ID: 1141283390

View in Genome Browser
Species Human (GRCh38)
Location 16:82649300-82649322
Sequence ATGAATGCATAGATGGAGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1599
Summary {0: 1, 1: 0, 2: 23, 3: 270, 4: 1305}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141283390 Original CRISPR ATGAATGCATAGATGGAGGA TGG Intronic
900498136 1:2985870-2985892 GTGAATGAATGGATGGATGATGG - Intergenic
900498155 1:2985958-2985980 GTGAATGGATGGATGGTGGATGG - Intergenic
900498167 1:2986011-2986033 GTGAATGAATGGATGGAGGATGG - Intergenic
900498700 1:2989156-2989178 ATGAATGGTTGGATGGATGATGG - Intergenic
900498729 1:2989278-2989300 ATGAATGGATGGATGGAGGATGG - Intergenic
900498748 1:2989373-2989395 GAGGATGAATAGATGGAGGATGG - Intergenic
900498766 1:2989463-2989485 ATGGATGGATGGATGGATGATGG - Intergenic
900498784 1:2989543-2989565 ATGGATGAATGGATGGAGGATGG - Intergenic
900509425 1:3051531-3051553 ATGGATGGATGGATGGATGATGG - Intergenic
900509584 1:3052193-3052215 ATGAATGAATGGATGGATGATGG - Intergenic
900573330 1:3370817-3370839 ATGGATGAATAGATGGTGGATGG - Intronic
900573347 1:3370883-3370905 ATGGATGAATGGATGGTGGATGG - Intronic
900573426 1:3371253-3371275 ATGGATGAATGGATGGTGGATGG - Intronic
900573442 1:3371339-3371361 ATGAATGGATGGATGGTGAATGG - Intronic
900573469 1:3371461-3371483 ATGGATGGATAGATGGTGGATGG - Intronic
900573486 1:3371516-3371538 ATGGATGGATAGATGGTGGATGG - Intronic
900896801 1:5488328-5488350 ATGAATGGATAGTTGAAGGATGG - Intergenic
900922004 1:5678790-5678812 ATGGATGGATGGATGGATGAGGG + Intergenic
900931020 1:5737659-5737681 ATGGATGGATGGATGGATGATGG + Intergenic
900993422 1:6108112-6108134 ATGGAGGCATAGAGGGATGATGG + Intronic
901001213 1:6149647-6149669 ATGAATGGATAAATGGATGATGG + Intronic
901001369 1:6150510-6150532 ATGGATGGATGGATGGTGGATGG + Intronic
901001379 1:6150578-6150600 ATGAATGGCTGGATGGATGAAGG + Intronic
901006601 1:6174699-6174721 ATGGATGAATGGATGGTGGATGG + Intronic
901006632 1:6174885-6174907 ATGGATGGATAGATGGTGGGTGG + Intronic
901006679 1:6175085-6175107 ATGGATGCATGGATGGATGGTGG + Intronic
901006718 1:6175272-6175294 ATGGATGCATGGATGGATGGTGG + Intronic
901006719 1:6175276-6175298 ATGCATGGATGGATGGTGGATGG + Intronic
901006723 1:6175299-6175321 ATGAATGAATGGATGGTGGATGG + Intronic
901006735 1:6175360-6175382 ATGGATGCATGGATGGATGGTGG + Intronic
901006736 1:6175364-6175386 ATGCATGGATGGATGGTGGATGG + Intronic
901006740 1:6175383-6175405 ATGGATGCATGGATGGATGGTGG + Intronic
901262553 1:7884899-7884921 ATGAATGGATGCATGGATGATGG - Intergenic
901262591 1:7885092-7885114 ATGAATGGATGCATGGATGATGG - Intergenic
901445567 1:9305937-9305959 ATGAGTGCAGAGAGGCAGGAGGG + Intronic
901863729 1:12090433-12090455 ATGGATGGATGGATGGGGGAAGG - Intronic
901928582 1:12582891-12582913 ATGCATGGATGGATGGAGTAGGG - Intronic
901928784 1:12583713-12583735 ATGCATGAATGGATGGAGTAGGG - Intronic
901928808 1:12583816-12583838 ATGGTTGGATAGATGGAGTAGGG - Intronic
902350537 1:15850175-15850197 CAGAATGCACAGAGGGAGGAGGG + Intronic
902397931 1:16142659-16142681 ATGAGTGGATGGATGGATGAGGG + Intronic
902398075 1:16143188-16143210 ATGAATGGATGGATGGATGTAGG + Intronic
902412856 1:16221587-16221609 ATGGATGGATGGATGGATGATGG + Intergenic
902412888 1:16221777-16221799 ATGGATGGATGAATGGAGGATGG + Intergenic
902599029 1:17528573-17528595 ACAAATGGATGGATGGAGGATGG - Intergenic
902599040 1:17528624-17528646 ATGAATGAATGGATGGAGGATGG - Intergenic
902721184 1:18305246-18305268 ATGGATGCATGGATGGTGGATGG + Intronic
902721222 1:18305471-18305493 ATGGATGGATGGATGGATGATGG + Intronic
902721233 1:18305529-18305551 ATGAATGGATGGATGGATGATGG + Intronic
902721244 1:18305579-18305601 ATGGATGGATGGATGGATGATGG + Intronic
902827600 1:18987738-18987760 ATGAATGAATGAATGAAGGAAGG + Intergenic
903175173 1:21576236-21576258 ATGGATGGATGGATGGATGATGG + Intronic
903224410 1:21886711-21886733 ATGGGTGGATAGATGGATGAAGG + Intronic
903341677 1:22658796-22658818 ATGGATGGATGGATGGAGGGTGG + Intronic
903357842 1:22758937-22758959 ATGAATGGATGGATGGATGATGG + Intronic
903474263 1:23608541-23608563 ATGAATGAATGGATGAATGAAGG + Intronic
903565977 1:24266178-24266200 ATGGATGGATAGAGGGAGGGTGG + Intergenic
903690428 1:25169326-25169348 ATGGATGGATGGATGGATGATGG + Intergenic
904269093 1:29337499-29337521 ATGAGTACATAGATGGTGGCAGG - Intergenic
904464524 1:30699979-30700001 ATGGATGGATGGATGGATGAAGG - Intergenic
904464546 1:30700086-30700108 ATGGATGGATAGGTGGTGGAGGG - Intergenic
904465112 1:30702955-30702977 ATGGATGGATGGATGGATGATGG + Intergenic
904581357 1:31546517-31546539 ATGGATGGATGGATGGATGATGG - Intergenic
904745210 1:32706486-32706508 ATGAATGAAGGGAAGGAGGATGG + Intergenic
904753499 1:32755188-32755210 GTGAATCCAGAGATGGGGGAAGG + Intronic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
905228223 1:36493731-36493753 ATGGATGCGTAGATGATGGATGG - Intergenic
905274627 1:36809197-36809219 ATGGATGGATGGATGGATGATGG - Intronic
905891252 1:41519845-41519867 ATGGAAGGATAGATGGAGAATGG + Intronic
906070899 1:43015723-43015745 ATGAAGGGAGAAATGGAGGAGGG - Intergenic
906180686 1:43815915-43815937 ATGGATGGATGGATGGATGATGG + Intronic
906706387 1:47898092-47898114 ATGAATGAGCAGATGAAGGAAGG + Intronic
906800796 1:48735371-48735393 AAGAATGGATGGATGGAGGGAGG + Intronic
907662897 1:56409516-56409538 ATGAATGAGTAGTTGGGGGAAGG - Intergenic
907664346 1:56421248-56421270 ATAAATGCAAAGATGGTGGATGG - Intergenic
907764135 1:57391717-57391739 AAGAATGCACAGATGGATTAGGG - Intronic
907790129 1:57655368-57655390 ATGAATGGATGGATGGATGATGG - Intronic
907919763 1:58901673-58901695 ATGAGTGGACAGATGGATGATGG - Intergenic
908358356 1:63344083-63344105 CTGGATGCAGAGAGGGAGGAAGG - Intergenic
908391370 1:63686692-63686714 ATGGATGGATGGATGGATGAAGG - Intergenic
908391400 1:63686850-63686872 ATGGATGAATGGATGGGGGATGG - Intergenic
909016832 1:70389042-70389064 ATTAAAGCAGAGAGGGAGGAAGG - Intergenic
909977230 1:82059384-82059406 ATGCATGCATAAATGGAGGCTGG + Intergenic
911184230 1:94887330-94887352 CTGAATGAATAGGGGGAGGAGGG - Intronic
912380278 1:109243861-109243883 ATGAATACATGAATGGAGGATGG - Intergenic
913329709 1:117657066-117657088 ATGAATGAATAAAGGAAGGAAGG - Intergenic
913963361 1:143355389-143355411 ATGAATGCGTGGATGCAGGGTGG + Intergenic
913993150 1:143634131-143634153 AGGAAAGAATAGAGGGAGGAAGG + Intergenic
914057717 1:144180975-144180997 ATGAATGCGTGGATGCAGGGTGG + Intergenic
914121429 1:144785391-144785413 ATGAATGCGTGGATGCAGGGTGG - Intergenic
