ID: 1141278903

View in Genome Browser
Species Human (GRCh38)
Location 16:82613060-82613082
Sequence AGAAAGCCCTCCTGTCTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141278901_1141278903 -6 Left 1141278901 16:82613043-82613065 CCAACCACAGCTTCAGAAGAAAG No data
Right 1141278903 16:82613060-82613082 AGAAAGCCCTCCTGTCTCCAAGG No data
1141278902_1141278903 -10 Left 1141278902 16:82613047-82613069 CCACAGCTTCAGAAGAAAGCCCT No data
Right 1141278903 16:82613060-82613082 AGAAAGCCCTCCTGTCTCCAAGG No data
1141278900_1141278903 20 Left 1141278900 16:82613017-82613039 CCTTGGTGATGGGGAGATACACA No data
Right 1141278903 16:82613060-82613082 AGAAAGCCCTCCTGTCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141278903 Original CRISPR AGAAAGCCCTCCTGTCTCCA AGG Intergenic
No off target data available for this crispr