ID: 1141255905

View in Genome Browser
Species Human (GRCh38)
Location 16:82402098-82402120
Sequence CATTTTGCCCTGAGGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141255896_1141255905 17 Left 1141255896 16:82402058-82402080 CCGGCAAGGTAACAGGGCAGGTC No data
Right 1141255905 16:82402098-82402120 CATTTTGCCCTGAGGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141255905 Original CRISPR CATTTTGCCCTGAGGGAGAT GGG Intergenic
No off target data available for this crispr