ID: 1141220585

View in Genome Browser
Species Human (GRCh38)
Location 16:82065733-82065755
Sequence CAGATGAAGGAGAAGGTGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 652
Summary {0: 1, 1: 0, 2: 5, 3: 62, 4: 584}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141220581_1141220585 -8 Left 1141220581 16:82065718-82065740 CCTTCTCTGCTGACACAGATGAA 0: 1
1: 0
2: 2
3: 21
4: 252
Right 1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG 0: 1
1: 0
2: 5
3: 62
4: 584
1141220576_1141220585 17 Left 1141220576 16:82065693-82065715 CCTGGGATTAGCTTGCCCAAACC 0: 1
1: 0
2: 0
3: 6
4: 57
Right 1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG 0: 1
1: 0
2: 5
3: 62
4: 584
1141220580_1141220585 -7 Left 1141220580 16:82065717-82065739 CCCTTCTCTGCTGACACAGATGA 0: 1
1: 0
2: 1
3: 17
4: 260
Right 1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG 0: 1
1: 0
2: 5
3: 62
4: 584
1141220578_1141220585 1 Left 1141220578 16:82065709-82065731 CCAAACCTCCCTTCTCTGCTGAC 0: 1
1: 0
2: 4
3: 38
4: 362
Right 1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG 0: 1
1: 0
2: 5
3: 62
4: 584
1141220579_1141220585 -4 Left 1141220579 16:82065714-82065736 CCTCCCTTCTCTGCTGACACAGA 0: 1
1: 0
2: 3
3: 39
4: 344
Right 1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG 0: 1
1: 0
2: 5
3: 62
4: 584
1141220577_1141220585 2 Left 1141220577 16:82065708-82065730 CCCAAACCTCCCTTCTCTGCTGA 0: 1
1: 0
2: 2
3: 25
4: 328
Right 1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG 0: 1
1: 0
2: 5
3: 62
4: 584

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141220585 Original CRISPR CAGATGAAGGAGAAGGTGGC TGG Intronic
900018183 1:169071-169093 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
900048442 1:527667-527689 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
900070668 1:769519-769541 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
900430209 1:2597806-2597828 GACAGGAAGGAGAAGATGGCAGG - Intronic
900625688 1:3607567-3607589 GTGAGGATGGAGAAGGTGGCAGG + Intronic
900806573 1:4771524-4771546 CACAGGAAGGACAAGGGGGCTGG - Intronic
900877105 1:5350629-5350651 CATTTGAAGGAGAAGGTGGAGGG + Intergenic
901144334 1:7054940-7054962 AAGATGAAGGGGAAGTAGGCTGG + Intronic
901558479 1:10050452-10050474 CAGCTGAAGGAGTAGGTGATAGG + Intronic
902179907 1:14679974-14679996 GACAAGAGGGAGAAGGTGGCTGG + Intronic
902199507 1:14823091-14823113 CAGAGGGAGGAGAACGGGGCTGG - Intronic
902619436 1:17642361-17642383 CAGATGAAGGGGAGGGAGGTAGG + Intronic
902701948 1:18178672-18178694 AAAAGGAAGGAGAAGCTGGCAGG - Intronic
902837046 1:19054086-19054108 CAGTTAAAGGGGAGGGTGGCCGG - Intergenic
903323080 1:22554085-22554107 CAGATCATGGAGAAGGAGCCAGG - Intergenic
903363561 1:22792368-22792390 CAGTTGAGGGAGAAGGAGGGGGG + Intronic
903810172 1:26030957-26030979 CAGAGGTGGGAGATGGTGGCAGG - Intronic
903959885 1:27050227-27050249 CAGATACAGGAGAAGGTGGAGGG + Intergenic
904306565 1:29593921-29593943 AAGAGGGAGGAGAAGGGGGCAGG + Intergenic
904308906 1:29612559-29612581 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
904408558 1:30311208-30311230 CAGATGAGAGTGGAGGTGGCTGG + Intergenic
904600357 1:31669505-31669527 GGGATGAGGGAGAAGGGGGCAGG - Intronic
905018155 1:34791563-34791585 CTGAGGAAAGGGAAGGTGGCAGG - Intronic
905595711 1:39204863-39204885 GAGATGGAGGAGAAGCTGCCAGG + Intronic
905906634 1:41622778-41622800 CAGGGGAAAGGGAAGGTGGCTGG + Intronic
905948370 1:41923473-41923495 CAGAGGCTGGAGGAGGTGGCGGG + Intronic
908295972 1:62713443-62713465 AAGAAGAAAGAGAAGGTGGAAGG - Intergenic
908768015 1:67571548-67571570 CAGCTGAAGGAGAAGGGGCTGGG + Intergenic
909993143 1:82247944-82247966 AAGATGATAGAGAAGGTGGGGGG + Intergenic
911337320 1:96596370-96596392 CAGAAGTAGGAGAATGTGGCTGG - Intergenic
911380366 1:97106594-97106616 CAGATGGTGGAGGAGATGGCTGG - Intronic
912144804 1:106780392-106780414 CAGATGCAGGATAAGGTGCAGGG - Intergenic
913022951 1:114805230-114805252 CTGATGCAGGAGAAGCAGGCAGG + Intergenic
913070227 1:115292005-115292027 GAGATGGAGGAGGAGGAGGCTGG - Intronic
914687067 1:149989746-149989768 AAGAAGAAGAAGAAGGTGGGGGG + Intronic
914863632 1:151407114-151407136 CAGAAAAAGGAGAAAGTGGGAGG - Intronic
915271440 1:154756476-154756498 CAGATGAAGGGGGGTGTGGCAGG - Intronic
915328395 1:155093123-155093145 CAGAAGAGGGAGGAGGTGGGAGG + Intergenic
915479154 1:156173370-156173392 GAGAGGAAGGAGGTGGTGGCTGG + Intronic
915656061 1:157361367-157361389 GAGATGAGGGTGAAGGTGGTGGG + Intergenic
915770480 1:158417122-158417144 CAATTGAAGGAGTAGGAGGCTGG + Intergenic
915826704 1:159085677-159085699 ATCATGAAGGAGAAGGGGGCAGG + Intronic
915853306 1:159351718-159351740 GAGATGAAGAGGAAGATGGCTGG - Intergenic
916014114 1:160733293-160733315 CAGATGGAGGAGGAGGTAGAAGG + Intergenic
916358716 1:163943160-163943182 CAGATGGAGGAGTAGGTGAAGGG + Intergenic
916415951 1:164592093-164592115 CAGATGAAGGGGATGGGGGTTGG + Intronic
916486313 1:165262785-165262807 CAGATAAATGAAAAGGTAGCTGG - Intronic
917243695 1:172976818-172976840 CAGGTCAAGGACAAGGTGGAGGG + Intergenic
917680792 1:177365071-177365093 GAGATGAAGGAATAGGTGGAAGG + Intergenic
917975833 1:180237089-180237111 CAGGGGAAGGAGAAGGAGGGAGG - Intronic
918038250 1:180896195-180896217 CAGATCAGGGATAAGGAGGCTGG + Intergenic
918039146 1:180901655-180901677 CAGCTGTAAGAGAAGGAGGCAGG + Intergenic
919595845 1:199561519-199561541 AAGAAGAAGGAGAAGGAGGAGGG - Intergenic
920669010 1:207988799-207988821 GAGAAGGAGGAGAAGATGGCGGG - Intergenic
920737152 1:208543149-208543171 CAGATGGTGGTGAAGGTGGTAGG + Intergenic
921131225 1:212221695-212221717 AAGACAATGGAGAAGGTGGCTGG + Intergenic
921191560 1:212713420-212713442 CAGATGGGGGAGAAAGGGGCTGG - Intergenic
921279860 1:213555853-213555875 AAGATGAAGGAAAAGGAGCCAGG - Intergenic
921377316 1:214487774-214487796 AAGATGAAAGATAAGCTGGCTGG + Intronic
922106029 1:222514934-222514956 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
