ID: 1141216940

View in Genome Browser
Species Human (GRCh38)
Location 16:82033626-82033648
Sequence TTCTCCCTTGGGTCTTGAGT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141216931_1141216940 20 Left 1141216931 16:82033583-82033605 CCCACAGCACAGTAATGGTTCAC No data
Right 1141216940 16:82033626-82033648 TTCTCCCTTGGGTCTTGAGTTGG No data
1141216929_1141216940 27 Left 1141216929 16:82033576-82033598 CCACAGTCCCACAGCACAGTAAT No data
Right 1141216940 16:82033626-82033648 TTCTCCCTTGGGTCTTGAGTTGG No data
1141216928_1141216940 28 Left 1141216928 16:82033575-82033597 CCCACAGTCCCACAGCACAGTAA No data
Right 1141216940 16:82033626-82033648 TTCTCCCTTGGGTCTTGAGTTGG No data
1141216932_1141216940 19 Left 1141216932 16:82033584-82033606 CCACAGCACAGTAATGGTTCACA No data
Right 1141216940 16:82033626-82033648 TTCTCCCTTGGGTCTTGAGTTGG No data
1141216927_1141216940 29 Left 1141216927 16:82033574-82033596 CCCCACAGTCCCACAGCACAGTA No data
Right 1141216940 16:82033626-82033648 TTCTCCCTTGGGTCTTGAGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141216940 Original CRISPR TTCTCCCTTGGGTCTTGAGT TGG Intergenic
No off target data available for this crispr