ID: 1141209776

View in Genome Browser
Species Human (GRCh38)
Location 16:81966904-81966926
Sequence TGAAATTGATGCCATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141209776_1141209781 -10 Left 1141209776 16:81966904-81966926 CCCACCCCATGGCATCAATTTCA No data
Right 1141209781 16:81966917-81966939 ATCAATTTCAGATGATTTCATGG No data
1141209776_1141209782 -9 Left 1141209776 16:81966904-81966926 CCCACCCCATGGCATCAATTTCA No data
Right 1141209782 16:81966918-81966940 TCAATTTCAGATGATTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141209776 Original CRISPR TGAAATTGATGCCATGGGGT GGG (reversed) Intergenic
No off target data available for this crispr