922155827 1:223039103-223039125 CAGATGAAGCAGCAGGTAGTGGG + Intergenic
922239767 1:223748068-223748090 CAGATGGAGGGGAAGGTGGCAGG - Intronic
922596237 1:226815635-226815657 CAGAGGAAGGAGAAAGAGGTGGG - Intergenic
922675825 1:227548230-227548252 CATCAGAAGGAGGAGGTGGCAGG + Intergenic
922698861 1:227746245-227746267 CAGGTGTGGGAGAAGGTGGGTGG + Intronic
923566439 1:235079988-235080010 CAGAGGAAGGAGAAAATGGGAGG - Intergenic
924426210 1:243952547-243952569 CAGACGCAGGAGCAGCTGGCTGG + Intergenic
924616728 1:245618055-245618077 CAGAAGGAAGAGAAGGAGGCAGG + Intronic
924645341 1:245872429-245872451 CCGGTGAAGGAGAAGGCGGCAGG - Intronic
924680212 1:246223315-246223337 CTGATGAAGGGGATGGTGGTAGG + Intronic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063643717 10:7857419-7857441 GAGCTGGAGGAGAAGTTGGCAGG + Intronic
1063847246 10:10144336-10144358 AAGATGAAGGAGATGGTGGCTGG - Intergenic
1064448230 10:15416461-15416483 CAGATCAAGGAAAAGATGGAAGG + Intergenic
1065886644 10:30083729-30083751 CATAAGAAAGAAAAGGTGGCTGG + Intronic
1065973684 10:30824502-30824524 CAGAAGAAGGAGGAGATGGAGGG - Intronic
1066728150 10:38412399-38412421 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1067433740 10:46263331-46263353 CAGATGAAGGGAGGGGTGGCCGG + Intergenic
1068716158 10:60191029-60191051 CAGATGAAGGAGAATGAAACTGG + Intronic
1069881931 10:71598566-71598588 CAGCTGATGGGGAAGGAGGCAGG + Intronic
1070870294 10:79745369-79745391 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1071637213 10:87267589-87267611 CACAGCAAGGAGAATGTGGCAGG - Intergenic
1072841355 10:98777750-98777772 AAGAAGAAGGACAAGGAGGCAGG - Intronic
1073997148 10:109328614-109328636 GAGGTGAAGGTGAAGGTTGCAGG - Intergenic
1074572695 10:114638783-114638805 CCGATGAAGGATAAGGTATCTGG - Intronic
1074987195 10:118668939-118668961 CAGATGAGGAAGAAGGAGGGTGG + Intergenic
1075051490 10:119185626-119185648 AAGGTGAAGGGGAAGATGGCAGG + Intergenic
1075081475 10:119386816-119386838 CAGAGGAGGGAGGAGGTGGCGGG + Intronic
1075125088 10:119693080-119693102 CAGATGAGGGAGGAGAGGGCAGG - Intergenic
1076284324 10:129278126-129278148 CAGATGACGTGGAAGATGGCAGG - Intergenic
1076489709 10:130850072-130850094 AAGATGAAGGAGAAGGAGAGGGG - Intergenic
1076773029 10:132677394-132677416 CAGAGGAAGGAGAAAGTGCCGGG + Intronic
1076974786 11:164267-164289 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
1077518754 11:3018569-3018591 CACATGTATGAGAAGGTGGTTGG + Intronic
1079451853 11:20604908-20604930 CAGAAGAAGGCGGGGGTGGCAGG - Intronic
1079471302 11:20780749-20780771 AAGCTGAAGGAGAAGGAGTCAGG + Intronic
1079632157 11:22691104-22691126 CAGATGAAGGAGGGGGCGGGGGG + Intronic
1079718650 11:23782989-23783011 AAGGTGAAGGGGAAGCTGGCAGG + Intergenic
1081006898 11:37755753-37755775 CAGATGAAGGACCAGCAGGCTGG - Intergenic
1081931654 11:46875685-46875707 CAGAGGAAGGAGAGGGTGGGGGG + Intronic
1083342614 11:61968101-61968123 CAGATGATTGGGAAGGTGGAAGG + Intergenic
1084020208 11:66412813-66412835 CTGAGGCAGGAGAGGGTGGCGGG - Intergenic
1084071085 11:66735352-66735374 AAAATTAAGGAGAAGGGGGCTGG + Intergenic
1084333010 11:68440654-68440676 CAGAGGAAGCAGAAGGGGGCTGG - Intronic
1084699894 11:70779783-70779805 CAGCAGAAGGAGGGGGTGGCAGG - Intronic
1084860508 11:72014930-72014952 GAGGCAAAGGAGAAGGTGGCAGG - Exonic
1084929827 11:72546132-72546154 AAGATGAGGAAGGAGGTGGCTGG - Intergenic
1085442647 11:76578278-76578300 CAGATGAAGCGGAGGGTCGCAGG - Intergenic
1085751674 11:79167688-79167710 CAGTTGGAGGTGAAGGTGGCAGG + Intronic
1085824218 11:79826154-79826176 AAGATGAAGAGGAAAGTGGCTGG - Intergenic
1085837192 11:79969698-79969720 CAAATGAATGAGAGGGTGGAAGG + Intergenic
1086079574 11:82889397-82889419 AAGAAGAAGGAGAAGGAGGAGGG + Intronic
1086487635 11:87325546-87325568 CAGAGAATGGACAAGGTGGCAGG - Intergenic
1086644265 11:89199707-89199729 AAGATTACAGAGAAGGTGGCAGG - Intronic
1087044807 11:93836072-93836094 ATGAGGAAGGAGAAGGTGTCAGG - Intronic
1087277137 11:96171849-96171871 CTGAGAATGGAGAAGGTGGCAGG - Intronic
1087307073 11:96500597-96500619 CAGCTGAATGAGAAGGAGGAGGG - Intronic
1087940724 11:104093753-104093775 AAGGAGAAGGAGAAGGTGGGTGG - Intronic
1088976849 11:114823362-114823384 CTGAGGAAGGTGAAGCTGGCCGG - Intergenic
1089573491 11:119424874-119424896 TAGATGAATGGGAAGATGGCTGG - Intronic
1089667980 11:120032411-120032433 CTGCTGAAGGGGTAGGTGGCAGG - Intergenic
1089747617 11:120628222-120628244 CAGATGAAGGGCCAGGTGACAGG - Intronic
1090007816 11:123018351-123018373 CACTTGAAGGAGAAAGTGGTCGG - Intergenic
1090397983 11:126431776-126431798 CAGAGGAAGGAGAGCGAGGCAGG + Intronic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090521375 11:127483098-127483120 CAAGAGAAGGAAAAGGTGGCTGG + Intergenic
1090664991 11:128909016-128909038 CACATGAAGGAGCAGGAAGCAGG + Intronic
1090717686 11:129444674-129444696 GAGGTAATGGAGAAGGTGGCCGG + Intronic
1090867744 11:130716924-130716946 CAGGTGGAGGAGAAGGTGAAGGG - Exonic
1090962878 11:131572837-131572859 CTGATGAAGGAGAATGTTCCCGG + Intronic
1091117845 11:133031356-133031378 TAGATGAATGAGTAGGTGGATGG + Intronic
1091796273 12:3299076-3299098 GAGAGGAAGAAGAAGGTGGCGGG - Intergenic
1092388842 12:8057196-8057218 CAGAAAAATGAGAAGGTGGTAGG + Intergenic
1092818442 12:12331353-12331375 CAAATTAAGGAAAAGGTGGGAGG + Intronic
1092846905 12:12592037-12592059 CAGGAGAAGTAGAAAGTGGCTGG - Intergenic
1094201878 12:27803417-27803439 CTGATGGAGGAGAAGGAGGATGG + Intergenic
1094353302 12:29550467-29550489 CAGAGGAGCGAGGAGGTGGCAGG + Intronic
1095111970 12:38305574-38305596 CTGATGAAGGAGTAGGTTCCTGG - Intergenic
1095214987 12:39537920-39537942 CAGATGAATCAGAATGAGGCAGG + Intergenic
1096192750 12:49631052-49631074 CAGATGAAGGGGCAGAAGGCAGG - Intronic
1096509977 12:52122263-52122285 AAGGTGAAGGTGAAGGAGGCTGG + Intergenic
1098217502 12:68235858-68235880 GAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1098364517 12:69688730-69688752 CAGAAGAAAGAGAAGCTGGAGGG + Intronic
