ID: 1141204381

View in Genome Browser
Species Human (GRCh38)
Location 16:81922215-81922237
Sequence ATGTTTCATAAGAAGCAATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 5, 3: 19, 4: 317}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141204381_1141204384 20 Left 1141204381 16:81922215-81922237 CCACATTGCTTCTTATGAAACAT 0: 1
1: 0
2: 5
3: 19
4: 317
Right 1141204384 16:81922258-81922280 CACATTGATGGATCCAGTTCTGG No data
1141204381_1141204385 21 Left 1141204381 16:81922215-81922237 CCACATTGCTTCTTATGAAACAT 0: 1
1: 0
2: 5
3: 19
4: 317
Right 1141204385 16:81922259-81922281 ACATTGATGGATCCAGTTCTGGG 0: 1
1: 0
2: 1
3: 12
4: 129
1141204381_1141204383 8 Left 1141204381 16:81922215-81922237 CCACATTGCTTCTTATGAAACAT 0: 1
1: 0
2: 5
3: 19
4: 317
Right 1141204383 16:81922246-81922268 ATGGCACTAACTCACATTGATGG 0: 1
1: 0
2: 0
3: 18
4: 163

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141204381 Original CRISPR ATGTTTCATAAGAAGCAATG TGG (reversed) Intronic
904277819 1:29395638-29395660 ATGTTCCATCAAAAGCAAAGAGG + Intergenic
904485328 1:30821106-30821128 CTGTTTCAAAAAAAGAAATGAGG - Intergenic
905083368 1:35345749-35345771 ATGTTTTTTAAGAAGTAATGTGG - Intronic
905641725 1:39594625-39594647 ATGGTTTAGAAGCAGCAATGGGG + Intergenic
905735694 1:40324313-40324335 ATTTTTTACAAGAAACAATGTGG - Intergenic
905812979 1:40926556-40926578 ATGTGCAATAAGAAGCCATGAGG + Intergenic
906188582 1:43880766-43880788 ATGTATTACCAGAAGCAATGCGG + Intronic
907905103 1:58777376-58777398 AAGTTACATAAGAAGAAAGGTGG + Intergenic
908880992 1:68733128-68733150 GTGTTGCATTAGAAGCAAAGTGG - Intergenic
909229564 1:73068775-73068797 ATGTTTTGTAAGAGGCAATTTGG - Intergenic
909815665 1:79990453-79990475 ATATTTCATAAAAACCTATGTGG + Intergenic
910840723 1:91558853-91558875 ATGCTTCCTAAGAAGGAAGGTGG - Intergenic
915182717 1:154077027-154077049 ATCTTTCATCAGAAACCATGAGG + Intronic
915666696 1:157451552-157451574 ATGTTTGTTAAGAGACAATGAGG + Intergenic
916268099 1:162912218-162912240 ATTTCTCATCAGAAACAATGGGG - Intergenic
916361990 1:163980642-163980664 ATGTTTCATCAGCAGCAAGATGG + Intergenic
918118858 1:181520012-181520034 AGGTTTCATGACAAGCAAAGAGG + Intronic
918398193 1:184137247-184137269 ATGTTTCATAAATATCAGTGAGG + Intergenic
919196333 1:194291261-194291283 ATGTGTCATAGGAACAAATGTGG + Intergenic
919993408 1:202725628-202725650 ATGTTTCATCAGAAGGGATTGGG + Exonic
921476057 1:215611330-215611352 ATCTTTAAAAAGAAGAAATGTGG + Intronic
921923570 1:220693492-220693514 ATGTGTGATAAGAATCACTGGGG - Intronic
922889827 1:229053127-229053149 ATGACTAAGAAGAAGCAATGTGG - Intergenic
924859902 1:247910365-247910387 ATGTTTCATAATATCCAGTGAGG - Intergenic
1064709711 10:18110837-18110859 ATGATTCAGAAGAAGTAGTGTGG + Intergenic
1065791749 10:29266749-29266771 GTGTCTCCTAAGCAGCAATGAGG + Intergenic
1067009628 10:42698227-42698249 ATATTTCAGAAAAAGGAATGTGG + Intergenic
1069829380 10:71273188-71273210 ATCTTTCTTAACAAGCACTGTGG - Intronic
1070897826 10:80000205-80000227 ATGTTTAAGAAAAAGCAAGGAGG - Intergenic
1071238633 10:83679048-83679070 ATCTTTCATAAGAAGCAATAAGG - Intergenic
