ID: 1141216929

View in Genome Browser
Species Human (GRCh38)
Location 16:82033576-82033598
Sequence ATTACTGTGCTGTGGGACTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141216929_1141216933 15 Left 1141216929 16:82033576-82033598 CCACAGTCCCACAGCACAGTAAT No data
Right 1141216933 16:82033614-82033636 GCTTCCCACCCCTTCTCCCTTGG No data
1141216929_1141216940 27 Left 1141216929 16:82033576-82033598 CCACAGTCCCACAGCACAGTAAT No data
Right 1141216940 16:82033626-82033648 TTCTCCCTTGGGTCTTGAGTTGG No data
1141216929_1141216934 16 Left 1141216929 16:82033576-82033598 CCACAGTCCCACAGCACAGTAAT No data
Right 1141216934 16:82033615-82033637 CTTCCCACCCCTTCTCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141216929 Original CRISPR ATTACTGTGCTGTGGGACTG TGG (reversed) Intergenic