ID: 1141278035

View in Genome Browser
Species Human (GRCh38)
Location 16:82605841-82605863
Sequence GCATCAGAGGTCCTCTTCTA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141278035 Original CRISPR GCATCAGAGGTCCTCTTCTA TGG Intergenic