1071402990 10:85296285-85296307 CTCTTTCAAAAGGAGCAATGAGG + Intergenic
1073662122 10:105488192-105488214 ATTTTTCTTAAGAGGCAATCAGG + Intergenic
1074694562 10:116037402-116037424 ATTTCTCATCAGAAACAATGGGG - Intergenic
1075692553 10:124408151-124408173 ATGTTTCATAAAAATTTATGAGG - Intronic
1075890108 10:125941285-125941307 ATTTTGCAGAAGAAGCAATTTGG + Intronic
1077236662 11:1485145-1485167 AGGTTTCAAAGGAAGCGATGAGG - Intronic
1077701702 11:4448203-4448225 ATACTTCTTAGGAAGCAATGAGG + Intergenic
1079523122 11:21352588-21352610 ATTTTTCGTGAGAAGAAATGAGG - Intronic
1079539714 11:21558243-21558265 TTGTTTCATAGGAAACAATATGG + Intronic
1079928630 11:26528748-26528770 ATAGTTGATAAAAAGCAATGGGG - Intronic
1080218481 11:29873030-29873052 ATCTTTGACAACAAGCAATGGGG - Intergenic
1081349679 11:42035290-42035312 ATGATTTATAAGAAGCAGTCTGG + Intergenic
1081790461 11:45779618-45779640 TTGTTGCATAAAAAGCAACGTGG - Intergenic
1082702483 11:56450137-56450159 GTGTTTCTTAAGAAACAACGTGG + Intergenic
1083528157 11:63391308-63391330 ATGTTTCATAAGTATCTATTAGG + Intronic
1087006198 11:93474437-93474459 ATGATTCATAAGAAAAAATTAGG + Intergenic
1087362553 11:97178920-97178942 CTGTTTCATTATAAGCAATGTGG - Intergenic
1089111068 11:116056810-116056832 ATGTGTCATGATTAGCAATGAGG - Intergenic
1089521267 11:119065786-119065808 ATATGTTAAAAGAAGCAATGTGG - Intergenic
1089957720 11:122587467-122587489 ATTTTTCATCAGAAACCATGGGG - Intergenic
1090372320 11:126265115-126265137 ATGTATCACAGGCAGCAATGAGG + Exonic
1090374769 11:126280964-126280986 ATGTTTATTAAGAAGCACTGAGG + Intergenic
1093883840 12:24437197-24437219 ATATTTTGTAATAAGCAATGGGG + Intergenic
1094359439 12:29614327-29614349 ATGTTTCAGAAGTAGGGATGTGG - Intronic
1094366804 12:29691661-29691683 ATGTTTCATAAGACATGATGAGG + Intronic
1096446080 12:51693276-51693298 ATCTTTCCTAAGAAGCAATGTGG - Intronic
1096686838 12:53293571-53293593 ATGTTTCATATAAAACACTGGGG - Exonic
1097245007 12:57603044-57603066 CTGTCTCACAAGAAGCCATGAGG + Exonic
1097490059 12:60255814-60255836 ATGTTTCATAACCAGCTATATGG + Intergenic
1097790269 12:63807934-63807956 AGGTTTCATCAGAATCAATCTGG - Intronic
1099312122 12:81039556-81039578 AAGTTTCTAAAGAAGCAATGAGG + Intronic
1099451152 12:82808246-82808268 ATGTTTCAGAAAAAGAAATATGG + Intronic
1101289629 12:103354466-103354488 CTGTTTGATAACAATCAATGCGG + Intronic
1101487461 12:105179763-105179785 ATTTTTCAAAAGAAGACATGCGG - Intronic
1106120052 13:26852535-26852557 CTGTTTCATATGAACCAGTGTGG + Intergenic
1106426831 13:29639132-29639154 ATGTTTGAAAAGAAGAAAGGTGG + Intergenic
1106824482 13:33504841-33504863 ATTTTTTATAAGAAGATATGAGG - Intergenic
1107036629 13:35909161-35909183 ATGTTGCAGAAAAAGAAATGAGG + Intronic
1107620696 13:42226152-42226174 ATTTTTCAAAAGAAGACATGTGG + Intronic
1108026843 13:46186875-46186897 GTGTTTCATGAGAAGCCTTGAGG - Intronic
1108268927 13:48739403-48739425 ACATTCCAGAAGAAGCAATGAGG - Intergenic
1109974263 13:69810241-69810263 ATGTTTCATATGAAGACAAGAGG - Intronic
1110140966 13:72129150-72129172 ATGTATCATACAAAGAAATGAGG - Intergenic
1111329968 13:86752608-86752630 ATGTGCAATAAAAAGCAATGTGG + Intergenic
1111552292 13:89829891-89829913 ATATTTTATGGGAAGCAATGTGG - Intergenic