1098701310 12:73631187-73631209 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1099802760 12:87477555-87477577 CAGATGAAGGAGAAGGTTATAGG - Intergenic
1101621650 12:106394727-106394749 CAGATTAGTGAGAAGATGGCAGG + Intronic
1101746714 12:107547204-107547226 GAGAAGAAGGAGAAGGGGGAGGG + Intronic
1102201113 12:111058614-111058636 CAGATACAGGAGAAGCTGGAGGG + Intronic
1102591525 12:113959878-113959900 GAGAAGAAGAAAAAGGTGGCAGG - Exonic
1102606429 12:114071228-114071250 TAGAGGAAGGTGCAGGTGGCAGG - Intergenic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1103032945 12:117632520-117632542 TAGAAAAAGGAGTAGGTGGCAGG - Intronic
1103197025 12:119053137-119053159 CAAAAGAAGGAGCAGGTGTCAGG + Intronic
1103201622 12:119092653-119092675 CATATGAAGAAGACGGTGGCTGG - Intronic
1103419890 12:120771917-120771939 CATATGAAGGAGCCGGGGGCAGG - Intronic
1103583909 12:121936912-121936934 GACATGAAAGAGCAGGTGGCAGG + Intronic
1103747715 12:123137279-123137301 CAGCTCCAGGAAAAGGTGGCAGG - Intronic
1104768539 12:131345965-131345987 GAGAAGAAGGGCAAGGTGGCAGG + Intergenic
1105069429 12:133225760-133225782 CAGAAGAGGGGGAGGGTGGCAGG + Intronic
1105477091 13:20737722-20737744 CAGCTGTAGGAGAAGGTGGCAGG - Exonic
1105872189 13:24515202-24515224 AAGATGAGGGTGAAGGTGGCAGG + Intergenic
1106071942 13:26420847-26420869 CAGATCAAAGCTAAGGTGGCTGG - Intergenic
1106329239 13:28723953-28723975 CAGGCGATGGAGAAGGTGACAGG - Intergenic
1107112372 13:36711874-36711896 CAAGAGAAGGAGAAGGTTGCGGG - Intergenic
1107649125 13:42526524-42526546 CAGATCAAAGAGAAAGAGGCAGG + Intergenic
1107694494 13:42986964-42986986 GAGATGAAGGGGTAGGTGGTGGG - Intronic
1107816661 13:44250575-44250597 CAGTTCAATGAGATGGTGGCTGG + Intergenic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1112241980 13:97691220-97691242 CAGATGAAGGTGAAAATGACTGG - Intergenic
1112274712 13:98005643-98005665 CAGATGCAAGAGAAGGCAGCAGG + Intronic
1113281019 13:108787894-108787916 CAGATGATGGAGATAGTGGGAGG - Intronic
1113406520 13:110045969-110045991 GTGATGCAGGAGAAGGTGGGAGG - Intergenic
1113635227 13:111914790-111914812 GACTTGAAGGGGAAGGTGGCTGG + Intergenic
1114271406 14:21102523-21102545 TCAATGAAGGAGAAGGTGGGAGG + Intronic
1114407218 14:22468133-22468155 AACATCAAGGAGAAGGTGGCTGG + Intergenic
1114598547 14:23935006-23935028 AAGAGAAAGGAGAAGGTGCCAGG + Intergenic
1114719448 14:24864927-24864949 CAGTAGAGAGAGAAGGTGGCGGG - Intronic
1115154540 14:30323052-30323074 CAGAGGAAGGAGAGGCAGGCAGG - Intergenic
1115989637 14:39139114-39139136 AATATTAAGAAGAAGGTGGCTGG + Intergenic
1117563560 14:56970065-56970087 AAGATGAAGCAGAGGGTGACAGG + Intergenic
1117736139 14:58770710-58770732 GAGATGAAGGAGGTGGTGGGAGG - Intergenic
1118005457 14:61561296-61561318 CAAATGAGGGTGAGGGTGGCTGG - Intronic
1118389346 14:65283113-65283135 CAGATGAAGAACAGAGTGGCAGG + Intergenic
1118516334 14:66532407-66532429 CAGAGGAAGCAGAAGATGCCAGG + Intronic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1119400354 14:74358503-74358525 GAGAAGCAGGAGAAGGAGGCTGG + Exonic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1120055611 14:79920393-79920415 GAGATGCAGCAGAAGGTGTCGGG + Intergenic
1121039458 14:90733357-90733379 CAGATGAAGGAGAAGGAGCCGGG - Intronic
1121491616 14:94365148-94365170 CAGAAGGAGGAGACGGGGGCTGG + Intergenic
1122126261 14:99580166-99580188 CAGAGGAAGGAGAGGCTGGGTGG + Intronic
1122207718 14:100156537-100156559 CAGATGAAGGAGTTGGGGCCTGG - Intronic
1122388108 14:101362610-101362632 CAGGTCGGGGAGAAGGTGGCCGG - Intergenic
1122640096 14:103154788-103154810 AAGGGGAAGGGGAAGGTGGCAGG + Intergenic
1122663876 14:103315830-103315852 CAGATGAAGGAGAGGGGGCCCGG - Intergenic
1122663890 14:103315892-103315914 CAGATGAAGGAGAGGGGGCCGGG - Intergenic
1122987316 14:105218457-105218479 CAGACGAAGCTGGAGGTGGCTGG - Intronic
1123898339 15:24850701-24850723 CAGATGAGGTAGAAGGAGCCTGG + Intronic
1124518840 15:30393127-30393149 CAGTTGCAGGAGAAAGGGGCGGG + Intronic
1125538340 15:40455640-40455662 CAGAGTAAGGAGAAGGCGGCTGG - Intronic
1126183593 15:45809794-45809816 CAGATGTAGCAGAAGGTAGAAGG + Intergenic
1126841771 15:52724370-52724392 CTGATGAAGGAGAAGCTGAGAGG - Intergenic
1127314943 15:57785978-57786000 CAGGAGAAGGAGCAGGTGACGGG - Intergenic
1128732482 15:70030656-70030678 CAGAGGGAGAAGGAGGTGGCTGG - Intergenic
1129174086 15:73827406-73827428 GAGATAAAGGAGATGGTGGGAGG - Intergenic
1130226006 15:82058867-82058889 GAGAGGAAGGAGAAGGGGGAAGG - Intergenic
1130744575 15:86637428-86637450 CAGATGAAGGTGAATGAGGCCGG + Intronic
1131861089 15:96653794-96653816 CAGATGAAGGAGGTAGTGGAGGG + Intergenic
1133015647 16:2938255-2938277 TACAGGAAGGAGAAGGCGGCTGG + Exonic
1133039658 16:3053676-3053698 AGCATGAAGGAGTAGGTGGCAGG + Intronic
1133043505 16:3073309-3073331 AGCATGAAGGAGTAGGTGGCAGG + Intronic
1133128209 16:3660338-3660360 CAAATGAAAGTGAAGCTGGCTGG + Exonic
1133130074 16:3671514-3671536 CAGAAGAAGGTGGGGGTGGCTGG - Intronic
1133314018 16:4870903-4870925 AAGATGAAGAAAAAGGGGGCAGG + Exonic
1134502708 16:14781606-14781628 GAGATGAAGGAGAAGTCAGCTGG - Intronic
1135031165 16:19039817-19039839 CTGAAGAAGGAGATGGCGGCCGG + Intronic
1135033558 16:19058054-19058076 CAGGTGTAGTAGAAGGTGCCTGG - Intronic
1135190329 16:20349020-20349042 CAGACGCAGGAGAAGGAGCCTGG + Exonic
1135612341 16:23879393-23879415 CATGTCAAGGAGAAGGTGCCTGG - Intronic
1135893000 16:26374169-26374191 CAGATGAGTGAGTAGGTGGGTGG + Intergenic
1137552208 16:49445367-49445389 TGGAAGAAGGAGAAGGTGTCAGG - Intergenic
1137612804 16:49830184-49830206 CAGAAGAAGGAGAAGGAGCCAGG + Intronic
1137637440 16:49999170-49999192 AAGATGAAGGCGAAGGTTGTTGG + Intergenic
1138828629 16:60352051-60352073 AAGATGCAGGAGAAGGTAGTAGG + Intergenic
1138856214 16:60696708-60696730 CAGAGGAAGAAGAAGATGACTGG - Intergenic
1139253049 16:65515207-65515229 CAGATGAAGGCGAAGGGAGATGG + Intergenic
