ID: 1141275743

View in Genome Browser
Species Human (GRCh38)
Location 16:82586533-82586555
Sequence GTGCCCACCCAGACTGAGAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 3103
Summary {0: 3, 1: 122, 2: 578, 3: 1109, 4: 1291}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141275743_1141275749 16 Left 1141275743 16:82586533-82586555 CCACTCTCAGTCTGGGTGGGCAC 0: 3
1: 122
2: 578
3: 1109
4: 1291
Right 1141275749 16:82586572-82586594 CGTGAGGCCAGAATAAAAGCAGG No data
1141275743_1141275745 0 Left 1141275743 16:82586533-82586555 CCACTCTCAGTCTGGGTGGGCAC 0: 3
1: 122
2: 578
3: 1109
4: 1291
Right 1141275745 16:82586556-82586578 CATCTAATCAGCCGCCCGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141275743 Original CRISPR GTGCCCACCCAGACTGAGAG TGG (reversed) Intergenic
Too many off-targets to display for this crispr