ID: 1141209782

View in Genome Browser
Species Human (GRCh38)
Location 16:81966918-81966940
Sequence TCAATTTCAGATGATTTCAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141209775_1141209782 -6 Left 1141209775 16:81966901-81966923 CCTCCCACCCCATGGCATCAATT No data
Right 1141209782 16:81966918-81966940 TCAATTTCAGATGATTTCATGGG No data
1141209773_1141209782 23 Left 1141209773 16:81966872-81966894 CCAAGAAATAGAAAAAACAAAGA No data
Right 1141209782 16:81966918-81966940 TCAATTTCAGATGATTTCATGGG No data
1141209777_1141209782 -10 Left 1141209777 16:81966905-81966927 CCACCCCATGGCATCAATTTCAG No data
Right 1141209782 16:81966918-81966940 TCAATTTCAGATGATTTCATGGG No data
1141209776_1141209782 -9 Left 1141209776 16:81966904-81966926 CCCACCCCATGGCATCAATTTCA No data
Right 1141209782 16:81966918-81966940 TCAATTTCAGATGATTTCATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141209782 Original CRISPR TCAATTTCAGATGATTTCAT GGG Intergenic
No off target data available for this crispr