1139478995 16:67218078-67218100 CAGGTGTAGAAGATGGTGGCAGG - Intronic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1140501343 16:75436069-75436091 CAGAAGAGGAAGAGGGTGGCAGG - Intronic
1140723120 16:77788722-77788744 CAAATGATCGAGAAGGAGGCAGG + Exonic
1141034874 16:80618279-80618301 CAGCTGTAGGAGAACGTGGCTGG - Intronic
1141220585 16:82065733-82065755 CAGATGAAGGAGAAGGTGGCTGG + Intronic
1141760205 16:86023242-86023264 CACATGAAGGAGAAAGTCTCAGG + Intergenic
1141895494 16:86956361-86956383 CAGCTGCATGAGATGGTGGCTGG - Intergenic
1142374027 16:89697677-89697699 GAGAGGAAGGAGAAGGCGGAAGG + Exonic
1142445477 16:90133390-90133412 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1142462035 17:102080-102102 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
1142553255 17:753479-753501 GAGATGAGGAAGAAGGAGGCTGG + Intronic
1142914604 17:3125993-3126015 CACATGAAGTCTAAGGTGGCAGG + Intergenic
1143165418 17:4895048-4895070 CAGAAGGAGGAGGAGGTGGGAGG - Intronic
1143254629 17:5546520-5546542 CAGACAAAGGAGAAATTGGCGGG - Intronic
1143267414 17:5650275-5650297 AAGATGCAGGAAGAGGTGGCTGG - Intergenic
1143374468 17:6459074-6459096 CAGGTGAATGAGAAGGTGGAAGG - Intronic
1143377253 17:6474096-6474118 CAGGAGAAGGAGAGGGTGGGAGG + Intronic
1144378433 17:14668705-14668727 GAGATTAAGGAGAAAGTGGGTGG - Intergenic
1144944034 17:18960722-18960744 GAGATGAATGAGAAGATGTCAGG - Intronic
1145262420 17:21362432-21362454 CAGATAAAGGAGAAGATGGATGG + Intergenic
1145887299 17:28391384-28391406 CCCATGAAGGAGAAGATGCCAGG + Intronic
1146184898 17:30718333-30718355 GAGACGAAGGAGAAGGTGTCGGG + Intergenic
1147112958 17:38277451-38277473 CAGAGGAAGGAGAATGGGGTGGG - Intergenic
1147202835 17:38814972-38814994 AAGATGGAGGAGAAGGAGGCAGG - Exonic
1148029800 17:44611703-44611725 CGGCTGGAGGAGAAGGGGGCTGG + Intergenic
1148193642 17:45697925-45697947 GAGATGCAGGGGAAGGTGGATGG - Intergenic
1148416663 17:47511774-47511796 CAGAGGAAGGAGAATGGGGTGGG + Intergenic
1148686766 17:49505454-49505476 CAGAATAAGGAGAAGGAGGCTGG - Intronic
1149040411 17:52181832-52181854 CAGAGGAAGGGAAAGGTGGTGGG - Intergenic
1150133682 17:62682496-62682518 CAGGTGAAAGAGAAGTTGGTGGG - Intronic
1150342232 17:64377700-64377722 CAGATGAATGAGAGGGTGATGGG + Intronic
1151599576 17:75097988-75098010 CAGCTGAATGAGGAGGTGGCGGG - Intronic
1152350893 17:79783704-79783726 AAGATAAAGGAGAAGTTGGCTGG - Intronic
1152494945 17:80664471-80664493 GAGGAGAAGGAGAAGGGGGCAGG - Intronic
1152618680 17:81350007-81350029 CAGATGAAGGCTCAGGTTGCGGG + Intergenic
1152926856 17:83091298-83091320 CAAATGCAGGAGGAGGTGGGTGG + Intronic
1154307795 18:13243446-13243468 CAGATGAACGAGTGGGTGGCTGG - Intronic
1155000507 18:21681527-21681549 GAGATGGAGGGGAAGGAGGCTGG - Intronic
1155208621 18:23582370-23582392 CAGATGAAGAAAAACCTGGCTGG + Intronic
1155218314 18:23662579-23662601 GAGAGGAAGGAGGAGGCGGCGGG + Intronic
1155988604 18:32256445-32256467 GAGAGGCAGGAGAAGGTGGCTGG - Intronic
1156350312 18:36297300-36297322 CAGATGAAGGCGGCGGCGGCCGG - Intergenic
1156554719 18:38054168-38054190 TAGATGAACGTGAAGATGGCAGG + Intergenic
1156916702 18:42470446-42470468 CAAATGAAATAGAAGGTGGGAGG - Intergenic
1157125993 18:44956528-44956550 GTGATGAAGGAAAAGGTGGAGGG - Intronic
1157195878 18:45619787-45619809 CAGATGAAGTACAAGCTGGCTGG - Intronic
1157357643 18:46950071-46950093 TAGATTAGGGAGAATGTGGCTGG - Intronic
1157616402 18:48990174-48990196 TGGATGAGGGAGGAGGTGGCTGG + Intergenic
1159327420 18:66941022-66941044 TAGATCAAGGGGAAGGTTGCAGG - Intergenic
1159355491 18:67334161-67334183 CAGAAGAAGAAGAAGATGCCAGG + Intergenic
1159420330 18:68210605-68210627 GAGGTGAAGGGGAAAGTGGCAGG + Intergenic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160337678 18:78057249-78057271 CAGAAAAAGGAGAGAGTGGCTGG + Intergenic
1160651738 19:234448-234470 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
1161517376 19:4703954-4703976 TTGATGAAGGAGAAGAAGGCAGG + Exonic
1161575385 19:5051889-5051911 CAGAGGCAGGAGAGGGTGGGCGG - Intronic
1161624664 19:5319471-5319493 CAGGTGAAGGCAAAGGTGGGTGG - Intronic
1161768310 19:6218620-6218642 CAGCTGCAGGAGGAGGAGGCGGG - Intronic
1161935375 19:7368625-7368647 CAGATGCAGGAGAAAGAGGGAGG + Intronic
1162973882 19:14197363-14197385 GAGATGAGGGAGAAGGTGTTGGG - Intronic
1163516273 19:17765786-17765808 CAGCAGGAGGAGAAGGTGGAGGG + Intronic
1164168304 19:22701531-22701553 CAAATGAAGGAGAAGGAAGTAGG - Intergenic
1164406770 19:27955602-27955624 CAGATGAGGGGGAGGGTGTCCGG + Intergenic
1164536158 19:29087842-29087864 CACATGAAGGAGAAGGAGACAGG + Intergenic
1164541228 19:29122909-29122931 AAGATGATGGAGCAGGCGGCAGG - Intergenic
1164592650 19:29514642-29514664 CAGATGAAGAGGAAGGAGGGGGG + Intergenic
1164657935 19:29938339-29938361 GAGAGGAAGGAGGAGGTGCCAGG + Intronic
1164683348 19:30150529-30150551 CAGATGAAAGAAAGCGTGGCAGG + Intergenic
1164847289 19:31444228-31444250 AAGAAGAAGAAGAAGGTGGAAGG + Intergenic
1164857364 19:31535556-31535578 CAGGTGATGGGGAAGGAGGCAGG - Intergenic
1165682442 19:37789471-37789493 AAGAAGAAGAAGAAGATGGCCGG + Intronic
1165996596 19:39848331-39848353 CAGAAGCAGGAGATGGTGCCAGG - Intergenic
1166100648 19:40569685-40569707 CAGCTGCAGGAGAAAGAGGCAGG + Exonic
1166322422 19:42026862-42026884 CAGTTTAAGAACAAGGTGGCTGG - Intronic
1166820272 19:45574983-45575005 CAGGTGCAGGTGGAGGTGGCTGG - Intronic
1167083538 19:47293567-47293589 AAAATGAAGGAGGAAGTGGCTGG - Intronic
1167145072 19:47676498-47676520 CAGAAGAGGGAGAAGGAGGAAGG - Intronic
1167353726 19:48991438-48991460 CAGACGAAGGCGAAGGTGACAGG - Exonic
1167595885 19:50427931-50427953 CAGATCCAGGAGATGGAGGCCGG + Intronic
1168058474 19:53877020-53877042 GGGATGGAGGAGAAGGAGGCTGG - Intergenic
1168718788 19:58543706-58543728 CAGATGGAGAAAAATGTGGCCGG - Intergenic
925078432 2:1039989-1040011 CAGTTGAAAGAGAAGGTCTCTGG + Intronic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925260181 2:2521967-2521989 CAGATGAATAAGTAGGTGGATGG - Intergenic
925589225 2:5493498-5493520 CAAGTGAGGGAGAAGGGGGCCGG - Intergenic
