ID: 1141244391

View in Genome Browser
Species Human (GRCh38)
Location 16:82292704-82292726
Sequence GTTCCCTCCATTCTCAGAAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141244391_1141244398 27 Left 1141244391 16:82292704-82292726 CCAGTTCTGAGAATGGAGGGAAC No data
Right 1141244398 16:82292754-82292776 CAGCCAAGGTCCGACCTTGCAGG No data
1141244391_1141244396 13 Left 1141244391 16:82292704-82292726 CCAGTTCTGAGAATGGAGGGAAC No data
Right 1141244396 16:82292740-82292762 AAGTATCCAGGTGTCAGCCAAGG No data
1141244391_1141244394 1 Left 1141244391 16:82292704-82292726 CCAGTTCTGAGAATGGAGGGAAC No data
Right 1141244394 16:82292728-82292750 CTCTCCAAATCAAAGTATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141244391 Original CRISPR GTTCCCTCCATTCTCAGAAC TGG (reversed) Intergenic
No off target data available for this crispr