1111602646 13:90494599-90494621 GTATTTCATAAGAAGCTCTGTGG + Intergenic
1111987936 13:95083822-95083844 GTGTTTCAAAAGAACTAATGGGG - Intronic
1112598302 13:100830321-100830343 ATGTTTCCTAAGATACACTGAGG + Intergenic
1112660254 13:101499782-101499804 ATGTTTCATAAAAATAATTGGGG + Intronic
1115201752 14:30861380-30861402 ATGTTTCATAACAGGAAAGGGGG + Intergenic
1115626420 14:35197733-35197755 ATCTTTCATAAGACAAAATGGGG - Intronic
1117583267 14:57174377-57174399 AGGTTTCATAAATAGCTATGTGG - Intergenic
1120155063 14:81084392-81084414 AGGTTTAAAAAGAAGGAATGTGG - Intronic
1121520768 14:94584796-94584818 ATGCTTCTAAAGAAACAATGTGG - Intronic
1122281697 14:100627005-100627027 ATATTTTACTAGAAGCAATGAGG + Intergenic
1122829803 14:104390298-104390320 ATGTTTTATAAGAGGCTTTGGGG + Intergenic
1123459772 15:20459359-20459381 GTGTTTCAGAAGAACGAATGTGG - Intergenic
1123658290 15:22541061-22541083 GTGTTTCAGAAGAACGAATGTGG + Intergenic
1124266002 15:28235196-28235218 GTGTTTCAGAAGAACGAATGTGG - Intronic
1124312155 15:28635553-28635575 GTGTTTCAGAAGAACGAATGTGG + Intergenic
1125263970 15:37858303-37858325 ATTTTTAATAAGAGGCAAGGGGG + Intergenic
1126282153 15:46966167-46966189 ATGTTTCATCAGAACCCCTGGGG + Intergenic
1126515800 15:49536447-49536469 ATGTATCAGAAGAATCAATATGG + Intronic
1126810973 15:52403736-52403758 ATGTTTCATTAGAAGAAATGAGG + Intronic
1126853961 15:52819256-52819278 ATCTCTCATAGGAAGAAATGAGG - Intergenic
1127007633 15:54588182-54588204 ATGGTTCATTAATAGCAATGGGG + Intronic
1128960552 15:71999041-71999063 ATATGACATAAGAAGAAATGTGG + Intronic
1129024658 15:72559239-72559261 GTGTTGTTTAAGAAGCAATGGGG + Intronic
1130202743 15:81847951-81847973 ATATTTCATAAAAAACAATTTGG - Intergenic
1131441979 15:92466462-92466484 ATGTTTCATGGTAAGCACTGTGG + Exonic
1131745420 15:95442319-95442341 ATGTGTATTAAGAAGCAGTGTGG + Intergenic
1132174152 15:99695567-99695589 GTGTTTCTTAAAAAGCAATGTGG + Intronic
1133844505 16:9441407-9441429 TTGTCTCAAAAGAAGCAATTTGG - Intergenic
1134159178 16:11871796-11871818 ATTTTTCATGAGAATAAATGAGG - Exonic
1134332963 16:13267118-13267140 ATGTTTAAAAAGAAGCCAAGTGG + Intergenic
1136704187 16:32172616-32172638 GTGTTTCAGAAGAACGAATGTGG - Intergenic
1136763722 16:32756790-32756812 GTGTTTCAGAAGAACGAATGTGG + Intergenic
1136804377 16:33113596-33113618 GTGTTTCAGAAGAACGAATGTGG - Intergenic
1137856557 16:51800327-51800349 ATTTTTCAGATGAAGAAATGGGG + Intergenic
1138683883 16:58707681-58707703 ATGTTTTATGAAAACCAATGAGG - Exonic
1138982658 16:62288871-62288893 ATTTTTCAGATGAAGAAATGAGG - Intergenic
1140551417 16:75870208-75870230 ATGTTTGAGAAAAAGCAAGGAGG + Intergenic
1140983319 16:80132501-80132523 ATGTTTCATCATCAGCAATTGGG - Intergenic
1141204381 16:81922215-81922237 ATGTTTCATAAGAAGCAATGTGG - Intronic
1141591902 16:85074747-85074769 ATGTTTCATAAAAGGCAATCTGG - Intronic
1203065872 16_KI270728v1_random:1017111-1017133 GTGTTTCAGAAGAATGAATGTGG + Intergenic
1143982367 17:10880990-10881012 ATGTTACATAAAAAGGAATATGG - Intergenic
1145284446 17:21494945-21494967 ATGTTACATATGTGGCAATGGGG - Intergenic
1145393010 17:22470549-22470571 ATGTTACATATGTGGCAATGAGG + Intergenic