925703712 2:6664221-6664243 GAGATGAAGGAGAAGGAGGAAGG + Intergenic
926059158 2:9794463-9794485 GAGATGGGGGAGAGGGTGGCAGG - Intergenic
926396686 2:12450049-12450071 AAGATGCAGGAGAAGGTAACTGG - Intergenic
926501047 2:13652805-13652827 CAGATGAGGGAGTAAATGGCAGG + Intergenic
926725054 2:15991206-15991228 AAGAAGAAGAAGAAGGTGGCCGG - Intergenic
926974253 2:18497374-18497396 AATATGTAGGAGAAGCTGGCTGG - Intergenic
927441267 2:23119673-23119695 CTTGTGAAGGAGAAGCTGGCAGG - Intergenic
927937279 2:27082967-27082989 CTGTTGGAGGAGCAGGTGGCAGG + Exonic
928115499 2:28542930-28542952 CAGTGGAAGGAGGGGGTGGCAGG - Intronic
928518203 2:32063656-32063678 CCGAGGAAGGAGAAAGGGGCGGG + Exonic
928733144 2:34256162-34256184 AAGATGAAAGAGAAAATGGCAGG - Intergenic
928930669 2:36620529-36620551 CAGAAGAAGGAGAAGCTGAAAGG - Intronic
929123762 2:38504364-38504386 CACATGAGGCAGCAGGTGGCTGG + Intergenic
930327073 2:49933427-49933449 CAGGTGAAGAGGAATGTGGCTGG - Intronic
930566950 2:53033072-53033094 CATATGATGGAGAAGGTGAAAGG - Intergenic
930989717 2:57638315-57638337 AAGATGAAGGAAAAGGAGGTAGG + Intergenic
931098979 2:58974043-58974065 CAGAGCAAGGTGAAGGTGTCTGG + Intergenic
931316834 2:61140854-61140876 CAGAGGAAGGAATAGGTGGAAGG + Intergenic
932072760 2:68637237-68637259 CAGATAGAGGAGGAGGTGGGAGG + Intergenic
933422140 2:82062223-82062245 CAGGTGAGGGAGAAGGCGGAAGG - Intergenic
933943139 2:87261961-87261983 CTGAGGAAGGAGAACGTGCCGGG - Intergenic
935462096 2:103349083-103349105 CAGATGAAGGGAAAAGTGGTTGG + Intergenic
935580590 2:104752837-104752859 CAGCTGTGGCAGAAGGTGGCCGG + Intergenic
935785534 2:106545202-106545224 CAGTGAAAGGAGACGGTGGCAGG - Intergenic
936337073 2:111599602-111599624 CTGAGGAAGGAGAACGTGCCGGG + Intergenic
936459060 2:112698077-112698099 CAGAGGACAGAGAAGGTGGTAGG - Intergenic
936674582 2:114700252-114700274 CAGGGGCAGGAGAAGGTGGAGGG - Intronic
936852084 2:116912494-116912516 CAGATGGAAGAGAAAGTGGAAGG + Intergenic
937440134 2:121908319-121908341 CAGATGCAGGTGCAGGAGGCTGG + Intergenic
937710934 2:124979147-124979169 CAGATTAGAGAGAAGGTAGCTGG + Intergenic
937777855 2:125801922-125801944 AACATAAAGGAGAAGGTGGTGGG + Intergenic
938038920 2:128059608-128059630 AAGAAGAAGAAGAATGTGGCCGG + Intergenic
938673890 2:133611271-133611293 CAGATGGAGGAGGTGGTGGCGGG - Intergenic
938899432 2:135787405-135787427 CAGACGAAGGAGAATCTGCCTGG + Intergenic
939059825 2:137408315-137408337 AAGATAAAGGAGAAGGGGGAAGG - Intronic
942207728 2:173638192-173638214 AAGAAGAAGGAGGAGGAGGCAGG + Intergenic
942636256 2:178009598-178009620 TGGATGAAGGAAAAGGTGGCAGG + Intronic
942648641 2:178143735-178143757 CTGATGCAGGAGATAGTGGCAGG + Intergenic
942802646 2:179893172-179893194 CAGAAGAAGCAGAAGCTGCCAGG + Intergenic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945155438 2:206832850-206832872 TAAATGAAGGAGAAGGAGGAAGG - Intergenic
945314733 2:208359822-208359844 CAGGGGAAGGCGAGGGTGGCTGG + Intronic
946071492 2:217037955-217037977 AAGATAAAGGAGAAAGTGGGTGG - Intergenic
946169828 2:217888288-217888310 CAGATGGAGGAGAGGAGGGCAGG - Intronic
946189923 2:218002755-218002777 CAGCAAAAGGATAAGGTGGCAGG + Intronic
946247661 2:218396700-218396722 CAGCTGAAGGAGGAGATGGATGG + Exonic
947060978 2:226164751-226164773 CAGATTCAAGTGAAGGTGGCAGG - Intergenic
948542051 2:238697992-238698014 CAGATGATGGAGGAGGTGAGTGG - Intergenic
948684126 2:239659444-239659466 CAGAGGAAGGGGAAGGTGTGAGG - Intergenic
948695314 2:239730174-239730196 AAGCTGATGGAGAAGGTGGGTGG + Intergenic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
948756536 2:240162818-240162840 CAGCTGGAGGAGAAGGCAGCTGG - Intergenic
948880631 2:240855588-240855610 CAGATGATGAAGAAGATGCCCGG - Intergenic
948897550 2:240934347-240934369 CAGCTGGAGGAGAAGGTCTCCGG + Intronic
1168838195 20:891693-891715 GAGATGAAGGAGGAAGTGGCTGG - Intronic
1169189182 20:3646517-3646539 CAGATGGAGGGGAAGGCGGAGGG + Intronic
1169852938 20:10072604-10072626 CTGATGGAGGAGAAGGTTTCAGG + Intergenic
1170248332 20:14249416-14249438 AAAACCAAGGAGAAGGTGGCAGG + Intronic
1170435019 20:16317777-16317799 CAGGTGAGGGTGAGGGTGGCAGG - Intronic
1170672980 20:18452222-18452244 GAGATGAGTGAGAAGGTGGCTGG - Intronic
1170711898 20:18798693-18798715 GAGATGCTGGAGGAGGTGGCAGG - Intergenic
1170770530 20:19328618-19328640 CAGTTGTAGGAGAAGGTGAGGGG + Intronic
1172301952 20:33856640-33856662 CAGGTGAAGGAAAAGCTGGCGGG - Intergenic
1172365242 20:34344052-34344074 AAAAAGAAGAAGAAGGTGGCAGG - Intergenic
1172589246 20:36105891-36105913 CAGAATAGGGAAAAGGTGGCAGG - Intronic
1172623937 20:36336847-36336869 CCCAGGAAGGAGAAGGGGGCTGG - Intronic
1172772761 20:37391252-37391274 CAGATGAAAGAGGAGGCTGCAGG - Intronic
1172849113 20:37947811-37947833 CAAAAGAAGAAGAAGGTGCCTGG + Intergenic
1172977614 20:38918625-38918647 GAGATGGAGGAGAAGGTGCATGG + Exonic
1173159173 20:40639606-40639628 CAGATGAATGAGATGGTAGATGG - Intergenic
1173827898 20:46058852-46058874 CAGAGCACGGAGAAGGCGGCTGG - Intronic
1173964087 20:47098686-47098708 GAGTTGGAGGTGAAGGTGGCTGG - Intronic
1174211100 20:48878632-48878654 CAGAAAAAGGGGAATGTGGCCGG - Intergenic
1174287526 20:49483465-49483487 GAGAAGGAGGAGAAGGGGGCGGG - Intergenic
1175081557 20:56424878-56424900 TAGATGAGGGAGGAGGTGGCTGG + Intronic
1175094024 20:56527674-56527696 CAGAAGCAGGAGAGGGAGGCAGG + Intergenic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175779448 20:61672955-61672977 TAGAAGAAGAAGAAGGAGGCAGG + Intronic
1175912706 20:62412445-62412467 CAGAGGAGGGCGAGGGTGGCCGG - Intronic
1175968492 20:62671993-62672015 CAGGTTAAGTAGAAGGTTGCAGG - Exonic
1176049494 20:63110194-63110216 AAGATGAAGGAGGAGCAGGCAGG + Intergenic
1176177548 20:63735800-63735822 CAGCTGCAGGAGAAGCTGGCAGG + Exonic
1177583135 21:23053781-23053803 CAGAGGTTGGAAAAGGTGGCAGG - Intergenic
1178457855 21:32772203-32772225 CAGATGAGGGAGGAGGAGGAGGG + Intergenic
1178920643 21:36736089-36736111 CAGATGGAAGGGAAGCTGGCAGG - Intronic
