ID: 1141216934

View in Genome Browser
Species Human (GRCh38)
Location 16:82033615-82033637
Sequence CTTCCCACCCCTTCTCCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141216931_1141216934 9 Left 1141216931 16:82033583-82033605 CCCACAGCACAGTAATGGTTCAC No data
Right 1141216934 16:82033615-82033637 CTTCCCACCCCTTCTCCCTTGGG No data
1141216929_1141216934 16 Left 1141216929 16:82033576-82033598 CCACAGTCCCACAGCACAGTAAT No data
Right 1141216934 16:82033615-82033637 CTTCCCACCCCTTCTCCCTTGGG No data
1141216928_1141216934 17 Left 1141216928 16:82033575-82033597 CCCACAGTCCCACAGCACAGTAA No data
Right 1141216934 16:82033615-82033637 CTTCCCACCCCTTCTCCCTTGGG No data
1141216932_1141216934 8 Left 1141216932 16:82033584-82033606 CCACAGCACAGTAATGGTTCACA No data
Right 1141216934 16:82033615-82033637 CTTCCCACCCCTTCTCCCTTGGG No data
1141216927_1141216934 18 Left 1141216927 16:82033574-82033596 CCCCACAGTCCCACAGCACAGTA No data
Right 1141216934 16:82033615-82033637 CTTCCCACCCCTTCTCCCTTGGG No data
1141216926_1141216934 22 Left 1141216926 16:82033570-82033592 CCAACCCCACAGTCCCACAGCAC No data
Right 1141216934 16:82033615-82033637 CTTCCCACCCCTTCTCCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141216934 Original CRISPR CTTCCCACCCCTTCTCCCTT GGG Intergenic
No off target data available for this crispr