1146753862 17:35408788-35408810 CTGTTTAATGAGAAGCAGTGGGG - Intergenic
1146771868 17:35576268-35576290 ATTTTTCATCAGAATCACTGGGG + Intronic
1149082557 17:52676697-52676719 ATGCTTTGTAAGAAGCACTGAGG + Intergenic
1150268595 17:63847843-63847865 GAATTTCATGAGAAGCAATGTGG + Intergenic
1150871549 17:68917379-68917401 TTGTTTCTAAAGAAGAAATGGGG - Exonic
1150880883 17:69026395-69026417 CTGTTCCTTAAGAAGAAATGGGG - Exonic
1153417679 18:4867080-4867102 ATTTCTCATAAGAAACTATGAGG + Intergenic
1153501291 18:5752515-5752537 CTGTTTCCTAAGAAGGAAAGTGG + Intergenic
1155097735 18:22575323-22575345 AAGTTTCATAAGATGAATTGAGG + Intergenic
1156695612 18:39762597-39762619 ATGTGGCATAAAAAGGAATGAGG + Intergenic
1157131989 18:45015707-45015729 ATGTGTGATAAAAGGCAATGAGG + Intronic
1157137222 18:45068017-45068039 ATATTTCAAAAGAAAAAATGGGG + Exonic
1158159328 18:54462240-54462262 ATGTTACAGAAGAATCACTGTGG - Intergenic
1158694843 18:59695232-59695254 ATGTGTCCTAAGAAACACTGTGG + Intronic
1158869594 18:61672126-61672148 TTGTTTCATAAGAAACAAACAGG + Intergenic
1159509092 18:69373233-69373255 ATTTTTCATAAGAAGCACGGAGG + Intergenic
1159840488 18:73393522-73393544 CTGTTTGATAAGAAGAATTGTGG + Intergenic
1160004138 18:75055976-75055998 CTGTTTTATAAGAAGAGATGGGG - Intronic
1160216265 18:76934868-76934890 ATGTTTTCTTAGAAGCTATGAGG + Intronic
1160584188 18:79903685-79903707 GTGTTTCATAAGAGGAAATGGGG + Exonic
1162623182 19:11861022-11861044 AATTTAAATAAGAAGCAATGAGG - Intronic
1162636210 19:11969593-11969615 AATTTAAATAAGAAGCAATGAGG - Intronic
1164233730 19:23314140-23314162 ATATGTCACAAGATGCAATGTGG - Intronic
1164394729 19:27852574-27852596 GTGTTTCATGAGAAAGAATGTGG - Intergenic
925895695 2:8470325-8470347 ATGTTTCAGAAGAAGCAGAGAGG - Intergenic
926112882 2:10194101-10194123 ATGACTCATAAGATGAAATGAGG - Intronic
927832553 2:26365084-26365106 ATGTTGTCTAAAAAGCAATGAGG + Intronic
928498340 2:31859150-31859172 ATGTTTTCTAAGAATCGATGTGG - Intergenic
928553870 2:32402252-32402274 TTGTTTCCTAAGAACCACTGTGG + Intronic
929418695 2:41769225-41769247 AGTTTTAATAGGAAGCAATGAGG - Intergenic
932945663 2:76227140-76227162 ATGTTTCACAAGAGGCTTTGTGG - Intergenic
933517865 2:83329377-83329399 ATATTTTCTAAGAAGAAATGTGG - Intergenic
933980513 2:87546102-87546124 TTTTTTTATCAGAAGCAATGAGG - Intergenic
934038773 2:88110492-88110514 CTGTTCCACAAGAAGCAATGAGG + Exonic
935549312 2:104435099-104435121 ATGTTTTATAAAATGCATTGTGG + Intergenic
936313313 2:111404689-111404711 TTTTTTTATCAGAAGCAATGAGG + Intergenic
936726696 2:115327625-115327647 ATGTTCTATGAGAAACAATGTGG + Intronic
937995149 2:127688669-127688691 ATGTCTCATCAGAAGCAATGGGG - Intergenic
938514395 2:131987860-131987882 ATGTTTTATCAGAAATAATGGGG + Intergenic
938721853 2:134074515-134074537 ATACTGCATAAGAAGCAATCTGG + Intergenic
939645960 2:144699423-144699445 ATTTTTAATAAAAAGTAATGAGG - Intergenic
940083361 2:149829652-149829674 ATGTGTGATAGGAAGCCATGTGG - Intergenic
940250289 2:151667974-151667996 ATGTTTTATAAGAAACATTTTGG - Intronic
941080063 2:161050403-161050425 ATGTGTCAGAAGAAACAGTGGGG - Intergenic
