ID: 1141263280

View in Genome Browser
Species Human (GRCh38)
Location 16:82473120-82473142
Sequence AGCATTTACTACTATGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141263280_1141263283 3 Left 1141263280 16:82473120-82473142 CCCAGCTCATAGTAGTAAATGCT No data
Right 1141263283 16:82473146-82473168 GTCCTGTGTGGATTAGATGAAGG No data
1141263280_1141263282 -9 Left 1141263280 16:82473120-82473142 CCCAGCTCATAGTAGTAAATGCT No data
Right 1141263282 16:82473134-82473156 GTAAATGCTCAAGTCCTGTGTGG No data
1141263280_1141263285 9 Left 1141263280 16:82473120-82473142 CCCAGCTCATAGTAGTAAATGCT No data
Right 1141263285 16:82473152-82473174 TGTGGATTAGATGAAGGATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141263280 Original CRISPR AGCATTTACTACTATGAGCT GGG (reversed) Intergenic
No off target data available for this crispr