914351301 1:146842755-146842777 ATGCATGGATGGATGGATGATGG + Intergenic
914351392 1:146843111-146843133 ATGGATGGATAGATAGATGATGG + Intergenic
916050873 1:161036080-161036102 ATGAATGAATGAATGTAGGAGGG + Intronic
918070567 1:181131008-181131030 ATAAATGAATAAATGGAGAATGG - Intergenic
918427312 1:184423854-184423876 ATGGATGGATGGATGGACGATGG - Intronic
919826995 1:201510182-201510204 ATGGATGGATGGATGGAGGGAGG - Intergenic
919922272 1:202173655-202173677 ATGGATGGATGGATGGTGGATGG - Intergenic
919935096 1:202245971-202245993 ATGAATGGATAGATGAAGGGAGG - Intronic
919935115 1:202246030-202246052 ATGAATGGATGGATGGAGGGAGG - Intronic
919935125 1:202246062-202246084 ATGAATGGATAGATGAAGGGAGG - Intronic
919935245 1:202246393-202246415 ATGAATGGATAGATGAAGGGAGG - Intronic
920287354 1:204890214-204890236 GTGAATGGATGGATGCAGGAAGG - Intronic
920700588 1:208215529-208215551 ATGGATGAAGGGATGGAGGAAGG + Intronic
920722271 1:208398896-208398918 ATGAATGAATGAATGGATGATGG - Intergenic
921151534 1:212406940-212406962 AGAAGTGCATAGATGGAGGCAGG - Intronic
921382437 1:214538201-214538223 AAGAATGAATGGAAGGAGGAAGG + Intronic
921501460 1:215909298-215909320 ATGAATGAATAGATGGAACACGG + Intronic
921563971 1:216693807-216693829 ATTAATTCATAGAGGAAGGATGG - Intronic
922030951 1:221797648-221797670 ATGAATGAAGACAGGGAGGATGG + Intergenic
922093104 1:222416418-222416440 ATGAATGCATTGATGGGCCAAGG - Intergenic
922648513 1:227317668-227317690 CAGAATGCATAGAAGGGGGAGGG + Exonic
922700128 1:227754432-227754454 ACGGATGGACAGATGGAGGAAGG - Intronic
922745561 1:228041496-228041518 ATTGATGGATAGATGGATGATGG - Intronic
922745570 1:228041547-228041569 ATGAATTGATGGATGGTGGATGG - Intronic
922790877 1:228310262-228310284 ATGAATGGACAGATGATGGATGG - Intronic
922790891 1:228310379-228310401 GTGAATGGATGGATGGTGGATGG - Intronic
922792858 1:228319739-228319761 ATGAATGGATGAATGGTGGATGG - Intronic
922792933 1:228320339-228320361 ATGGATGGATAGATGGTGGATGG - Intronic
922793026 1:228321010-228321032 ATGAATGGATGGATGCAGGGTGG - Intronic
923426842 1:233879068-233879090 ATGAGTGCTCAGATGGAGGTGGG + Intergenic
923427031 1:233881269-233881291 CTAAATGCAGAGATGGAGGTGGG - Intergenic
923626082 1:235615082-235615104 GAGAATGCATAGATCGAAGAGGG + Intronic
923916299 1:238509878-238509900 ATGAATAGATAGATAGATGATGG - Intergenic
924600657 1:245485864-245485886 ATGAATAAATAAATGAAGGAAGG + Intronic
1062928340 10:1335200-1335222 ATGAATGGATGGATGGAGGGAGG + Intronic
1063081518 10:2772341-2772363 TTGAATGCATAGACTGAGTAAGG + Intergenic
1063164303 10:3446032-3446054 ATGGATGCAAAGAAAGAGGAGGG + Intergenic
1063438926 10:6056287-6056309 ATGCATGAATGGATGGATGAAGG + Intronic
1063500447 10:6548966-6548988 ATGAATGGATAAATGGATCATGG - Intronic
1063877603 10:10496549-10496571 ATGGATGAAAAGATGGAGGGTGG + Intergenic
1064132361 10:12721505-12721527 ATGGATGGATGGATGGTGGATGG - Intronic
1064142389 10:12801463-12801485 ATGAATGGATAGATAGATGACGG - Intronic
1064715262 10:18170241-18170263 AGGAATGAATGGATGTAGGATGG + Intronic
1064896381 10:20241954-20241976 ATGGATGGATGGATGGAGAAAGG + Intronic
1065860679 10:29870336-29870358 ATGGATGGATGGATGGTGGATGG - Intergenic
1065860704 10:29870447-29870469 ATGAATGGATAGATGGGAGATGG - Intergenic
1065860736 10:29870603-29870625 ATGAATGGATCGATGGTAGATGG - Intergenic
1065860789 10:29870885-29870907 ATGAATGGATGGATGGTAGATGG - Intergenic
1066038981 10:31525706-31525728 ATGAATCCACAGATTGAAGAAGG - Intronic
1066201754 10:33148561-33148583 ATGAATGAATAAATAGAAGATGG + Intergenic
1066229330 10:33416895-33416917 ATGAATGGATGGATGGTGGATGG + Intergenic
1066290237 10:34007832-34007854 ATGGAAGCATATAGGGAGGAAGG - Intergenic
1067051422 10:43023554-43023576 ATGGATGAATGGATGGATGATGG + Intergenic
1067342442 10:45416800-45416822 ATGGATTCATGGATGGTGGATGG + Intronic
1067709622 10:48637580-48637602 ATGGATGGATAAATGGTGGATGG + Intronic
1067754901 10:48998210-48998232 ATGAATGCATATGTGAATGAGGG + Intergenic
1067893970 10:50160135-50160157 GTGAAAGGAGAGATGGAGGAAGG - Intergenic
1067954877 10:50780129-50780151 GTGAAAGGAGAGATGGAGGAAGG + Intronic
1068195578 10:53711561-53711583 ATGATAGCATAGATAGAGCAGGG + Intergenic
1069285242 10:66706235-66706257 AAGAATGAATGGATGAAGGATGG - Intronic
1069601630 10:69711869-69711891 ATGGATGGATGGATGGATGATGG - Intergenic
1070749902 10:78957851-78957873 ATGGATGGATGGATGGATGAAGG + Intergenic
1071131212 10:82395660-82395682 ATGAATGGATGGATGATGGATGG - Intronic
1071508580 10:86247369-86247391 ATGGATGGATGGATGGATGATGG + Intronic
1071509032 10:86249872-86249894 ATAAATGGATGGATGGTGGAAGG + Intronic
1071575553 10:86723319-86723341 ATGCATGGATAAATGGAGGAGGG + Intronic
1072450411 10:95535058-95535080 ATAAATGAATGGATGGATGATGG + Intronic
1072532786 10:96335375-96335397 GTGAATGAAAGGATGGAGGAAGG - Intronic
1072751569 10:97984315-97984337 ATGACTGCTCAGATGGGGGAGGG - Intronic
1073323839 10:102631272-102631294 ATGAATGGATACAGGGAGGATGG - Exonic
1073391103 10:103176800-103176822 ATGAAAACCTAGATGGAGGCCGG - Intronic
1073467166 10:103700945-103700967 ATGGATGGATGGATGGATGATGG - Intronic
1073467170 10:103700964-103700986 ATGGATGGATGGATGGTGGATGG - Intronic
1073467179 10:103701013-103701035 ATGGATGGATGGATGGTGGATGG - Intronic
1073467185 10:103701036-103701058 ATGGATGGATGGATGGTGGATGG - Intronic
1073467191 10:103701059-103701081 ATGGATGGATGGATGGATGATGG - Intronic
1073467213 10:103701172-103701194 ATGGATGGATGGATGGTGGATGG - Intronic
1073467232 10:103701265-103701287 ATGAATGGATAGATGATGGATGG - Intronic
1073467235 10:103701288-103701310 ATGAATGGATGGATGATGGATGG - Intronic
1073467236 10:103701292-103701314 ATGGATGAATGGATGGATGATGG - Intronic
1073467239 10:103701311-103701333 ATGAATGGATGGATGATGGATGG - Intronic
1073467240 10:103701315-103701337 ATGGATGAATGGATGGATGATGG - Intronic
1073467248 10:103701353-103701375 ATGAATGGATAGATGATGGGTGG - Intronic
1073467264 10:103701428-103701450 ATGAATGGATAGATGGTGGATGG - Intronic
1073467274 10:103701484-103701506 ATGAATGGATGGATGATGGATGG - Intronic
1073467275 10:103701488-103701510 ATGGATGAATGGATGGATGATGG - Intronic
1073467289 10:103701552-103701574 ATGAATGGATAGATGATGGATGG - Intronic
1073467303 10:103701634-103701656 ATGGATGGATAGATGATGGATGG - Intronic
1073467364 10:103701979-103702001 ATGGATGGATGGATGGTGGATGG - Intronic
1073467377 10:103702035-103702057 GTGGATGGATAGATGGATGATGG - Intronic
1073467399 10:103702161-103702183 ATGGATGGATGGATGGTGGATGG - Intronic
