ID: 1141262379

View in Genome Browser
Species Human (GRCh38)
Location 16:82465705-82465727
Sequence AACCCTATGCAGCTTTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141262378_1141262379 -2 Left 1141262378 16:82465684-82465706 CCATCATTTTCTTCTACATCTAA No data
Right 1141262379 16:82465705-82465727 AACCCTATGCAGCTTTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141262379 Original CRISPR AACCCTATGCAGCTTTTCCC TGG Intergenic
No off target data available for this crispr