941654737 2:168131275-168131297 ATGTTTCATAATAAGATATTGGG + Intronic
943065786 2:183084720-183084742 ATTTCTCATTAGAAGCAGTGTGG + Intronic
944360663 2:198851901-198851923 ATTTTTCAAATGAAGAAATGTGG - Intergenic
944859743 2:203803779-203803801 ATGTCTCCTAAGAAGTAAAGAGG - Intergenic
944903465 2:204239396-204239418 TGGTTTCATATGAAGCAAAGGGG - Intergenic
945365834 2:208952561-208952583 ATGTTTCAGAAGAATCACAGAGG + Intergenic
946521629 2:220471038-220471060 ATGTTTCTTAAAAAGCACAGAGG - Intergenic
946856428 2:223954624-223954646 ATGTTGCCTAAGAAACTATGTGG - Intergenic
947465078 2:230336471-230336493 CTGTTTCATGAGAATCTATGAGG + Intronic
947959772 2:234226254-234226276 GAATTTCATAAGAAGCTATGTGG + Intergenic
1170371183 20:15649956-15649978 ATGTTTCATAGCATCCAATGGGG - Intronic
1171491910 20:25525761-25525783 ATGTTTAAGAAGTAGGAATGGGG + Intronic
1172410131 20:34715162-34715184 CTGTTTCATAAAGTGCAATGGGG - Exonic
1172462670 20:35131886-35131908 ATGTTTCCCAAGAAGCACTGGGG - Intronic
1175078930 20:56401654-56401676 ATGTCCAATAAGAAGCACTGAGG + Intronic
1175313162 20:58025677-58025699 ATGTCCCATAAGCAGCAGTGGGG + Intergenic
1175372886 20:58504394-58504416 ATGGTTCCTAAGCAGCCATGAGG + Intronic
1175548617 20:59800496-59800518 ATGTCTCAAGAGAAACAATGTGG - Intronic
1178512365 21:33216210-33216232 ATTGTTCATGAGAAGCTATGAGG - Intergenic
1179204653 21:39263597-39263619 ATGATACATATGACGCAATGAGG + Intronic
1181845044 22:25700040-25700062 GTGTTTCAGCAGAAGCAAGGGGG - Intronic
1182207384 22:28642691-28642713 ATGTTTCAGAAACAGCAAAGAGG + Intronic
1183349511 22:37326995-37327017 ATGTTTGCTAAGAACCAGTGTGG - Intergenic
1183688315 22:39374639-39374661 ATGTTTCAGATGAGGAAATGAGG + Intronic
1185159968 22:49218318-49218340 ACTTCTCATCAGAAGCAATGCGG + Intergenic
951661965 3:25076864-25076886 ATGTCTCATGGGAAGCATTGTGG - Intergenic
952110025 3:30111711-30111733 GTGTTTCATACAAAACAATGGGG - Intergenic
952252410 3:31667197-31667219 ATGCTTCATCAGAGGCAGTGTGG + Intronic
952648272 3:35689155-35689177 ATGTTTCAAAACTAGCAATCTGG - Intronic
955523065 3:59793751-59793773 ATCTTTCAAATGAGGCAATGAGG - Intronic
957741308 3:84273140-84273162 TTGTTTCATTAGAGGCAATTTGG + Intergenic
958213851 3:90533363-90533385 ATGTTTCATTTGAAGAAATCAGG + Intergenic
958221635 3:90692262-90692284 AAGTTTCATAAGAAGAAATCCGG + Intergenic
959635176 3:108558803-108558825 AAGTTTCAGAAAAAGCAAAGTGG + Intronic
960263635 3:115595754-115595776 ATGAATCATCAGAAGCTATGTGG + Intergenic
960468049 3:118023152-118023174 CTGTCTCATAAGAAGTAATTTGG + Intergenic
961842664 3:129729807-129729829 CTATTTCATAAAAAGGAATGAGG + Intronic
963362040 3:144286893-144286915 ATGTTTTATAAGGACCATTGAGG + Intergenic
963655805 3:148048820-148048842 ATTTTTCATTAGAAACCATGGGG - Intergenic
964017098 3:151961196-151961218 ATGTTTGTTAAGCAGCATTGAGG + Intergenic
965585540 3:170314649-170314671 AAATTTGATAAGCAGCAATGTGG - Intergenic
965895444 3:173570289-173570311 ATGTTTCAGAAAGAGCAAGGTGG + Intronic
967049570 3:185770168-185770190 ACGTCTCATAAGAAGGGATGTGG + Intronic
968204875 3:196790542-196790564 ATGTTTCATAAAATGAAAGGAGG - Intronic
971103792 4:23498989-23499011 GTCTTTCATAAGAAGGAATATGG + Intergenic