1073795056 10:106978299-106978321 ATGACTGAAAAGATAGAGGATGG + Intronic
1074704308 10:116117708-116117730 AGGTATGAATAGATGGATGATGG + Intronic
1074896304 10:117780496-117780518 ATGGATGGATAGATGGATGGAGG - Intergenic
1074950516 10:118329810-118329832 ATGAATGCAAACATGGATGACGG - Intronic
1075648258 10:124110487-124110509 ATGGATGGATGGATGGATGATGG + Intergenic
1075918312 10:126188873-126188895 ATGAATGAAAGGATGAAGGATGG - Intronic
1076136725 10:128050242-128050264 ATGGATGGATGGATGGATGATGG + Intronic
1076230451 10:128816182-128816204 ATGAGTGGATAGATAGATGATGG + Intergenic
1076494436 10:130887636-130887658 ATGGATGGATGGATGGATGAAGG + Intergenic
1076825136 10:132963425-132963447 ATGGACGGATGGATGGAGGAAGG - Intergenic
1076844939 10:133065429-133065451 ATGTATGGATGGATGGATGATGG + Intergenic
1076844953 10:133065483-133065505 ATGGATGGATGGATGGTGGATGG + Intergenic
1076845003 10:133065650-133065672 ATGGATGGATAGATGGAGGGTGG + Intergenic
1076845049 10:133065802-133065824 AGGGATGGATAGATGGTGGATGG + Intergenic
1076845121 10:133066046-133066068 ATGGGTGGATAGATGGTGGATGG + Intergenic
1076931874 10:133536885-133536907 ATGGGTGGATGGATGGAGGATGG + Intronic
1077150330 11:1070259-1070281 ATGAGTGGATAAATGGAGGGAGG - Intergenic
1077159570 11:1106513-1106535 ATGGATGGATGGATGGTGGATGG - Intergenic
1077280503 11:1742895-1742917 ATGGATGGACAGATGGAGGATGG + Intronic
1077280507 11:1742914-1742936 ATGGATAGATGGATGGAGGATGG + Intronic
1077280511 11:1742933-1742955 ATGGATGGATAGATGGATGGAGG + Intronic
1077280512 11:1742937-1742959 ATGGATAGATGGATGGAGGATGG + Intronic
1077280531 11:1743033-1743055 ATGGATGGATGGATGAAGGATGG + Intronic
1077280541 11:1743067-1743089 ATGGATGGATGGATGGAGGATGG + Intronic
1077280548 11:1743097-1743119 ATGGATGGATAGATGGATGGAGG + Intronic
1077280556 11:1743142-1743164 ATGGATGGACAGATGGAGGATGG + Intronic
1077280576 11:1743274-1743296 ATGGATGGACAGATGGAGGATGG + Intronic
1077280588 11:1743339-1743361 ATGGATGGATGGATGGAGGATGG + Intronic
1077280595 11:1743377-1743399 ATGGATGAATGGATGGAAGATGG + Intronic
1077280616 11:1743486-1743508 ATGGATGGACAGATGGAGAATGG + Intronic
1077304201 11:1861544-1861566 ATGGATGGATAGATGGATAATGG + Intronic
1077312117 11:1893525-1893547 ATGAGTGGATGGATGGATGAAGG + Intergenic
1077321745 11:1946005-1946027 ATGAAGGCATTGAAGCAGGATGG - Intergenic
1077479921 11:2808973-2808995 ATAGATGCAGAGATGGAGGGAGG + Intronic
1077480881 11:2814000-2814022 ATGGATGGATGGATGGATGATGG + Intronic
1078579448 11:12527210-12527232 AGGAAGGCAAAGAGGGAGGATGG + Intronic
1078886632 11:15506873-15506895 AGGAATGAAGATATGGAGGAGGG + Intergenic
1079203264 11:18393318-18393340 ATTAAAGAAGAGATGGAGGAGGG + Intergenic
1079554102 11:21738411-21738433 ATGAATGAATAAATGAATGATGG + Intergenic
1079604622 11:22349439-22349461 ATGAATAGATGGATTGAGGAGGG + Intronic
1079807369 11:24950223-24950245 ATAAATGAATGGATGGATGAAGG + Intronic
1080415115 11:32062562-32062584 ATGGATGGATGGATGGTGGATGG + Intronic
1080740491 11:35059434-35059456 ATGAATGCCCAGAGAGAGGATGG - Intergenic
1080781489 11:35433828-35433850 ATGGATGGATGGATGGATGAGGG + Intronic
1080849360 11:36054893-36054915 ATGGATGAATGGATGGATGATGG + Intronic
1080942956 11:36939737-36939759 ATTAATGCATAAATGAATGAAGG - Intergenic
1081287183 11:41285246-41285268 ATGAATGAATGGATGGATGATGG - Intronic
1081704057 11:45170437-45170459 GTGAATGCCTAGAGGGAGTAGGG + Intronic
1082130232 11:48479776-48479798 ATGAATGCATAGATTAAGTTGGG + Intergenic
1082150314 11:48730672-48730694 ATGAATGCAATGAAGCAGGAAGG + Intergenic
1082171659 11:49012376-49012398 CGGAATGCAGAGATGGAGCAGGG + Intergenic
1082563753 11:54650689-54650711 ATGAATGCATAGATTAAGTTGGG + Intergenic
1082781382 11:57290190-57290212 ATGGATGGATGGATGGATGAAGG + Intergenic
1083293668 11:61703652-61703674 GTGAGTGGGTAGATGGAGGATGG + Intronic
1083622405 11:64055699-64055721 ATGGATGGATGGATGGATGATGG + Intronic
1083879843 11:65542978-65543000 ATGGATGGATGGATGGATGAAGG + Intronic
1083879844 11:65542982-65543004 ATGGATGGATGGATGAAGGATGG + Intronic
1084005926 11:66323520-66323542 ATGGATGCATGGATGGATGGAGG + Intergenic
1084461892 11:69300847-69300869 ATGAATGCACGGATGATGGATGG + Intronic
1084543830 11:69803775-69803797 ATGGATGGATGGATGGATGATGG + Intergenic
1084543837 11:69803818-69803840 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084543847 11:69803888-69803910 ATGGATGGATGGATGGATGATGG + Intergenic
1084543875 11:69804053-69804075 ATGGATGAAAAGATGGAAGATGG + Intergenic
1084543901 11:69804223-69804245 ATGGATGGATAGATGGATGATGG + Intergenic
1084576540 11:69992238-69992260 ATGGATGGATGGATGGATGATGG + Intergenic
1084579222 11:70012347-70012369 ATGGATGGATGGATGGATGAAGG - Intergenic
1084579265 11:70012688-70012710 ATGGATGGATGGATGGATGAAGG - Intergenic
1084609661 11:70194152-70194174 ATGGATGGATGGATGGTGGATGG + Intergenic
1084609760 11:70194630-70194652 ATGGATGGATGGATGGTGGATGG + Intergenic
1084609836 11:70195033-70195055 ATGAATGGATGGATGGATGGTGG + Intergenic
1084609837 11:70195037-70195059 ATGGATGGATGGATGGTGGATGG + Intergenic
1084658813 11:70535409-70535431 ATGGATGGATGGATGGATGATGG - Intronic
1084684617 11:70686310-70686332 ATGGATGGGTAGATGGATGATGG - Intronic
1084684637 11:70686405-70686427 ATGGATGGGTAGATGGATGATGG - Intronic
1084697479 11:70764316-70764338 ATAGATGGATAGAAGGAGGAGGG - Intronic
1084705126 11:70811653-70811675 ATGGATGAATAGATGATGGATGG - Intronic
1084705150 11:70811798-70811820 ATGGATGGGTAGATGGATGATGG - Intronic
1084716558 11:70878006-70878028 AAGAATGCAGAGAAGCAGGAGGG + Intronic
1084740004 11:71133410-71133432 ATGGATGGACAGATGGAGGGAGG + Intronic
1084781845 11:71414982-71415004 ATGGATGGGTAGATGGATGATGG + Intergenic
1085032777 11:73282751-73282773 ATGAATGAATGAATGGAGGAGGG + Intronic
1085059243 11:73429715-73429737 AGGAATACATGGAAGGAGGAGGG - Intronic
1085406834 11:76268536-76268558 ATGGATGGATGGATGGTGGAGGG - Intergenic
1085406867 11:76268657-76268679 ATGGATGGATGGATGGAGGATGG - Intergenic
1085406873 11:76268680-76268702 ATGGATGGATGGATAGAGGATGG - Intergenic
1085406894 11:76268761-76268783 ATGAATGGATGGATGGAGGATGG - Intergenic
1085464244 11:76713397-76713419 ATGCATGGATAGATGGTGGTGGG + Intergenic
1085721116 11:78913218-78913240 ATGAAAGCAGAGAAGCAGGAAGG - Intronic
1085789057 11:79480260-79480282 ATGAATGAATAAATGGGGGAAGG + Intergenic
1086212304 11:84335247-84335269 ATGAAGGAACAGAGGGAGGAAGG + Intronic
1086401979 11:86468335-86468357 ATGGATGGATGGATGGATGATGG - Intronic
1086445477 11:86866496-86866518 ATGAATGAATAGATGATGAATGG - Intronic