1179421472 21:41240111-41240133 CATAGGAAGCAGAATGTGGCTGG + Intronic
1179969514 21:44826424-44826446 TAGATGGAGGAGAAGGAGACAGG + Intergenic
1180608020 22:17075811-17075833 ACGATGATGGAGAAGCTGGCTGG + Intergenic
1180960731 22:19761174-19761196 AAGAAGAACGCGAAGGTGGCCGG + Exonic
1182361049 22:29746721-29746743 AAGATGAAGCAGCAGGTGACAGG - Intronic
1184075314 22:42173375-42173397 CAGGTGGGGGGGAAGGTGGCAGG + Intronic
1184305577 22:43599033-43599055 CAAATGTAGGAGCAGGTGCCTGG - Intronic
1184750196 22:46481417-46481439 CAGTTGAAGCAGAAGCTGGAAGG - Intronic
1185045251 22:48525443-48525465 CAGAAGGCGGAGCAGGTGGCAGG - Intronic
1185273796 22:49941259-49941281 CAGAAGAAGGAGAGGGTGCTGGG + Intergenic
1185336163 22:50271734-50271756 CAGCTAAAGGAGGAGGAGGCCGG + Intergenic
949360914 3:3231291-3231313 AAGGTGAAGCAGAAGCTGGCAGG + Intergenic
949929110 3:9064388-9064410 AAGATGAAGGAGAAGGTGAGTGG - Exonic
950580028 3:13855987-13856009 AAGGTGAATGAGAAGGTGGGTGG - Intronic
951829915 3:26915024-26915046 AATGTGATGGAGAAGGTGGCAGG + Intergenic
952412856 3:33064935-33064957 TAGAAGAAGGAGAATGGGGCAGG + Intronic
952419390 3:33117758-33117780 CAGATTTTGGAGAAGGTGGTAGG - Intronic
952484217 3:33793278-33793300 CAGAATAAGGAGAGGGTGGAGGG - Intergenic
953929047 3:46996898-46996920 CAGAGGGAGGAGGGGGTGGCAGG - Intronic
954424108 3:50434356-50434378 AAGTTGGTGGAGAAGGTGGCAGG - Exonic
954788836 3:53115537-53115559 GAGAGAAAGGAAAAGGTGGCGGG - Intronic
955500950 3:59582314-59582336 CAGATGGAGGAGAAGGGGTGAGG - Intergenic
956139990 3:66137117-66137139 CACATGGTGGAAAAGGTGGCAGG - Intronic
956907039 3:73777231-73777253 CAGATTATGCAGAAGGTGGTTGG + Intergenic
957523037 3:81345564-81345586 CAGAATAAGGGGAAGGTGGATGG + Intergenic
957637691 3:82807952-82807974 CAGGCGATGGAGGAGGTGGCAGG - Intergenic
959650119 3:108743357-108743379 CAAATTAAAGAGAAGGTGGCAGG - Intergenic
960463169 3:117961877-117961899 CAGATGAAGGTGATGGTGGCAGG - Intergenic
960615130 3:119589481-119589503 GGGATGAACTAGAAGGTGGCAGG - Exonic
960720312 3:120618883-120618905 TAGAGGAAGGTGCAGGTGGCGGG + Intergenic
960734758 3:120766579-120766601 AAGATGAAGGAGAAGATGAAGGG - Intronic
960864563 3:122185837-122185859 AAGATGTAGGAGAAGTTGGAGGG + Intronic
961861652 3:129921202-129921224 CAGAACAAGGAGAAGACGGCTGG + Intergenic
962509264 3:136082605-136082627 CAGATGTAGGAGAAGGAGTTTGG + Intronic
963707003 3:148699478-148699500 GAGAGGAAGGAGAAGGTACCAGG - Intronic
963806067 3:149724282-149724304 CAGGTGAAGGAGCAGGTAGTTGG - Intronic
964689803 3:159437587-159437609 CGGAGGAAGGAGACGGTGGAGGG + Intronic
965076004 3:163977303-163977325 TAAAAGAAGGAGAAGGGGGCTGG - Intergenic
966516636 3:180828248-180828270 TACAGGAAGGAGAAGGCGGCCGG - Intronic
967079667 3:186037825-186037847 CTGATGAAAGAGAAGGAGGTGGG - Intergenic
967121328 3:186385252-186385274 GAGATGAAGGAGGAGGTGCAAGG + Intergenic
968076318 3:195817564-195817586 CTGCTTAAGGAGAAGGAGGCCGG - Intergenic
968268680 3:197382671-197382693 CACATCAAGGAGAAGATGGAAGG - Intergenic
968366093 3:198185520-198185542 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
968568511 4:1327396-1327418 CAGCTGCAGGAGCAGGGGGCGGG + Intronic
968981364 4:3851543-3851565 GAGAGGAAGGAGAAGATGTCTGG + Intergenic
969091852 4:4700204-4700226 CAGGTAGAGGAGATGGTGGCTGG + Intergenic
969401305 4:6957422-6957444 CAGATGGAGGTGAAAGTTGCTGG + Intronic
969501124 4:7553808-7553830 GAGAGGAAGGTGAAGGTGGGAGG + Intronic
969506454 4:7591184-7591206 GAGAAGAAGGAGAAGGTGGGAGG - Intronic
970209541 4:13694533-13694555 CAGATGATGTAGAATGTGCCAGG - Intergenic
970852535 4:20618170-20618192 CAGACAAAGGAGAAGGAGGAAGG - Intronic
971001951 4:22333150-22333172 AAGGTGAAGGAGAAGCAGGCAGG - Intergenic
971919800 4:32923107-32923129 AAGACAAAGGAGCAGGTGGCTGG - Intergenic
972374808 4:38460299-38460321 CAGAGGAAGAAGTAGGTGGCTGG - Intergenic
972569026 4:40294236-40294258 AAGATGGAGGTGAAGGTGGAGGG - Intergenic
972785033 4:42318725-42318747 TAGAGGAAGGTGCAGGTGGCAGG - Intergenic
972796094 4:42421189-42421211 TAGATGAAGAAAAAGGTGGAGGG + Intronic
975077855 4:70235297-70235319 CTGAAGAAGGAAGAGGTGGCAGG + Intergenic
975086848 4:70352061-70352083 CAGATGATGGACAATGTGGGTGG - Intergenic
975448023 4:74490459-74490481 AAGATGAGGCTGAAGGTGGCTGG - Intergenic
976163125 4:82225054-82225076 CAGATGAAGGAGCAGTGGTCTGG - Intergenic
976464329 4:85350604-85350626 CACATGTAGGAGAAGGTAACTGG - Intergenic
977252626 4:94705604-94705626 TGGCTGAAGGAGAAGGTGCCAGG + Intergenic
977438640 4:97034726-97034748 TAGATGAGGGAGAAGATAGCAGG - Intergenic
979150275 4:117304485-117304507 CAGGTGAAAGAGAAGGTGAAAGG + Intergenic
979333826 4:119445334-119445356 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
979800639 4:124904383-124904405 CACATCAAGAAGATGGTGGCAGG - Intergenic
981995645 4:150971463-150971485 TTGAGGAAAGAGAAGGTGGCTGG - Intronic
982134390 4:152259437-152259459 CAGAGGAAGGAGAGGGGTGCAGG - Intergenic
982465159 4:155721460-155721482 CAGAGGAAGCAGAAAGTGGAAGG - Intronic
982663961 4:158238318-158238340 CAGATAAAGGAGAATTTGGAGGG + Intronic
984626783 4:182016159-182016181 CAGATGACTGAGATGGTGTCTGG + Intergenic
984632567 4:182076187-182076209 AAGAAGAAGGAGAAAGAGGCTGG - Intergenic
985313815 4:188632558-188632580 AAGAAGAAGGGGAGGGTGGCCGG + Intergenic
987109559 5:14672512-14672534 CACAGGAAGGAGGAGGTGCCAGG - Intronic
987231319 5:15896595-15896617 CAGAGGAAGGAGGAACTGGCAGG - Intronic
987468881 5:18306390-18306412 CAGCTGAAGGAGACAGTGGCAGG - Intergenic
989512697 5:42306533-42306555 CAGACAAAGGAGAAGTTGGAAGG + Intergenic
989668718 5:43888658-43888680 CATATGAGGGAGAAGGTGTGAGG - Intergenic
989705323 5:44322914-44322936 CCGGTGAAGGAGATGGTGTCAGG - Intronic
990170863 5:53048183-53048205 GAAGTGATGGAGAAGGTGGCAGG - Intronic
991601344 5:68354459-68354481 CAGAGGGATGTGAAGGTGGCGGG - Intergenic
991942924 5:71871670-71871692 CAGATGAAGAAGAAAGTGGTTGG + Intergenic
991944726 5:71888998-71889020 CAGATGAAAGAGGAGGTGTGAGG + Intergenic