971446319 4:26753218-26753240 ATGTTTCATATGTAACAAGGAGG - Intronic
971605886 4:28656782-28656804 ATGTTTCATTAGATGCAACTAGG + Intergenic
972380886 4:38519315-38519337 ATGTCTCATAAGAGACAGTGCGG + Intergenic
973069863 4:45844942-45844964 ATTTTTGATAAGTAGCAATATGG - Intergenic
973346510 4:49061873-49061895 ATGTTTCATAAAAAGTATTTGGG - Exonic
973938389 4:55876241-55876263 ATCTTCCAAAAGAATCAATGAGG - Intronic
974431405 4:61801526-61801548 ATGGTTTCAAAGAAGCAATGTGG - Intronic
974450685 4:62053452-62053474 ATTTGTCATAACAAGGAATGTGG + Intronic
974683804 4:65197115-65197137 ATGTTATATAATAAGCCATGAGG - Intergenic
974772843 4:66438047-66438069 ATGTTTGATAAGCAGAGATGTGG - Intergenic
975063341 4:70032684-70032706 ATGATGCATAAAAAGGAATGAGG + Intronic
975486736 4:74941946-74941968 ATTTTACATGAGAAGCAATATGG + Intronic
975916687 4:79333578-79333600 ATGTTTTTAAAGAAGAAATGAGG - Intergenic
975996873 4:80325643-80325665 ATGATTTCTAAGAAACAATGTGG - Intronic
976742281 4:88368550-88368572 TTTTTTCATAAAAAGAAATGAGG + Intergenic
977465904 4:97382666-97382688 AAGTTCCATAAGAAGCAACTGGG + Intronic
977871795 4:102099476-102099498 ATTTTTCATATGAAGCATTGAGG - Intergenic
978148525 4:105406857-105406879 ACCATTCATTAGAAGCAATGGGG + Intronic
978194377 4:105953858-105953880 CTGTTTCATAGGAAACAAGGTGG - Intronic
978736087 4:112086152-112086174 AAGTTTTATAAGAAGATATGTGG - Intergenic
979364470 4:119804178-119804200 ATGTTGAATAAGATCCAATGTGG - Intergenic
979878277 4:125921563-125921585 TTGTATCATAAGAATAAATGGGG + Intergenic
980715458 4:136622751-136622773 ATGTTTCATATGAATTAATCTGG + Intergenic
980830960 4:138128790-138128812 ATCTTGCATAAGAAGCCCTGGGG + Intergenic
981340170 4:143612864-143612886 CACTTTAATAAGAAGCAATGAGG + Intronic
983383339 4:167024999-167025021 ATGTATCATAAAAAGCTATCTGG + Intronic
983829317 4:172304803-172304825 ACTTTACATAAGAAGAAATGGGG - Intronic
984346195 4:178530255-178530277 ATACTTCAGAATAAGCAATGAGG + Intergenic
984571656 4:181402377-181402399 ATTTTTCATAATAAAAAATGTGG - Intergenic
986373046 5:7099890-7099912 ATGTTCCCGAAAAAGCAATGTGG + Intergenic
986700095 5:10398281-10398303 GTCTTTAATAAGAAGCCATGTGG + Intronic
986981325 5:13450874-13450896 ATATTTTATCAGAAGAAATGAGG - Intergenic
987327453 5:16825299-16825321 ATGTGTCATAAGGAGCAATGAGG - Intronic
988031233 5:25765848-25765870 ATGTTTCCTTAGAAGAAAAGGGG + Intergenic
989105606 5:37860537-37860559 ATGTTTCCTAAGAATCACTTGGG + Intergenic
989221255 5:38968052-38968074 GTGTTTCATAAAAATAAATGAGG - Intronic
991220457 5:64209087-64209109 ATATGGCATAAGAGGCAATGTGG + Intronic
995368989 5:111397061-111397083 ATGTATAATAACAAGAAATGAGG - Intronic
995433809 5:112112880-112112902 ATGTTTTTTAAAAAGCATTGTGG + Intergenic
996916209 5:128714920-128714942 ATATTTCAAAAGAAACAATTAGG - Intronic
997269475 5:132524860-132524882 ATGTTTCATATGAAGAAAGTGGG - Intergenic
997363458 5:133310360-133310382 ATGTCTCATACAGAGCAATGTGG - Intronic
997907939 5:137838601-137838623 ATATATTATAAGAAGCATTGAGG + Intergenic
998222046 5:140291003-140291025 TTGTTTCTAAAGAGGCAATGAGG - Intronic
998296073 5:140969743-140969765 ATGTTTCTTAAAAAGCTCTGAGG + Intronic