1087021574 11:93608448-93608470 ATGAAGTCATAGATGCAGGCTGG + Intergenic
1087175913 11:95095233-95095255 TTGAATGAATGGATGGAGGGTGG + Intronic
1087179999 11:95132316-95132338 ATGACTGAATAAATGAAGGATGG - Exonic
1087399512 11:97647276-97647298 ATGAGTGCAAAGCTTGAGGATGG + Intergenic
1088545142 11:110951634-110951656 GTGAATGCATGGAGGGAGGGTGG + Intergenic
1088709015 11:112489835-112489857 ATGGATGGATAGATGGATGATGG - Intergenic
1089049682 11:115535371-115535393 ATGAATGCATACATGCATGAAGG - Intergenic
1089419854 11:118323338-118323360 ATGGATGAATAGATGATGGATGG + Intergenic
1090268016 11:125366407-125366429 ATCAATGAATAGATGAATGATGG - Intronic
1090509810 11:127363147-127363169 AGAAAAGCATAGATGGAGGGAGG + Intergenic
1090675174 11:128985678-128985700 ATGAATGAATGGATGGACAAAGG - Intronic
1090857096 11:130619709-130619731 ATGGATAGATGGATGGAGGATGG - Intergenic
1090880244 11:130826444-130826466 ATGAATGAATAAAGGGATGAAGG - Intergenic
1091036642 11:132239983-132240005 ATGAATGGATGGATGGATGATGG - Intronic
1091187304 11:133658294-133658316 ATGGATGGATGGATGGATGATGG + Intergenic
1091367634 11:135035750-135035772 ATGGATGCATAGATGGATGGAGG + Intergenic
1202804763 11_KI270721v1_random:1318-1340 ATGAAGGCATTGAAGCAGGATGG - Intergenic
1091407333 12:217381-217403 ATGGATGGATGGATGGAGGATGG + Intergenic
1091644405 12:2263032-2263054 ATGAATGCAGGGATGGAGATAGG + Intronic
1091993031 12:4972336-4972358 GTGAATGGATGGATGGAGGGAGG - Intergenic
1092071348 12:5633911-5633933 AGGCATGCATATAGGGAGGAGGG - Intronic
1092575847 12:9782028-9782050 ATGAATGCACAGAAGAAGGCCGG - Intergenic
1092585764 12:9899574-9899596 AGGGATGCAAAGATGGAAGAGGG - Intronic
1092598871 12:10036879-10036901 ATGAATGCATATATGTATGACGG - Intronic
1093429446 12:19067700-19067722 ATGAATGAATAAAGGAAGGAGGG + Intergenic
1094136778 12:27136106-27136128 ATGAAGGAAGAGGTGGAGGATGG + Intergenic
1094186516 12:27648863-27648885 ATGAAGGGAGAGGTGGAGGATGG + Intronic
1094244430 12:28272600-28272622 ATGAATAAAGAGAAGGAGGAAGG - Intronic
1094349793 12:29511436-29511458 ATGAATGAATAAATGAATGATGG + Intronic
1094355590 12:29574194-29574216 GTGAATGAATGAATGGAGGAAGG - Intronic
1094488020 12:30940305-30940327 ATGAATGAATGAATGAAGGAAGG - Intronic
1094773796 12:33697603-33697625 TTGAATGCAAAAATGGAGCAAGG - Intergenic
1095240747 12:39856218-39856240 ATGCATGGATAGATGGATGAAGG - Intronic
1095477786 12:42603509-42603531 GTGCATGCATAGAGGGTGGAGGG - Intergenic
1095880298 12:47129010-47129032 ATGATAGCAGAGATGGAGAAAGG - Intronic
1096535450 12:52269726-52269748 ATGAATGCTGAGATCCAGGAAGG - Intronic
1096536760 12:52279827-52279849 GTGAATGGATGGATGGAGAATGG - Intronic
1096611227 12:52803312-52803334 ATGGATGAATAGATGGATGATGG + Intergenic
1097338056 12:58406787-58406809 CTGAATGCAGAGAAGGAGGAGGG + Intergenic
1097437473 12:59569214-59569236 ATGTATGCATATATAGAAGAGGG - Intergenic
1097946933 12:65379222-65379244 ATGGATGGGTAGATGGTGGATGG - Intronic
1098369410 12:69740043-69740065 ATGATTGCATAATTGGAGGAGGG + Intronic
1098700382 12:73616288-73616310 ATGATTCCATATATAGAGGAAGG + Intergenic
1099305391 12:80948268-80948290 ATGAATGGATAAATGGCGGTAGG + Intronic
1099374895 12:81887041-81887063 ATAGATGGATAGATGGAAGAAGG + Intergenic
1100069506 12:90694855-90694877 ATGAATATATAATTGGAGGAAGG - Intergenic
1100370858 12:93967202-93967224 AGGAATGGAGAGATGGAGGGAGG - Intergenic
1100866024 12:98857655-98857677 ATGAATGAATAAATGAATGAAGG + Intronic
1101081463 12:101189675-101189697 ATGAACGCACAGAGGTAGGAAGG - Intronic
1101206933 12:102497791-102497813 ATAAATGCATAGAAAGAAGAAGG - Intergenic
1101411941 12:104476801-104476823 ATGAATGTTGAGATAGAGGAAGG - Intronic
1101634659 12:106528593-106528615 AGAAATGCAAAGATGGAGGTGGG + Intronic
1101791915 12:107935339-107935361 AAGAATGGATGGATGGAGGATGG - Intergenic
1101801096 12:108022524-108022546 ATGAATGAATGGATGATGGAAGG - Intergenic
1101873189 12:108582022-108582044 ATGAATGAATGAATGGGGGATGG - Intergenic
1102042453 12:109809367-109809389 ATGAATGGGTGGATGGATGATGG - Intronic
1102043146 12:109813689-109813711 ATGAATAGATGGATGGATGATGG + Intronic
1102043168 12:109813845-109813867 ATGAATGGATGGATGGATGATGG + Intronic
1102199791 12:111049353-111049375 ATGGATGCATGCATGGAGGAAGG - Intronic
1102222956 12:111206947-111206969 ATGAATGCATAAATGGATGGTGG + Intronic
1102222969 12:111207042-111207064 ATGAATGGATAAATGGATGGTGG + Intronic
1102452710 12:113053725-113053747 AGGAAGGGAGAGATGGAGGAAGG + Intergenic
1102452758 12:113053935-113053957 TGGAATGGATGGATGGAGGATGG + Intergenic
1102507192 12:113391005-113391027 ATGAATGAATGGATGGCTGATGG - Exonic
1102514748 12:113438895-113438917 ATGAATGCATGGATGGATTATGG - Intergenic
1102856122 12:116295572-116295594 ATGGATGGATAGATGATGGATGG + Intergenic
1102856132 12:116295631-116295653 ATGAATGGGTAGATGAATGATGG + Intergenic
1102895620 12:116595853-116595875 ATGGATGGATGGATGGATGAAGG + Intergenic
1103006201 12:117422360-117422382 ATGTATGAATAGATGGTGGATGG - Intronic
1103012773 12:117469993-117470015 ATGGATGGATGGATGAAGGATGG - Intronic
1103012774 12:117469997-117470019 ATGGATGGATGGATGGATGAAGG - Intronic
1103024063 12:117559068-117559090 ATGGATGGATGGATGGTGGATGG + Intronic
1103131019 12:118468732-118468754 ATGAATGAATAGATGGTGGCTGG - Intergenic
1103178918 12:118890497-118890519 ATGAATAGATAGATGTATGAGGG + Intergenic
1103255955 12:119541445-119541467 ATGAATGAATGGATGGTGGATGG + Intergenic
1103403922 12:120661429-120661451 ATGAATGGAAAGGTAGAGGATGG - Intronic
1103403941 12:120661543-120661565 ATGGATGGATAGGTAGAGGATGG - Intronic
1103403950 12:120661614-120661636 ATAAATGGATGGATGGATGATGG - Intronic
1103834325 12:123807128-123807150 ATGGATGGATGGATGGATGATGG - Intronic
1103941441 12:124503425-124503447 ATGCATGCATGGATAGAGAAAGG + Intronic
1103941449 12:124503467-124503489 ATGGATGGATGGATGGATGATGG + Intronic
1103941465 12:124503557-124503579 ATGGATGGATAGATGGAAGACGG + Intronic
1103992527 12:124808637-124808659 ATGAATGGATGGAGGGTGGATGG - Intronic
1104034621 12:125089753-125089775 AGGGATGGATAGATGGATGACGG - Intronic
1104034648 12:125089902-125089924 ATGGATGGATAGATGGATAATGG - Intronic
1104034673 12:125090055-125090077 GTGGATGGATAGATGGATGAGGG - Intronic
1104034698 12:125090204-125090226 ATGGATGGATAGATGGATAATGG - Intronic
1104034722 12:125090357-125090379 ATGGATGAATAGATGGATGACGG - Intronic
1104034761 12:125090630-125090652 ATGGATGGAGAGATGGATGATGG - Intronic
1104034774 12:125090720-125090742 ATGGATGGATGGATGGATGATGG - Intronic
