ID: 1141250948

View in Genome Browser
Species Human (GRCh38)
Location 16:82358602-82358624
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141250945_1141250948 -3 Left 1141250945 16:82358582-82358604 CCACTGAAGCAAAATGCTTGGCT No data
Right 1141250948 16:82358602-82358624 GCTACTTTGAAGATGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141250948 Original CRISPR GCTACTTTGAAGATGGAGGA AGG Intergenic
No off target data available for this crispr