ID: 1141277861

View in Genome Browser
Species Human (GRCh38)
Location 16:82604437-82604459
Sequence GCTTCTGTTCTGAGGGTCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141277855_1141277861 8 Left 1141277855 16:82604406-82604428 CCAGCATGCTCTGAATTGGTGTT No data
Right 1141277861 16:82604437-82604459 GCTTCTGTTCTGAGGGTCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141277861 Original CRISPR GCTTCTGTTCTGAGGGTCCA TGG Intergenic
No off target data available for this crispr