ID: 1141276765

View in Genome Browser
Species Human (GRCh38)
Location 16:82595390-82595412
Sequence CTGAAAACCCTTTCACCTCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141276765_1141276769 18 Left 1141276765 16:82595390-82595412 CCTTGAGGTGAAAGGGTTTTCAG No data
Right 1141276769 16:82595431-82595453 TCAATGTTTTTCTTTCATGGAGG No data
1141276765_1141276770 19 Left 1141276765 16:82595390-82595412 CCTTGAGGTGAAAGGGTTTTCAG No data
Right 1141276770 16:82595432-82595454 CAATGTTTTTCTTTCATGGAGGG No data
1141276765_1141276768 15 Left 1141276765 16:82595390-82595412 CCTTGAGGTGAAAGGGTTTTCAG No data
Right 1141276768 16:82595428-82595450 AATTCAATGTTTTTCTTTCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141276765 Original CRISPR CTGAAAACCCTTTCACCTCA AGG (reversed) Intergenic
No off target data available for this crispr