ID: 1141241246

View in Genome Browser
Species Human (GRCh38)
Location 16:82266984-82267006
Sequence ACATTTAAGCAACTGCTGGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141241246_1141241252 -10 Left 1141241246 16:82266984-82267006 CCCCCCAGCAGTTGCTTAAATGT No data
Right 1141241252 16:82266997-82267019 GCTTAAATGTGGTACCCTGATGG No data
1141241246_1141241257 18 Left 1141241246 16:82266984-82267006 CCCCCCAGCAGTTGCTTAAATGT No data
Right 1141241257 16:82267025-82267047 AAAGCAATTGATTAGACTTGAGG No data
1141241246_1141241253 -9 Left 1141241246 16:82266984-82267006 CCCCCCAGCAGTTGCTTAAATGT No data
Right 1141241253 16:82266998-82267020 CTTAAATGTGGTACCCTGATGGG No data
1141241246_1141241254 -5 Left 1141241246 16:82266984-82267006 CCCCCCAGCAGTTGCTTAAATGT No data
Right 1141241254 16:82267002-82267024 AATGTGGTACCCTGATGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141241246 Original CRISPR ACATTTAAGCAACTGCTGGG GGG (reversed) Intergenic
No off target data available for this crispr