGG - Intronic
1050485808 9:6133516-6133538 TGGGATTCCAGTGCCCACGTTGG - Intergenic
1050601313 9:7254863-7254885 TGGGATTGCATTGAACCTGTAGG + Intergenic
1052434998 9:28415399-28415421 TGGGATGCCATTGATCATTTTGG - Intronic
1053782363 9:41623839-41623861 TGGGATTTCAGTCACCACGTTGG + Intergenic
1054170315 9:61833996-61834018 TGGGATTTCAGTCACCACGTTGG + Intergenic
1054667223 9:67746819-67746841 TGGGATTTCAGTCACCACGTTGG - Intergenic
1055375638 9:75646445-75646467 TGGGATCCCAGTGACAAGATGGG - Intergenic
1055412166 9:76042462-76042484 TGGGATTTCGTTCACCATGTTGG - Intronic
1058825019 9:108767556-108767578 TGGGATTTCATTGTTTAGGTTGG - Intergenic
1059435708 9:114275028-114275050 TTGGAGACCATTGACCAGGCTGG - Intronic
1060620630 9:125062562-125062584 TGGGGTTTCATTCACCATGTTGG - Intronic
1062203826 9:135324431-135324453 TGGGATTCCAGTGTGCTGGTGGG - Intergenic
1185660487 X:1724748-1724770 TGAGATTGCATAGACAAGGTGGG - Intergenic
1188534051 X:31175741-31175763 TGGGATGGAATTGACCAAGTAGG - Intronic
1191227780 X:58063440-58063462 TGTGTTTTCATTGACCAGGTTGG - Intergenic
1191237678 X:58148568-58148590 TGTGTTTTCATTAACCAGGTTGG + Intergenic
1191239422 X:58171149-58171171 TGAGTTTCTATTCACCAGGTTGG + Intergenic
1192198504 X:69048308-69048330 GGGGATTCCAGTGAGCAGCTGGG + Intergenic
1192345859 X:70304846-70304868 TGGGGTTTCATTCACCATGTTGG + Intronic
1194066253 X:89266272-89266294 TGAGATTCAAATGGCCAGGTGGG - Intergenic
1194356537 X:92891781-92891803 TGGGATTGCTTTGACTATGTAGG + Intergenic
1194405434 X:93491031-93491053 TGGTATTCCATTGTGCAGTTAGG - Intergenic
1194828007 X:98586278-98586300 TGGGATTCTAGTGACCAGAATGG - Intergenic
1195754617 X:108188591-108188613 TGAGACCCCATGGACCAGGTGGG + Exonic
1198767620 X:140094779-140094801 TGGGGTTTCATTCACCATGTTGG - Intergenic
1200116595 X:153772280-153772302 TGGGAGGCCACTGACCTGGTAGG - Exonic
1200664874 Y:6008781-6008803 TGGGATTGCTTTGACTATGTAGG + Intergenic
1200720424 Y:6600391-6600413 TGAGATTCAAATGGCCAGGTGGG - Intergenic
1200800410 Y:7381787-7381809 TGGGACTACATTGTCCAGGCTGG - Intergenic