ID: 1141249239

View in Genome Browser
Species Human (GRCh38)
Location 16:82339722-82339744
Sequence AAACTGGGGCTTTCAGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141249231_1141249239 24 Left 1141249231 16:82339675-82339697 CCTTTGAGGTACGTGGCTGAGTA No data
Right 1141249239 16:82339722-82339744 AAACTGGGGCTTTCAGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141249239 Original CRISPR AAACTGGGGCTTTCAGAGGA AGG Intergenic
No off target data available for this crispr