ID: 1141270337

View in Genome Browser
Species Human (GRCh38)
Location 16:82534035-82534057
Sequence CTGGGTAATCAGAATGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141270337_1141270344 15 Left 1141270337 16:82534035-82534057 CCTTCCTCATTCTGATTACCCAG No data
Right 1141270344 16:82534073-82534095 ATGTACCAGGCAGCTACTCTGGG No data
1141270337_1141270346 20 Left 1141270337 16:82534035-82534057 CCTTCCTCATTCTGATTACCCAG No data
Right 1141270346 16:82534078-82534100 CCAGGCAGCTACTCTGGGTGAGG No data
1141270337_1141270343 14 Left 1141270337 16:82534035-82534057 CCTTCCTCATTCTGATTACCCAG No data
Right 1141270343 16:82534072-82534094 CATGTACCAGGCAGCTACTCTGG No data
1141270337_1141270347 23 Left 1141270337 16:82534035-82534057 CCTTCCTCATTCTGATTACCCAG No data
Right 1141270347 16:82534081-82534103 GGCAGCTACTCTGGGTGAGGTGG No data
1141270337_1141270342 2 Left 1141270337 16:82534035-82534057 CCTTCCTCATTCTGATTACCCAG No data
Right 1141270342 16:82534060-82534082 GATTGATGGATTCATGTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141270337 Original CRISPR CTGGGTAATCAGAATGAGGA AGG (reversed) Intergenic
No off target data available for this crispr