1104567607 12:129899325-129899347 ATGGATGGATGGATGGATGATGG + Intronic
1104763962 12:131314548-131314570 ATGGATGGATAGATGGCTGATGG - Intergenic
1104778404 12:131404630-131404652 ATGGATGGATGGATGGATGATGG - Intergenic
1104778423 12:131404708-131404730 ATGGATGGATGGATGGATGATGG - Intergenic
1104779310 12:131409681-131409703 ATGGGTGGATAGATGGATGATGG - Intergenic
1104779334 12:131409819-131409841 GTGAATGGATGGATGGATGATGG - Intergenic
1104968083 12:132518511-132518533 ATGCATGCATGCATGGTGGATGG - Intronic
1105211651 13:18260687-18260709 ATGAATGGATAGAGGGAGGGAGG + Intergenic
1105638832 13:22241660-22241682 ATGAATGAATAAATGATGGATGG - Intergenic
1106000584 13:25719479-25719501 ATGGATGGATGGATGGATGATGG + Intronic
1106057219 13:26249694-26249716 ATGAATGAACAGATGGATAATGG - Intergenic
1106171608 13:27293426-27293448 ATGAAAGGATGGAGGGAGGAAGG - Intergenic
1106586324 13:31059267-31059289 ATGCATGAATAAATGGGGGAAGG + Intergenic
1106900610 13:34351423-34351445 ATGAATGAGTAGAGGGATGATGG + Intergenic
1107630020 13:42333728-42333750 ATGAGGGAAGAGATGGAGGAGGG + Intergenic
1107710102 13:43142939-43142961 CTGAAGGCAGAGATGTAGGAAGG + Intergenic
1108290416 13:48954646-48954668 ATGAATGGATAAATGTAAGATGG - Intergenic
1108671298 13:52691853-52691875 AAAAATGCACAGATGGAGAAAGG - Intronic
1108830233 13:54468660-54468682 ATGGAGGCATATATGGAGAAAGG + Intergenic
1109901724 13:68781407-68781429 ATGAATCAATCGGTGGAGGACGG - Intergenic
1110382162 13:74865312-74865334 ATGGATGGATGGATGGAGGGAGG - Intergenic
1110752517 13:79131803-79131825 TTGAATGAATGGATGGATGAAGG - Intergenic
1111795577 13:92915107-92915129 GTTAATGCATAGAGGGAGCAGGG - Intergenic
1113072883 13:106438685-106438707 ATGGATGGATGGATGGATGATGG + Intergenic
1113130449 13:107030945-107030967 ATGATTGAATAAATGAAGGAAGG - Intergenic
1113224736 13:108147356-108147378 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224745 13:108147405-108147427 ATGACTGAATAGATGGGGGCTGG - Intergenic
1113224762 13:108147503-108147525 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224776 13:108147601-108147623 ATGACTGAATAGATGGGGGCTGG - Intergenic
1113224791 13:108147699-108147721 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224811 13:108147797-108147819 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224821 13:108147845-108147867 ATGATTGAATAGATGGAGGATGG - Intergenic
1113224832 13:108147894-108147916 ATGGCTGAATAGATGGAAGATGG - Intergenic
1113224840 13:108147943-108147965 ATGGCTGAATAGATGGAGGATGG - Intergenic
1113224862 13:108148040-108148062 ATGACTGAATAGATGGAGGATGG - Intergenic
1113224873 13:108148089-108148111 ATGACTGAATAGATGGAGGATGG - Intergenic
1113417572 13:110140288-110140310 ATGGATGGATGGATGGTGGATGG + Intergenic
1113554546 13:111221785-111221807 ATGAATCCATAGGTGTATGAGGG - Intronic
1113641469 13:111960490-111960512 ATGAATGAATAGATGGATGGAGG + Intergenic
1113646607 13:112001839-112001861 ATGAATGCAACGATGGAATATGG - Intergenic
1113726149 13:112603829-112603851 AGGAAAGCAGAGAAGGAGGAAGG + Intergenic
1113824792 13:113243341-113243363 CTGCATGCATGGGTGGAGGAGGG + Intronic
1113901087 13:113798514-113798536 ATGAATGGAAGGATGGATGATGG + Intronic
1113901138 13:113798771-113798793 ATGAATGGAAGGATGGATGATGG + Intronic
1114287499 14:21259098-21259120 AAGAATACATAGATGAGGGATGG - Intronic
1114498001 14:23147206-23147228 ATGGATGGATAGATGATGGATGG - Intronic
1115306506 14:31939072-31939094 GTGTATGCATAAATGGTGGATGG - Intergenic
1116079062 14:40150322-40150344 ATGAATGAATGAATGAAGGAAGG - Intergenic
1116268397 14:42727190-42727212 ATGGATGGATGGATGGAAGATGG - Intergenic
1117009495 14:51455859-51455881 ATAGATGCAAAGATGGGGGAAGG + Intergenic
1117016891 14:51527353-51527375 ATGAATGAATAAACTGAGGACGG + Intronic
1117018885 14:51549199-51549221 ATGGATGGATAGATGGATGGAGG + Intronic
1118502319 14:66373362-66373384 ATGAATACATAGAAAGAGGCAGG - Intergenic
1119108610 14:71948479-71948501 ATAAATGCAGATCTGGAGGAAGG - Intronic
1119816681 14:77575208-77575230 ATTGATGCATAGATGGATGCAGG - Intronic
1120397088 14:83981807-83981829 AAGAATGCATTCCTGGAGGAGGG + Intergenic
1121062234 14:90923425-90923447 ATGGATGGATGGATGGATGATGG - Intronic
1121277444 14:92677912-92677934 ATGGATGCATGGATGGATGACGG - Intronic
1121423186 14:93830050-93830072 ATGGATGGATGGATGGTGGATGG + Intergenic
1121423210 14:93830168-93830190 ATGGATGGATAGATGGAGGAAGG + Intergenic
1121449359 14:93997616-93997638 ATAAATGCATGGATGGGGGGTGG + Intergenic
1121468362 14:94130284-94130306 ATGAGAGGATTGATGGAGGAGGG - Intergenic
1121627165 14:95394346-95394368 ATGAATGGATGGCTGGATGATGG + Intergenic
1121739969 14:96244806-96244828 ATGGATGCATGGATGGAGGAGGG - Intronic
1121786872 14:96668533-96668555 ATGAATGAACTGATGGGGGACGG - Intergenic
1121824938 14:97002450-97002472 ATGGATGGATGGATGGGGGATGG - Intergenic
1122005557 14:98700590-98700612 TGAAATGCAGAGATGGAGGAAGG + Intergenic
1122109083 14:99482431-99482453 ATGAAAGAATGGATGGATGATGG + Intronic
1122275757 14:100589956-100589978 AAGAATGCATGGATGGATGGAGG + Intergenic
1122275759 14:100589960-100589982 ATGCATGGATGGATGGAGGTGGG + Intergenic
1122365046 14:101190029-101190051 ATGAATGGTTAGATGGAGGGAGG + Intergenic
1122600704 14:102920301-102920323 GTGGATGGATAGATGGTGGATGG - Intergenic
1122600892 14:102921282-102921304 CTGAATGGATGGATGGTGGATGG - Intergenic
1122625217 14:103082025-103082047 ATGGATGGATAGGTGGTGGATGG + Intergenic
1122794194 14:104197690-104197712 ATGGATGGATAGATGAAAGATGG - Intergenic
1122813205 14:104299117-104299139 ATGGATGGATGGATGGAAGATGG - Intergenic
1123058792 14:105585134-105585156 ATGGATGGATAGATGGAAGAAGG - Intergenic
1123058861 14:105585462-105585484 ATGGATGGATGGATGAAGGATGG - Intergenic
1123083120 14:105705360-105705382 ATGGATGGATAGATGGAAGAAGG - Intergenic
1123083171 14:105705609-105705631 ATGGATGGATGGATGGATGATGG - Intergenic
1124395798 15:29300316-29300338 ATGGATGGATGGATGGATGATGG + Intronic
1125256202 15:37766376-37766398 ATAAAGGCATTGCTGGAGGATGG - Intergenic
1125431837 15:39603211-39603233 ATGAATGAATGGATGGCAGATGG + Intronic
1125588626 15:40840248-40840270 ATGAAGGCAGGGCTGGAGGAGGG + Intergenic
1125588964 15:40843184-40843206 ATGAAGGCAGGGCTGGAGGAAGG - Intergenic
1125828721 15:42696051-42696073 ATGAATGAACAGAAGGAGCAGGG - Intronic
1126174962 15:45727709-45727731 AGGATTGAATAGATGGAGCATGG + Intergenic
1126226827 15:46280468-46280490 ATAAATTCATGGATGGTGGATGG + Intergenic
