ID: 1141278908

View in Genome Browser
Species Human (GRCh38)
Location 16:82613079-82613101
Sequence AAGGCGCTGAAGCCTGCATG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141278902_1141278908 9 Left 1141278902 16:82613047-82613069 CCACAGCTTCAGAAGAAAGCCCT No data
Right 1141278908 16:82613079-82613101 AAGGCGCTGAAGCCTGCATGAGG No data
1141278904_1141278908 -10 Left 1141278904 16:82613066-82613088 CCCTCCTGTCTCCAAGGCGCTGA No data
Right 1141278908 16:82613079-82613101 AAGGCGCTGAAGCCTGCATGAGG No data
1141278901_1141278908 13 Left 1141278901 16:82613043-82613065 CCAACCACAGCTTCAGAAGAAAG No data
Right 1141278908 16:82613079-82613101 AAGGCGCTGAAGCCTGCATGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141278908 Original CRISPR AAGGCGCTGAAGCCTGCATG AGG Intergenic
No off target data available for this crispr