999354851 5:150916569-150916591 ATGTTTCATAAGCAGAAGTTTGG - Intergenic
1000114216 5:158138106-158138128 TTGTTTCACAAGAATGAATGGGG + Intergenic
1001920428 5:175595568-175595590 ATGGTTCAGCAGAGGCAATGAGG - Intergenic
1004922012 6:20384590-20384612 AATTTTCAAAATAAGCAATGAGG - Intergenic
1005049663 6:21673244-21673266 ATGTTTCAGAGAAAGCAAGGAGG + Intergenic
1005351252 6:24937727-24937749 ATTTTACAGATGAAGCAATGGGG + Intronic
1005584343 6:27261117-27261139 GTCTTTCAAAAGAAGAAATGTGG + Intergenic
1007355603 6:41313611-41313633 AAGTTGTTTAAGAAGCAATGAGG + Intergenic
1010663182 6:78595590-78595612 ATGTTTTCTAAAAATCAATGTGG + Intergenic
1010897596 6:81383612-81383634 AAGTGTGATAAGAAGCTATGAGG - Intergenic
1011826171 6:91308290-91308312 ATGTTCCATAATATGCAGTGGGG + Intergenic
1011947327 6:92922616-92922638 ATGTTGCATAAGTAACACTGCGG - Intergenic
1012327407 6:97938952-97938974 ATTTTACATAAGCAACAATGGGG + Intergenic
1015819902 6:137249676-137249698 ATGTTTCAAAAGTAGGAAGGGGG - Intergenic
1015826365 6:137316849-137316871 ATGTTGCAAGAGAAGCAATGTGG - Intergenic
1015898071 6:138036125-138036147 ATTTTTCATAAGACACCATGAGG - Intergenic
1016218889 6:141640681-141640703 TTGTATCTTAAGAAGCACTGTGG + Intergenic
1016380310 6:143470959-143470981 AGGTTTCACAAGAAGTACTGTGG + Exonic
1016899243 6:149084838-149084860 AAGTTTGAACAGAAGCAATGTGG + Intergenic
1018716838 6:166539579-166539601 ATATTTCAGAAGAAGCAGTCAGG + Intronic
1018901640 6:168054578-168054600 ATGTTTCCTAAGAAGGAGGGTGG - Intergenic
1019345891 7:530786-530808 CTGTTTTATAAGAGGCACTGGGG + Intergenic
1020337221 7:7071344-7071366 ATGTTTCATAATATCCAAGGAGG + Intergenic
1021007580 7:15418371-15418393 AAAGTTTATAAGAAGCAATGAGG - Intronic
1021594660 7:22302298-22302320 CTGTTTCAGCAGAAGCCATGTGG + Intronic
1022973615 7:35537895-35537917 ATTTTTCATAAGATGAAAGGAGG - Intergenic
1023469923 7:40506340-40506362 GTGTTTGATAATAAGTAATGTGG + Intronic
1026109964 7:67451221-67451243 AAGTTTCATAGGATGCAGTGTGG - Intergenic
1027479378 7:78675943-78675965 TTGATTCATAAGACACAATGTGG - Intronic
1028559654 7:92159919-92159941 ATGATGAATAAAAAGCAATGGGG - Intronic
1031326719 7:120408982-120409004 ATGTTTCTTAAGAAGGAGGGAGG + Intronic
1032605247 7:133343761-133343783 ATAATTCATAGGAAGCACTGAGG - Intronic
1033854819 7:145547216-145547238 ATGTTTTAAAAGAAACTATGTGG - Intergenic
1036917237 8:12815770-12815792 ATTTCTCAGAGGAAGCAATGTGG + Intergenic
1037329748 8:17732633-17732655 ATGATTGATAAGAGGCCATGTGG - Intronic
1038541201 8:28391548-28391570 ATGTTTCAAAAGAATCTTTGTGG - Intronic
1039371022 8:36983989-36984011 ATTTTACATAATAAGAAATGGGG - Intergenic
1041784802 8:61620028-61620050 ATGTTTTATATGAATGAATGTGG - Intronic
1041872246 8:62648423-62648445 ATGTTCCCTAAGAAGCAAGCTGG + Intronic
1042147322 8:65743638-65743660 ATTTTTCTTGAGAATCAATGTGG - Intronic
1042561867 8:70078042-70078064 ATATTTCATAGGATGCAAGGTGG + Intergenic
1042892482 8:73627564-73627586 TTGTTTCATAAGAAAAAATTAGG + Intronic
1043821008 8:84864546-84864568 ATGTTTCATATAAAGCACTGGGG + Intronic
1043973619 8:86561124-86561146 ATATGGCATAAGTAGCAATGGGG - Exonic
1047118261 8:121869917-121869939 ATGGTTCAGAGGAAGAAATGGGG - Intergenic