992167314 5:74067472-74067494 CAGGTGAAGGACAGGGTGACAGG - Intergenic
992639177 5:78753641-78753663 CACATGAATTTGAAGGTGGCAGG + Intronic
997299176 5:132789857-132789879 CAGCTGAATGTGAAGGGGGCTGG - Intronic
997434282 5:133863073-133863095 CAGAAATAGGGGAAGGTGGCAGG - Intergenic
997614158 5:135235307-135235329 GAGATGAAGGAAAAGTTAGCTGG + Intronic
998552442 5:143090517-143090539 TAGAGGAAGGTGCAGGTGGCGGG + Intronic
1000292764 5:159886289-159886311 GAAATGAAGAAGAAGGTGGAAGG - Intergenic
1000334020 5:160228673-160228695 CACCTGGAGGAGAAGGTGCCAGG - Intronic
1001104712 5:168843282-168843304 CAGGTGAAGAGGAAGGTGGAGGG + Intronic
1001633540 5:173194063-173194085 CAGATGAAGCACAATGTGGATGG - Intergenic
1002167249 5:177355853-177355875 CAGCTGAAGGAGAAAGAGGGAGG + Intergenic
1002721296 5:181262621-181262643 CAGAGGATGGAGATGGGGGCTGG + Intergenic
1002725319 5:181290745-181290767 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1003501580 6:6707555-6707577 CAGATGAAAGAGAACTTGGCTGG - Intergenic
1003509929 6:6771287-6771309 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509940 6:6771330-6771352 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003509951 6:6771373-6771395 AAGAAGAAGGAGAAGGAGGAAGG + Intergenic
1003567914 6:7236163-7236185 CAGGTGGAGGAGAGGGTGCCAGG + Intronic
1003692905 6:8372344-8372366 CAGATGATGGAGCAGGTCTCAGG - Intergenic
1004353575 6:14912201-14912223 GAGATGAAGGGGATGGTAGCTGG - Intergenic
1004354795 6:14921562-14921584 CAAATGAGGGAGAAGGGGGAAGG + Intergenic
1004389480 6:15198059-15198081 CAGAAGAAGGAGAAGGGGCATGG + Intergenic
1005429151 6:25736096-25736118 CTGTTGAAAGAGAAGGTGGTGGG + Intergenic
1006191662 6:32213195-32213217 CAGAGGCAGGAGAAGGTGCCAGG + Exonic
1006865120 6:37203237-37203259 CAGAAGTTGGAGAAGGTGGATGG + Intergenic
1007577115 6:42932390-42932412 CAGAGGAAGGAGAACCTGCCCGG + Intronic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1009992403 6:70860197-70860219 CAGATGAATCAGCAGATGGCTGG + Exonic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1011110009 6:83827440-83827462 CATAGGAAGGAGAAGCTGCCAGG + Intergenic
1011666436 6:89638975-89638997 CAAATGAAAGTGAAGGAGGCCGG + Intergenic
1012305101 6:97645939-97645961 AAGGTGAAGGAGAAAGTGTCAGG + Intergenic
1012448283 6:99328636-99328658 CAGATGAAGGGGCTGGTGGTCGG - Intronic
1012816503 6:104028546-104028568 TAGTTTTAGGAGAAGGTGGCAGG - Intergenic
1012986675 6:105883550-105883572 CAGATGCAGCTGAAGGTGCCGGG + Intergenic
1013437570 6:110126831-110126853 CAGATTAGGGAGAAGGAGACAGG - Intronic
1013932931 6:115556627-115556649 GAGATGAAGGAGCATGTGCCAGG - Intergenic
1015483642 6:133743771-133743793 AAGATGGAGGAGAACCTGGCAGG + Intergenic
1015854662 6:137610571-137610593 AAGATAAAGGAGAAAGTGTCAGG + Intergenic
1015978542 6:138815913-138815935 CAGATGCAGGAGTAGCTGACAGG - Intronic
1016811258 6:148263217-148263239 CCGAAGAAGCAGAAGGTGGCAGG + Intergenic
1016891693 6:149014105-149014127 CAGAGTGAGGAGAAGGAGGCAGG + Intronic
1017274557 6:152551079-152551101 TAGAGGAAGGAAAAGGTGTCAGG - Intronic
1017429197 6:154354287-154354309 CAGATGGCGGAGATGGTGGTTGG - Intronic
1017551725 6:155516930-155516952 CAAATGAGGGAGAAGGTGGGTGG + Intergenic
1018222347 6:161593600-161593622 CAGACAAAGGAAAAGGAGGCAGG + Intronic
1019133033 6:169891154-169891176 AAGATGAAGGACAAGGAGGGTGG + Intergenic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1019936431 7:4261272-4261294 CAGATGAGGGAGCAGCTGGCAGG + Intronic
1020354311 7:7260203-7260225 GTGATGATGGAGAAGGGGGCCGG - Intergenic
1021626291 7:22596039-22596061 AAGAGGAAGGAGCAGCTGGCAGG + Intronic
1021647706 7:22802545-22802567 CAGGGGGAGGAGAAGGGGGCTGG - Intergenic
1022607618 7:31831746-31831768 GAGATGATGGAGAAGATGGAGGG + Intronic
1022800969 7:33776941-33776963 CAGATGAAGCAGATGGTGCCAGG + Intergenic
1022959708 7:35414832-35414854 CAGTTGAATGAGAAAGTGGATGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023344599 7:39258716-39258738 AAGAAGAAGAAGAAGGTGGTAGG + Intronic
1023768504 7:43533683-43533705 CAGATGCAGGAACATGTGGCAGG - Intronic
1023915638 7:44586811-44586833 CAAATGAAGGACGGGGTGGCTGG - Intergenic
1024070225 7:45778358-45778380 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1024919304 7:54541706-54541728 AAGATGAAGGAAAAGAAGGCAGG + Intergenic
1024930380 7:54662767-54662789 GAAATGTAAGAGAAGGTGGCTGG + Intergenic
1025099208 7:56121586-56121608 CAGGTGATGGAGAGGGTGGGAGG + Intergenic
1025107026 7:56179830-56179852 CTGAGGCAGGAGAAAGTGGCAGG + Intergenic
1025248653 7:57337085-57337107 CAGATGAAAGTGCAGGTGGGTGG - Intergenic
1026989504 7:74575726-74575748 AAGATGCAGGAGAAGCTGGTGGG + Intronic
1027882216 7:83855132-83855154 AAGAAGAAGGAGAAAGAGGCAGG + Intergenic
1028536696 7:91896130-91896152 CAAGTGATGGAGAAGGTGGGAGG + Intergenic
1028556816 7:92134279-92134301 CAGGCGATGGAGAAGGTGACAGG - Exonic
1029549672 7:101231046-101231068 GAGATGAAGGAGAAAGGGGAGGG + Intergenic
1029554002 7:101255060-101255082 AAGAAGAAGGAGAAGCTGGCTGG + Intergenic
1030152862 7:106424121-106424143 CAGGTGAGGAAGAAGGTAGCAGG - Intergenic
1032047627 7:128622650-128622672 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1032131814 7:129235403-129235425 AAGAAGAATGAGAAGGAGGCTGG - Intronic
1032738494 7:134714366-134714388 CAGAGGAAGGACAAGTCGGCTGG - Intergenic
1032905486 7:136359763-136359785 CAGGTGAGGGAGCAGGTGGTTGG + Intergenic
1032962040 7:137046859-137046881 CAGAAGAAGGAGGAGGGGGAAGG + Intergenic
1034248609 7:149670048-149670070 CAGAAGAAGGAGGAGGAGGAGGG - Intergenic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034496976 7:151428886-151428908 CAGATTAGGGAGCAGGGGGCTGG + Intronic
1035797943 8:2376470-2376492 CTGGTGAAGGGGAAGCTGGCAGG + Intergenic
1036180365 8:6579293-6579315 CAAATGGAGGAGAAGGGGACCGG - Intronic
1036295957 8:7537433-7537455 CAGAGGAAGGAGTATGTGGCCGG + Intergenic
1036326609 8:7783586-7783608 CAGAGGAAGGAGTATGTGGCCGG - Intergenic
