ID: 1141248070

View in Genome Browser
Species Human (GRCh38)
Location 16:82329334-82329356
Sequence CTGCTATGTTTGAGGGAAAG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141248067_1141248070 -4 Left 1141248067 16:82329315-82329337 CCTCAGCAGGACACATTTTCTGC No data
Right 1141248070 16:82329334-82329356 CTGCTATGTTTGAGGGAAAGTGG No data
1141248066_1141248070 -3 Left 1141248066 16:82329314-82329336 CCCTCAGCAGGACACATTTTCTG No data
Right 1141248070 16:82329334-82329356 CTGCTATGTTTGAGGGAAAGTGG No data
1141248062_1141248070 27 Left 1141248062 16:82329284-82329306 CCACTGCAGAACCATAGGCTGGG No data
Right 1141248070 16:82329334-82329356 CTGCTATGTTTGAGGGAAAGTGG No data
1141248064_1141248070 16 Left 1141248064 16:82329295-82329317 CCATAGGCTGGGTCTGATGCCCT No data
Right 1141248070 16:82329334-82329356 CTGCTATGTTTGAGGGAAAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141248070 Original CRISPR CTGCTATGTTTGAGGGAAAG TGG Intergenic
No off target data available for this crispr