ID: 1141216971

View in Genome Browser
Species Human (GRCh38)
Location 16:82033760-82033782
Sequence AATGAGGGGCAGGAGGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141216971_1141216979 19 Left 1141216971 16:82033760-82033782 CCTTCCTCCTCCTGCCCCTCATT No data
Right 1141216979 16:82033802-82033824 GAGACAAGTCTATACTCCACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141216971 Original CRISPR AATGAGGGGCAGGAGGAGGA AGG (reversed) Intergenic
No off target data available for this crispr