1037173182 8:15918045-15918067 AAGATGTAGGAGAAAGTGGCCGG + Intergenic
1037737902 8:21581649-21581671 CAGGTGGAGGAGACGGAGGCTGG + Intergenic
1037880264 8:22570210-22570232 CAGAGGGGGAAGAAGGTGGCTGG + Intronic
1038906693 8:31912380-31912402 CAGATGTAAGTGCAGGTGGCTGG + Intronic
1039106434 8:33994973-33994995 CAGATGAAAGACAATGTAGCTGG + Intergenic
1039184306 8:34899702-34899724 AAGGTTGAGGAGAAGGTGGCTGG - Intergenic
1039553592 8:38460806-38460828 GAGGTGAAGCAGGAGGTGGCAGG - Intronic
1039888395 8:41668573-41668595 CAGAAGAAGCAGCAGATGGCCGG + Intronic
1041154395 8:54970132-54970154 AAGATGAAGGTGAAATTGGCAGG - Intergenic
1041380190 8:57246674-57246696 CAGTTGAAGGTGAAGGAGGTGGG + Intergenic
1041840134 8:62259870-62259892 GAGACGAAGGTGAAGGTGGGTGG + Intronic
1042130474 8:65582718-65582740 GAGGAGAAGGAGAAGGAGGCAGG + Intergenic
1042391541 8:68241330-68241352 CAGATTAGGGAGAAGGAGACAGG + Intergenic
1042574061 8:70198707-70198729 GAGGTAAAAGAGAAGGTGGCTGG + Intronic
1042848038 8:73187778-73187800 CAGATGTCAGAGCAGGTGGCAGG + Intergenic
1043364016 8:79510485-79510507 CAGATCCAAGAGATGGTGGCTGG + Intergenic
1044532726 8:93326122-93326144 GAGAAGACCGAGAAGGTGGCAGG - Intergenic
1045239473 8:100386525-100386547 CAGATGAAGGCAAGGGTCGCAGG - Intronic
1046015600 8:108601126-108601148 AAGAAGAAGGAGAAGGAGGAGGG + Intergenic
1047345132 8:124020424-124020446 AAGATGAAGCAGACAGTGGCAGG + Intronic
1047526302 8:125637313-125637335 CATATGAAAGGCAAGGTGGCAGG + Intergenic
1047526365 8:125637756-125637778 CAGCTGAAGGAGGGGGTGGTGGG + Intergenic
1048175532 8:132149190-132149212 CAGATGAGGGGGAAGGTCCCAGG + Intronic
1048410643 8:134168841-134168863 CAGTTGAAGGATAAGGAGGGTGG + Intergenic
1049199515 8:141333215-141333237 CAGGTGAAGGAGGAGATGGGTGG + Intergenic
1049339587 8:142104976-142104998 CAGCTGAAGTAGCAGGTGACAGG + Intergenic
1051187901 9:14479974-14479996 AGGAAGAAGGAGAAGGAGGCAGG + Intergenic
1051729051 9:20120048-20120070 CAAATGAAGGAAAATGTGGGTGG - Intergenic
1051997208 9:23232502-23232524 AATATGTAGGAGTAGGTGGCTGG - Intergenic
1052142414 9:25003854-25003876 CAGCTGAGGCAGAGGGTGGCGGG + Intergenic
1052755491 9:32536821-32536843 CAGGTGAAGCTGAAGGTGACTGG - Intergenic
1053042343 9:34885367-34885389 CATCAGAAGGAGGAGGTGGCAGG - Intergenic
1053158975 9:35800481-35800503 CAGGTGATGGAGGAGGAGGCAGG + Exonic
1053310987 9:37019568-37019590 CAGATGAAAGGGAAGGAGCCAGG + Intronic
1054331594 9:63762402-63762424 CAGATAGTGAAGAAGGTGGCAGG + Intergenic
1054754872 9:68947417-68947439 GAGTTGGATGAGAAGGTGGCAGG - Intronic
1054810765 9:69432300-69432322 CAGATGAAAGAGAAGGCTGAGGG + Intronic
1054892117 9:70261993-70262015 GAGAAGAAAGAGAAGGTAGCTGG + Intronic
1055298150 9:74854572-74854594 GAGAAGAAGGAGGAGGTTGCTGG - Intronic
1055862182 9:80764977-80764999 CAGGTTAAGGAGTAGGTAGCAGG - Intergenic
1056126279 9:83538573-83538595 CAGCTGAAGGAGGAGGCGGAGGG + Intergenic
1056328037 9:85497246-85497268 AAGAGGAAGGAGAAGGAGGAAGG + Intergenic
1057132787 9:92666344-92666366 AAGCTGAAGGCGAAGGAGGCAGG + Intronic
1057473549 9:95379832-95379854 CAAATGAGAGAAAAGGTGGCAGG - Intergenic
1057555069 9:96081575-96081597 GAGAGGAAGGATAAGGGGGCAGG - Intergenic
1057557914 9:96102325-96102347 CAGAAGGAGAAGAAGGAGGCCGG + Intergenic
1058005053 9:99905971-99905993 CACATGAACAAGCAGGTGGCCGG - Intergenic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059667884 9:116466345-116466367 CAGAGATAAGAGAAGGTGGCTGG - Intronic
1059733061 9:117075482-117075504 CAGATGGAGGGGAAGGGGGAGGG + Intronic
1060625852 9:125110651-125110673 AAGGTGAAGGAGAAGCAGGCAGG - Intronic
1061744177 9:132727723-132727745 CAGATGAAGGAGGCGGTTGGGGG - Intronic
1061867165 9:133498839-133498861 CTGATGAAAGACAAGGTGGGAGG + Intergenic
1062114509 9:134800904-134800926 ACGCTGGAGGAGAAGGTGGCTGG - Intronic
1062750462 9:138248387-138248409 CAGGTGATGGAGAGGGTGGGAGG - Intergenic
1186459946 X:9740034-9740056 CAGGAGAAGGAGAAAGTGGGAGG + Intronic
1186646893 X:11516846-11516868 GAGATGACAGAGAAGGAGGCTGG - Intronic
1187072872 X:15905660-15905682 CAGATAAAGGAGAAAAAGGCTGG - Intergenic
1189217678 X:39341012-39341034 AAGAAGAGGGAGAAGGTGTCAGG + Intergenic
1189451356 X:41134800-41134822 CAGATGAAGCAGTGAGTGGCTGG + Exonic
1189578490 X:42381143-42381165 GAAATGAAGGAGAAGGAAGCAGG + Intergenic
1189588692 X:42488823-42488845 CAAATGAAGGAAAAGATGGCTGG - Intergenic
1189650840 X:43187938-43187960 AAGAAGAAGTAGAAGGGGGCAGG + Intergenic
1190311800 X:49122272-49122294 CAGGAGAAGGGGCAGGTGGCGGG + Intronic
1190719995 X:53139836-53139858 CAAAAGAAGGAGGAGGAGGCAGG + Intergenic
1190817457 X:53940614-53940636 CAGGTAAGGGAGAGGGTGGCAGG - Intronic
1191667044 X:63714234-63714256 CTGAAGAAGGAGTAGGGGGCAGG - Intronic
1192486713 X:71533730-71533752 GAGATGAAGGAGGAGATGGAGGG - Intronic
1193066523 X:77265791-77265813 CAGGAGAAGGAGAAGGTGAAGGG - Intergenic
1197645152 X:129009495-129009517 CAGATTTAGGAGAAGGGGACTGG - Intergenic
1197656545 X:129122804-129122826 CAGTTGAAGGAAAAAGTGCCAGG - Intergenic
1198281764 X:135149629-135149651 CAGATGAAGGAGGAAGTGCTTGG - Intergenic
1198289195 X:135222893-135222915 CAGATGAAGGAGGAAGTGCTTGG + Intergenic
1198818753 X:140622402-140622424 AAGATGAAGGTGAGTGTGGCTGG + Intergenic
1198863896 X:141099880-141099902 CAAATGAGGGGGTAGGTGGCAGG + Intergenic
1198898792 X:141487535-141487557 CAAATGAGGGGGTAGGTGGCAGG - Intergenic
1199278666 X:145974564-145974586 TAGAGGAAGGTGGAGGTGGCGGG - Intergenic
1200003465 X:153073411-153073433 CAGATGGTGGAGAGCGTGGCCGG + Exonic
1200004258 X:153076598-153076620 CAGATGGTGGAGAGCGTGGCCGG - Intergenic
1200085103 X:153600169-153600191 CTGAGGAAGGAGAATGAGGCCGG - Intergenic
1200112107 X:153745639-153745661 CAGGGGAAGGAAAATGTGGCGGG + Intergenic
1200379708 X:155822197-155822219 CAGAAGAAGGAGAAGGAGAAGGG + Intergenic
1200686456 Y:6263948-6263970 CAGATCAAGGAGAAAGAGGATGG + Intergenic
1201546993 Y:15176264-15176286 GAGAGGAAGCAGTAGGTGGCTGG - Intergenic