1126584249 15:50267224-50267246 ATGGATGCATGGATGGTGGTTGG - Intergenic
1127324630 15:57883327-57883349 ATGACTGCAAAGAAGGAGCATGG - Intergenic
1127330200 15:57931606-57931628 AAGAAGGGAAAGATGGAGGAAGG - Intergenic
1127330206 15:57931650-57931672 AAGAAGGGAGAGATGGAGGAAGG - Intergenic
1127402487 15:58603565-58603587 ATGAAAGTAAAGATGAAGGAAGG - Intronic
1127531584 15:59848631-59848653 ATGACTCCATAGATGTAGGAAGG + Intergenic
1127764017 15:62166984-62167006 CTGAGTGAATAGATGGAGGAAGG - Intergenic
1127803144 15:62494770-62494792 ATGAATGCATGGTGGGAGCAGGG - Intronic
1128355730 15:66925173-66925195 ATGAATTCACAGATGGAGCCTGG + Intergenic
1128384734 15:67139410-67139432 ATGATTTCATTGAGGGAGGAGGG - Intronic
1128518968 15:68362911-68362933 ATGAATGGGTGGATGGATGATGG + Intronic
1128793413 15:70449151-70449173 ATGGATGGAGAGATGGAGGGAGG + Intergenic
1129720065 15:77873005-77873027 ATGAATGGATGGATGGATGGGGG + Intergenic
1130041543 15:80409216-80409238 AGGAATGAATAGGTGGAGCATGG - Intronic
1130353607 15:83111232-83111254 ATGAGTGGATGGATGGAGTATGG - Intronic
1130353615 15:83111287-83111309 ATGGATGAATTGATGGATGATGG - Intronic
1130353617 15:83111306-83111328 ATAAATGGATGGATGGATGATGG - Intronic
1130353623 15:83111339-83111361 ATGGATGAATTGATGGATGATGG - Intronic
1130353634 15:83111400-83111422 ATGAATGGATGGATGGATGATGG - Intronic
1130688031 15:86056342-86056364 ATGAATGGATACAAGGATGATGG - Intergenic
1130784898 15:87085234-87085256 ATGGATGGATAGATAGATGAGGG - Intergenic
1132019070 15:98344857-98344879 ATGAATGGATGGATGGTGGATGG + Intergenic
1132030850 15:98437694-98437716 ATGGATGGATGGATGGAGGATGG + Exonic
1132030857 15:98437721-98437743 ATGGATGGATGGATGGATGATGG + Exonic
1132030864 15:98437755-98437777 ATGAATGGATGGATGGAGGATGG + Exonic
1132030881 15:98437847-98437869 ATGGATGGATGGATGGAAGATGG + Exonic
1132030902 15:98437928-98437950 ATAGATGGATGGATGGAGGATGG + Exonic
1132030914 15:98437981-98438003 ATGGATGGATGGATGGATGATGG + Exonic
1132512207 16:349150-349172 AAGCACCCATAGATGGAGGATGG + Intronic
1132653736 16:1032936-1032958 ATGGATGGATGGATGGATGATGG - Intergenic
1132653816 16:1033321-1033343 ATGAGTGGATGGATGGATGATGG - Intergenic
1132653854 16:1033506-1033528 ATGGATGGATGGATGGATGATGG - Intergenic
1132653923 16:1033813-1033835 ATGGATGGATAGATGGATGATGG - Intergenic
1133204833 16:4227056-4227078 ATGGATGGATGGATGGATGATGG + Intronic
1133326833 16:4947077-4947099 ATGAATGGATGGATGGAGGAAGG - Intronic
1133326873 16:4947257-4947279 ATGGATGGATGGATGGAGGAAGG - Intronic
1133530914 16:6653993-6654015 ATGGATGGATGGATAGAGGAAGG + Intronic
1133563008 16:6967044-6967066 ATATATGGATAGATGGAGGGTGG - Intronic
1133617225 16:7488842-7488864 ATGAATGTATAGATAGATAATGG - Intronic
1133825110 16:9271229-9271251 AGAAATGCATGGATGGATGATGG - Intergenic
1133965929 16:10531777-10531799 ATGAATGAATGAATGGTGGATGG + Exonic
1134132378 16:11658504-11658526 ATGAATGAATGGATGCAGGCAGG - Intergenic
1134224838 16:12381747-12381769 ATGGGTGCATGGATGGATGATGG - Intronic
1134488430 16:14677723-14677745 ATGGATGGATGGATGGATGATGG + Intronic
1134488468 16:14677903-14677925 AAGAATGAATGGATGGATGATGG + Intronic
1134488469 16:14677907-14677929 ATGAATGGATGGATGATGGATGG + Intronic
1134632237 16:15765161-15765183 ATGAATAAATGGATAGAGGATGG + Intronic
1134685539 16:16155592-16155614 ATGAATGGAAGGATGGATGAGGG - Intronic
1134788004 16:16962459-16962481 ATGGATGGATGGATGGATGAAGG + Intergenic
1134848590 16:17461684-17461706 ATGCATAAATAGATGGAGGCAGG + Intronic
1135156501 16:20057565-20057587 ATGGAAGGATGGATGGAGGAAGG - Intronic
1135509171 16:23067658-23067680 ATTAGTGCGTAGAAGGAGGAAGG - Exonic
1135513679 16:23111338-23111360 ATGAATGTGGAGAGGGAGGAAGG + Intronic
1136071367 16:27789484-27789506 ATGAATGGATAGATAGTGGATGG + Exonic
1136071391 16:27789677-27789699 ATGAATGGATAGATGATGGATGG + Exonic
1136071396 16:27789700-27789722 ATGGATGGATGGATGGATGATGG + Exonic
1136071408 16:27789780-27789802 ATGAATGGATAGATAATGGATGG + Exonic
1136071450 16:27790064-27790086 ATGAATGGATAGATGATGGATGG + Exonic
1136071468 16:27790214-27790236 ATGAATGGATGGATGGATAATGG + Exonic
1136375259 16:29861635-29861657 AGGCATGCTTAGAGGGAGGATGG - Intronic
1137386142 16:48044181-48044203 ATGAATGGATGGATGGATGATGG - Intergenic
1137569421 16:49555628-49555650 ATAGATGGATAGATGGTGGATGG + Intronic
1137579717 16:49626590-49626612 GTGGATGGGTAGATGGAGGATGG - Intronic
1137579736 16:49626700-49626722 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579754 16:49626775-49626797 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579771 16:49626850-49626872 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579781 16:49626892-49626914 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579793 16:49626951-49626973 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579802 16:49626986-49627008 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579819 16:49627061-49627083 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579829 16:49627103-49627125 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579842 16:49627162-49627184 ATTGATGGGTAGATGGAGGATGG - Intronic
1137579857 16:49627229-49627251 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579868 16:49627276-49627298 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579879 16:49627323-49627345 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579891 16:49627374-49627396 ATGGATAGGTAGATGGAGGATGG - Intronic
1137579901 16:49627418-49627440 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579912 16:49627465-49627487 ATGAATGGGTAGATGGAGGATGG - Intronic
1137579924 16:49627524-49627546 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579935 16:49627568-49627590 ATGGATGGGTAGATGGAGGATGG - Intronic
1137579959 16:49627688-49627710 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580000 16:49627866-49627888 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580017 16:49627941-49627963 ATGGATGGGTAGATGGAGGATGG - Intronic
1137580028 16:49627985-49628007 ATGGATAGGTAGATGGAGGATGG - Intronic
1137580038 16:49628032-49628054 ATGGATGGGTAGATGGAAGATGG - Intronic
1137580050 16:49628091-49628113 ATGGATGGGTAGATGGAGGGTGG - Intronic
1137580061 16:49628135-49628157 ATGGATGGGTAGATGGACGATGG - Intronic
1137580085 16:49628245-49628267 ATGGATGGGTAGATGGAGTATGG - Intronic
1137601623 16:49760170-49760192 ATGGATGGATGGATGGATGAGGG + Intronic
1137625611 16:49906099-49906121 ATGGATGGATGGATGGATGATGG + Intergenic
