ID: 1141257941

View in Genome Browser
Species Human (GRCh38)
Location 16:82420762-82420784
Sequence ATCTGCATGCTATAGATGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141257941_1141257943 9 Left 1141257941 16:82420762-82420784 CCTCTCATCTATAGCATGCAGAT No data
Right 1141257943 16:82420794-82420816 ACATATTTTAGTGAGTCGTTAGG No data
1141257941_1141257945 29 Left 1141257941 16:82420762-82420784 CCTCTCATCTATAGCATGCAGAT No data
Right 1141257945 16:82420814-82420836 AGGATTATAGGAGAAAATGTAGG No data
1141257941_1141257944 17 Left 1141257941 16:82420762-82420784 CCTCTCATCTATAGCATGCAGAT No data
Right 1141257944 16:82420802-82420824 TAGTGAGTCGTTAGGATTATAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141257941 Original CRISPR ATCTGCATGCTATAGATGAG AGG (reversed) Intergenic
No off target data available for this crispr