ID: 1141216928

View in Genome Browser
Species Human (GRCh38)
Location 16:82033575-82033597
Sequence TTACTGTGCTGTGGGACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141216928_1141216934 17 Left 1141216928 16:82033575-82033597 CCCACAGTCCCACAGCACAGTAA No data
Right 1141216934 16:82033615-82033637 CTTCCCACCCCTTCTCCCTTGGG No data
1141216928_1141216940 28 Left 1141216928 16:82033575-82033597 CCCACAGTCCCACAGCACAGTAA No data
Right 1141216940 16:82033626-82033648 TTCTCCCTTGGGTCTTGAGTTGG No data
1141216928_1141216933 16 Left 1141216928 16:82033575-82033597 CCCACAGTCCCACAGCACAGTAA No data
Right 1141216933 16:82033614-82033636 GCTTCCCACCCCTTCTCCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141216928 Original CRISPR TTACTGTGCTGTGGGACTGT GGG (reversed) Intergenic
No off target data available for this crispr