1137811183 16:51354318-51354340 ATGAATGGATAGAGGATGGATGG - Intergenic
1137878509 16:52021258-52021280 ATGAAGGCAGAAATGGAGGGAGG - Intronic
1137995406 16:53205461-53205483 ATGACTGCTTAGATGGTGGGGGG + Intronic
1138440362 16:57030648-57030670 ATGGATGGATGGATGGATGAAGG + Intronic
1138495663 16:57407706-57407728 ATGAATGGGTTGATGGATGATGG - Intronic
1138495671 16:57407745-57407767 ATGGATGGATGGATGGATGATGG - Intronic
1138495765 16:57408309-57408331 GTGAATGGATGGATGGAGGATGG - Intronic
1138537938 16:57669679-57669701 ATGAATGCGCAAATGGAGAATGG - Intronic
1138547764 16:57729691-57729713 ATGGATGGATGGATGGATGATGG + Intronic
1138547854 16:57730050-57730072 ATGGATGGATGGATGGATGATGG + Intronic
1138748133 16:59387292-59387314 GTGCATGCAAGGATGGAGGATGG + Intergenic
1139293563 16:65879364-65879386 CTGAATGCATGGATGGAGGGTGG + Intergenic
1139982645 16:70872436-70872458 ATGGATGGATAGATGATGGATGG - Intronic
1140450742 16:75068962-75068984 CTGAATGAAGAGAGGGAGGAGGG - Intronic
1140830370 16:78745301-78745323 TTGAAGGCAGAGGTGGAGGAAGG - Intronic
1140951728 16:79824971-79824993 ATGAATGCATGGATGGTAGATGG - Intergenic
1140989247 16:80192318-80192340 ATAGATGCATAGAAGGAGAAGGG - Intergenic
1141042894 16:80687418-80687440 ATGAATGGATAGATGGATGGTGG + Intronic
1141046038 16:80716931-80716953 ATGAATGGATAGATAATGGATGG + Intronic
1141110129 16:81265418-81265440 ATGAATGGATGGATGGTGGATGG - Intronic
1141110182 16:81265620-81265642 ATGAATGGATGGATGGTGGATGG - Intronic
1141110255 16:81265956-81265978 GTGGATGGATAGATGGTGGATGG - Intronic
1141178356 16:81735318-81735340 ATGGATAGATAGATGGATGATGG + Intergenic
1141283390 16:82649300-82649322 ATGAATGCATAGATGGAGGATGG + Intronic
1141332735 16:83126959-83126981 ATGAAGGAGTAGAGGGAGGAGGG + Intronic
1141391323 16:83667070-83667092 AAGGATGGATAGATGGATGATGG + Intronic
1141421614 16:83921375-83921397 ATGGATGGATAGATGGATGGAGG + Exonic
1141421616 16:83921379-83921401 ATGGATAGATGGATGGAGGAGGG + Exonic
1141430287 16:83967756-83967778 ATGGATGGATGGATGGAGGGTGG + Intergenic
1141473642 16:84256983-84257005 ATGAACGGATGGATGGATGATGG + Intergenic
1141606498 16:85156941-85156963 ATGGATGGATGGATGGAGAAAGG - Intergenic
1141619786 16:85231001-85231023 ATGGATGGACAGATGGATGATGG + Intergenic
1141619820 16:85231182-85231204 ATGGATGGACAGATGGATGATGG + Intergenic
1141619847 16:85231335-85231357 ATGGATGGACAGATGGATGATGG + Intergenic
1141641943 16:85346612-85346634 ATGGATGGATGGATGGATGATGG + Intergenic
1141641988 16:85346821-85346843 ATGGATGGATGGATGGATGATGG + Intergenic
1141658065 16:85426598-85426620 ATGGATGGATAAATGGAAGAAGG + Intergenic
1141782909 16:86176313-86176335 ATAAATGAATACATGGGGGAAGG + Intergenic
1141854832 16:86673856-86673878 ATGAATGAGTAGATGGATGAAGG - Intergenic
1141854894 16:86674102-86674124 ATGAATGGGTAGATGGATGAAGG - Intergenic
1141854945 16:86674343-86674365 ATGGATGAAGAGATGGAGGGAGG - Intergenic
1141898262 16:86972510-86972532 ATGGATGCAGGGATGGAGGGAGG + Intergenic
1141899351 16:86980543-86980565 ATGCATGGATAGATGGATGTGGG + Intergenic
1142124194 16:88402064-88402086 ATGGATGGATAGATGGTAGATGG + Intergenic
1142124216 16:88402151-88402173 ATGGATGGAGAGATGGTGGATGG + Intergenic
1142152395 16:88518436-88518458 ATGCATGGATAGATGGATGGTGG + Intronic
1142152470 16:88518757-88518779 ATGGATGGATGGATGGATGATGG + Intronic
1142152563 16:88519134-88519156 ATGGATGGATGGATGGATGATGG + Intronic
1142244718 16:88964783-88964805 CTGGATGGATAGATGGTGGATGG - Intronic
1142244740 16:88964889-88964911 ATAAGTGGATAGATGGTGGATGG - Intronic
1142960489 17:3549427-3549449 AGGAATGTATAGCTGTAGGATGG - Intronic
1142960532 17:3549715-3549737 ATGGATGGATGGATGGAGGATGG + Intronic
1142960552 17:3549877-3549899 ATGGATGGATGGATGGAGGATGG + Intronic
1142960568 17:3549974-3549996 ATGAGTGGATAGATGATGGATGG + Intronic
1142960575 17:3550024-3550046 ATGGATGAATAGATGACGGATGG + Intronic
1143301240 17:5912083-5912105 ATGGATGAATGGATGGAAGATGG - Intronic
1143301246 17:5912118-5912140 ATGGATGAATGGATGGAAGATGG - Intronic
1143301490 17:5913855-5913877 ATGGATGGATGGATGGAAGATGG - Intronic
1143433931 17:6908773-6908795 ATGAATGCCTGCATGGAGGCTGG - Intronic
1143766321 17:9139903-9139925 ATGGATGAATGGATGGATGATGG - Intronic
1144100697 17:11939828-11939850 ATGGATGGATGGATGGATGATGG + Intronic
1144248490 17:13392309-13392331 ATGAATGAATAACTGAAGGAGGG - Intergenic
1144482846 17:15641754-15641776 ATGAATGGATGGATGGATGATGG + Intronic
1144580655 17:16457218-16457240 ATGAATGAATTTATGGATGAGGG - Intronic
1144915840 17:18723277-18723299 ATGAATGGATGGATGGATGATGG - Intronic
1145262410 17:21362340-21362362 ATGAATGGATGGATGGATGATGG + Intergenic
1145262425 17:21362479-21362501 ATGCATGGATGGATGGATGATGG + Intergenic
1145271658 17:21407990-21408012 ATGGATGGATGGATGGATGATGG - Intronic
1145819932 17:27824433-27824455 ATGGATGAAGTGATGGAGGAGGG - Intronic
1145898168 17:28472861-28472883 ATGGATGGATGGATGGATGATGG + Intronic
1145978737 17:28999103-28999125 AAGGATGGATGGATGGAGGATGG + Intronic
1146375086 17:32288421-32288443 ATGAGTGAGTAGATGAAGGAAGG + Intronic
1146489236 17:33268338-33268360 ATGGATGGATGGATGGATGATGG - Intronic
1146815754 17:35940891-35940913 ATGAATGGATAGACGAAGTATGG - Intronic
1146820918 17:35983061-35983083 ATGGATGGATGGATGAAGGAAGG - Intergenic
1146820919 17:35983065-35983087 ATGGATGGATGGATGGATGAAGG - Intergenic
1146924147 17:36732476-36732498 ATGAATGGATGGATGGATGGTGG - Intergenic
1147303760 17:39549514-39549536 AAGAATGGAGAGAGGGAGGAAGG - Intronic
1147977503 17:44256183-44256205 ATGGATGAATAGATGGATAATGG - Intronic
1148463783 17:47852334-47852356 AAGAATGCGTGGGTGGAGGACGG - Intronic
1148826637 17:50398724-50398746 ATGAATGAATGAATGAAGGAAGG + Intergenic
1149098792 17:52877963-52877985 ATGAATACAATCATGGAGGAAGG + Intronic
1149361201 17:55897701-55897723 GTGAATGCATACATGCAGAAAGG - Intergenic
1149453737 17:56770531-56770553 GTGTATGAATAGATGGATGATGG - Intergenic
1149453747 17:56770610-56770632 ATGGATGGATAGATGGATGATGG - Intergenic
1149522506 17:57328353-57328375 ATGGATGGATTGATGGATGAAGG - Intronic
1149522510 17:57328376-57328398 ATGGATGGATTGATGGATGAAGG - Intronic
1149925375 17:60697197-60697219 ATGAATGAATAAATGAGGGAGGG + Intronic
1151175022 17:72281030-72281052 GTGCATGCATAGGTGGAGGTGGG - Intergenic
1151582304 17:74987537-74987559 ATGTATGCAAAGCTGGAGGCGGG - Intergenic
1152006601 17:77686084-77686106 ATGGATGGATAGATGGAGGAAGG - Intergenic
1152033569 17:77858292-77858314 ATGACTGGATAGTTGGATGAGGG - Intergenic