1047282127 8:123454876-123454898 ATTTGTGATCAGAAGCAATGTGG + Intronic
1047649867 8:126909125-126909147 ATATTTCATTGGCAGCAATGTGG + Intergenic
1050617678 9:7419600-7419622 GTGTTTCATAAGAAAAAAGGTGG - Intergenic
1051009513 9:12394290-12394312 ATGTATGCTAATAAGCAATGAGG + Intergenic
1053748130 9:41221682-41221704 ATGTTACAGAGGAAGCAGTGGGG - Intergenic
1054338263 9:63828902-63828924 ATGTTTCAGAGGAAGCAGTGGGG + Intergenic
1054981076 9:71206850-71206872 ATTTTGCAAAACAAGCAATGGGG - Intronic
1055362167 9:75503985-75504007 ATTTTTCAGATGAAGAAATGAGG + Intergenic
1055489382 9:76789313-76789335 ATTTTACAAAAGAAGAAATGGGG + Intronic
1055493346 9:76828494-76828516 ATGTTTTATAAGAATCACTCTGG + Intronic
1055615541 9:78068400-78068422 ATGTGTCATAAAAATCGATGTGG + Intergenic
1055967494 9:81880014-81880036 CTGTTTATTAATAAGCAATGAGG - Intergenic
1056607844 9:88101728-88101750 ATATTTCATAAGAAACTATAGGG + Intergenic
1056890416 9:90486912-90486934 AAGTTTTAGAAGAAGCAACGAGG + Intergenic
1058561827 9:106237994-106238016 ATTTCTCACAAGAAACAATGAGG - Intergenic
1058851688 9:109017838-109017860 ATGATTCCTCAGATGCAATGAGG - Exonic
1059040106 9:110804252-110804274 AATTTTCATAAAAAGAAATGTGG - Intergenic
1059297063 9:113280743-113280765 ATATTCCATAAGGACCAATGTGG - Intronic
1059582032 9:115560491-115560513 ATGTTTTATAAGTATCAATTTGG - Intergenic
1202784258 9_KI270718v1_random:32383-32405 ATGTTACAGAGGAAGCAGTGGGG - Intergenic
1185721887 X:2388881-2388903 ACATTTCATAAGAAGAGATGAGG + Intronic
1186741532 X:12523304-12523326 ATGTTTCATGAGAGCCCATGAGG - Intronic
1186903186 X:14080664-14080686 ATGTTTCAGAAGAATAATTGGGG + Intergenic
1187954180 X:24499615-24499637 ATGTTCCATAAGAAGAACTAGGG + Intronic
1188178689 X:27026330-27026352 ATGTTTGCCAAGAAGAAATGAGG - Intergenic
1188331620 X:28878768-28878790 ATGGTTCATATAAAGCAATAGGG + Intronic
1194322535 X:92468408-92468430 ATGTTTTATGAGAAGCAAAAAGG - Intronic
1195600518 X:106742028-106742050 ATGTTTCATTAGTAGCCATGAGG + Intronic
1196387328 X:115172633-115172655 ATTTTTCAAAAGAAAAAATGGGG - Intronic
1196971756 X:121117109-121117131 TTCTTACATAAGAAGCAATGAGG + Intergenic
1197022434 X:121707514-121707536 AAGTTTGGTAAGAAGCAATTTGG + Intergenic
1198229836 X:134678329-134678351 ATGTTTGAGAAAAAGCAAGGAGG - Intronic
1199013342 X:142782321-142782343 CTGTTTACTCAGAAGCAATGAGG - Intergenic
1200687617 Y:6270842-6270864 ATGTTTGAAAAGAAGACATGAGG - Intergenic
1201047654 Y:9903867-9903889 ATGTTTGAAAAGAAGACATGAGG + Intergenic
1201062797 Y:10062971-10062993 ATATTTCAAAAGAAGACATGAGG + Intergenic
1201383060 Y:13406284-13406306 AGGTATCATAAGAACCAATTAGG + Intronic
1201946740 Y:19518750-19518772 ATCTTACAAAAAAAGCAATGGGG + Intergenic
1202100345 Y:21300966-21300988 ATGTTTCATAAGCAGCACAGAGG - Intergenic
1202116585 Y:21474291-21474313 ATGTTTCAAAAGAAGATGTGAGG - Intergenic
1202165417 Y:21982113-21982135 AGGTTTCATAGTAAGCCATGTGG + Intergenic
1202225940 Y:22604259-22604281 AGGTTTCATAGTAAGCCATGTGG - Intergenic
1202317173 Y:23591402-23591424 AGGTTTCATAGTAAGCCATGTGG + Intergenic
1202553592 Y:26078656-26078678 AGGTTTCATAGTAAGCCATGTGG - Intergenic