ID: 1141278902

View in Genome Browser
Species Human (GRCh38)
Location 16:82613047-82613069
Sequence AGGGCTTTCTTCTGAAGCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141278902_1141278908 9 Left 1141278902 16:82613047-82613069 CCACAGCTTCAGAAGAAAGCCCT No data
Right 1141278908 16:82613079-82613101 AAGGCGCTGAAGCCTGCATGAGG No data
1141278902_1141278903 -10 Left 1141278902 16:82613047-82613069 CCACAGCTTCAGAAGAAAGCCCT No data
Right 1141278903 16:82613060-82613082 AGAAAGCCCTCCTGTCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141278902 Original CRISPR AGGGCTTTCTTCTGAAGCTG TGG (reversed) Intergenic
No off target data available for this crispr