ID: 1141267049

View in Genome Browser
Species Human (GRCh38)
Location 16:82507064-82507086
Sequence GACCTCCCCCATGACAGAGT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141267049_1141267058 11 Left 1141267049 16:82507064-82507086 CCGACTCTGTCATGGGGGAGGTC No data
Right 1141267058 16:82507098-82507120 GAAGTGCAGTGTGGGCTCCATGG No data
1141267049_1141267060 20 Left 1141267049 16:82507064-82507086 CCGACTCTGTCATGGGGGAGGTC No data
Right 1141267060 16:82507107-82507129 TGTGGGCTCCATGGAGCTGTGGG No data
1141267049_1141267061 24 Left 1141267049 16:82507064-82507086 CCGACTCTGTCATGGGGGAGGTC No data
Right 1141267061 16:82507111-82507133 GGCTCCATGGAGCTGTGGGTAGG No data
1141267049_1141267055 3 Left 1141267049 16:82507064-82507086 CCGACTCTGTCATGGGGGAGGTC No data
Right 1141267055 16:82507090-82507112 AGGCCCGGGAAGTGCAGTGTGGG No data
1141267049_1141267054 2 Left 1141267049 16:82507064-82507086 CCGACTCTGTCATGGGGGAGGTC No data
Right 1141267054 16:82507089-82507111 GAGGCCCGGGAAGTGCAGTGTGG No data
1141267049_1141267059 19 Left 1141267049 16:82507064-82507086 CCGACTCTGTCATGGGGGAGGTC No data
Right 1141267059 16:82507106-82507128 GTGTGGGCTCCATGGAGCTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141267049 Original CRISPR GACCTCCCCCATGACAGAGT CGG (reversed) Intergenic
No off target data available for this crispr