1152034054 17:77861163-77861185 ATGGATGAATGGATGGAGGATGG + Intergenic
1152038018 17:77885221-77885243 ATGAATGGATGGATGGATGGAGG + Intergenic
1152038019 17:77885225-77885247 ATGGATGGATGGATGGAGGATGG + Intergenic
1152091457 17:78249864-78249886 AGGGAGGCATAGAGGGAGGAGGG + Intergenic
1152296202 17:79468374-79468396 ATGGATGCATAGACAGATGATGG + Intronic
1152301845 17:79499465-79499487 ATGAATGAATGGATGGTGGATGG - Intronic
1152434793 17:80269518-80269540 ATGGATGAATAGAAAGAGGATGG - Intronic
1152767482 17:82148995-82149017 ATGAATGGATGGGTGGTGGATGG + Intronic
1152984642 18:310716-310738 ATGAATGGATGGATGGATGCAGG - Intergenic
1153251681 18:3129136-3129158 ATGAAAGCAAACATGGATGAAGG + Intronic
1153758008 18:8302740-8302762 ATGAATGGTTAGATGGATGATGG + Intronic
1153974170 18:10252382-10252404 ATGAATGGATAGACGGATGGTGG - Intergenic
1154307813 18:13243522-13243544 ATGAGTGGATGGATGGATGATGG - Intronic
1155403573 18:25463955-25463977 ATGAATGAATGAATGAAGGAAGG - Intergenic
1155539319 18:26850728-26850750 ATGGATGGATGGATGGATGATGG - Intergenic
1155565543 18:27129994-27130016 AAGAAGGCAAAGGTGGAGGAGGG + Intronic
1155587683 18:27386428-27386450 ATGAATGGAAAAAAGGAGGAAGG - Intergenic
1155724569 18:29063758-29063780 ATGCAGACATAGATGGAGAAGGG - Intergenic
1155912118 18:31516015-31516037 ATTAATGCATAAATGGAAGGTGG + Intronic
1156471694 18:37381107-37381129 ATGGATGGATGGATGGATGATGG - Intronic
1156509223 18:37621504-37621526 ATGGATACATAGACGGAGAATGG - Intergenic
1157177590 18:45465569-45465591 ATGCATGGATGGATGGATGAAGG - Intronic
1157257813 18:46154037-46154059 GAGAATTCAAAGATGGAGGAAGG + Intergenic
1157554313 18:48603246-48603268 ATGAATGGATGGATGGATGCAGG + Intronic
1157903373 18:51542605-51542627 ATGAACGGATATATGGCGGAAGG + Intergenic
1158136079 18:54209683-54209705 GTGAAAGCAAACATGGAGGAGGG + Intronic
1158731188 18:60024346-60024368 ATGAATGTAAAGATGCAGGATGG + Intergenic
1159274014 18:66192307-66192329 ATGAAGCCACAGATGGAGGAAGG - Intergenic
1160226833 18:77018411-77018433 ATGAGTGGATAGATGGTGGGTGG - Intronic
1160502560 18:79409521-79409543 ATGAATGGATGGATGATGGATGG - Intronic
1160526659 18:79542553-79542575 ATGAATGAATGGATGGATGGTGG - Intergenic
1160526684 18:79542682-79542704 ATGAATGCATGGATGATGAATGG - Intergenic
1160681819 19:415181-415203 ATGGATGTGTAGATGGGGGATGG + Intergenic
1160681860 19:415434-415456 ATGGATGTGTAGATGGGGGATGG + Intergenic
1160926593 19:1549637-1549659 ATGGATGGATGGATGGATGAAGG - Intergenic
1160960283 19:1717886-1717908 ATTCATGGGTAGATGGAGGACGG + Intergenic
1160960326 19:1718084-1718106 ATTCATGGGTAGATGGAGGATGG + Intergenic
1161049782 19:2157095-2157117 ATGGATGGATGGATGGATGATGG - Intronic
1161105270 19:2440689-2440711 ATGAATGGATAGATGATTGAGGG - Intronic
1161242807 19:3231874-3231896 ATGAATAGATGGATGGATGATGG + Intronic
1161242828 19:3231988-3232010 ATGAATGGATGGATGGATGATGG + Intronic
1161287552 19:3476822-3476844 ATGAGTGAATAGATGGGTGATGG + Intronic
1161329088 19:3677949-3677971 AGGGATGGATGGATGGAGGATGG + Intronic
1161449207 19:4335193-4335215 ATGAGTGGATGGATGGATGATGG - Intronic
1161449218 19:4335247-4335269 ATGAATGCATGGATGGATGATGG - Intronic
1161465731 19:4429255-4429277 CTGAAGGGACAGATGGAGGAGGG - Intronic
1161489390 19:4553609-4553631 ATGGATGGATAGATGAAGGATGG + Intronic
1161632874 19:5367756-5367778 ATGAATGGATGGATGAATGAGGG + Intergenic
1161633119 19:5369343-5369365 GTGGATGAATAGATGGATGATGG - Intergenic
1161679798 19:5674068-5674090 GTGAGTGCGTAGATGGATGATGG - Intergenic
1161768977 19:6221247-6221269 ATGAATGAATGGATGGATGAGGG - Intronic
1161934503 19:7363323-7363345 GTGAATGGATAAATGGATGATGG + Intronic
1162062823 19:8107196-8107218 ATGAATGGGTAGATGGGGGATGG + Intronic
1162062871 19:8107378-8107400 ATGAATGGGTAGATGGAGAATGG + Intronic
1162062935 19:8107688-8107710 ATGAATGGGTAGATGGAGGATGG + Intronic
1162085897 19:8248924-8248946 ATGAGTGGATAGGTGGATGATGG + Intronic
1162155547 19:8675888-8675910 ATGGAGGAATAGATGGTGGATGG + Intergenic
1162155990 19:8678257-8678279 ATGCATGGATAAATGGAGGATGG - Intergenic
1162180842 19:8867693-8867715 ATGGATGGATGGATGGTGGATGG + Intronic
1162203318 19:9037031-9037053 ATGGCTGCATGGATGGAAGAAGG + Intergenic
1162315905 19:9937699-9937721 ATGTAGGCAGAGGTGGAGGAGGG + Intergenic
1162424739 19:10587629-10587651 ATCAATGAATCGATGGAAGATGG - Intergenic
1163050796 19:14682271-14682293 ATGGATGCATGGATGCATGATGG - Intronic
1163095034 19:15051049-15051071 ATTAATGGATAGATGGTAGATGG + Intronic
1163218175 19:15895988-15896010 ATGGATGGATGGATGGATGATGG - Intronic
1163238425 19:16043381-16043403 ATGGATGAATGGGTGGAGGATGG + Intergenic
1163238454 19:16043500-16043522 ATGGATGAATGGATGGAGGGAGG + Intergenic
1163382599 19:16978805-16978827 ATGGATGGGTAGATGGTGGATGG - Intronic
1163382706 19:16979295-16979317 ATGGATGAATAGATGGATGGAGG - Intronic
1163383551 19:16985299-16985321 ATGTATGGATGGATGGATGAAGG + Intronic
1163383586 19:16985456-16985478 ATGGATGGATGGATGGATGAAGG + Intronic
1163383633 19:16985655-16985677 ATGAATAGATAGATGGAGGATGG + Intronic
1163409629 19:17145936-17145958 ATGGATGGATGGATGGATGATGG + Intronic
1163462268 19:17446181-17446203 ATGGATGGATGGATGGATGAGGG - Intronic
1163571257 19:18083697-18083719 ATGGATGGGTAGATGGTGGACGG - Intronic
1163571381 19:18084271-18084293 ATGGATGGATAGATGGATGGGGG - Intronic
1163609862 19:18295226-18295248 ATGAATGGGTAGATGGTGGATGG - Intergenic
1163609997 19:18295729-18295751 ATGGATGGATGGATGGTGGATGG - Intergenic
1163703619 19:18799553-18799575 ATGAATGGATGTATGGAGGATGG + Intergenic
1164317097 19:24100494-24100516 ATGAATACATAGTTGAAGGAAGG - Intronic
1164484674 19:28644728-28644750 ATCTATGCCTAGAAGGAGGAGGG + Intergenic
1164670370 19:30068948-30068970 GTGGATGGATAAATGGAGGAAGG - Intergenic
1164678923 19:30121212-30121234 ATGAATGGATTGATGGGGGATGG - Intergenic
1164694627 19:30234047-30234069 ATGCATGAAGAGATGCAGGAAGG + Intronic
1164701403 19:30287447-30287469 ATGGGTGGATTGATGGAGGATGG + Intronic
1164706510 19:30324033-30324055 ATGGATAGATGGATGGAGGATGG - Intronic
1164797296 19:31044403-31044425 ATGGATGGATGGATGGATGAAGG + Intergenic
1164797438 19:31045301-31045323 ATGGATGGATAGATGGAGACTGG + Intergenic
1164811692 19:31162472-31162494 ATGAATGAGTAAATGGATGACGG + Intergenic
1164936513 19:32219090-32219112 ATGAATGAATAAATGAAGGAAGG + Intergenic
1165098361 19:33422785-33422807 ATGGATGGATAGATAGAGGGAGG - Intronic
1165144390 19:33722093-33722115 ATGGATGGATGGATGGATGAAGG + Intronic
1165190281 19:34057281-34057303 ATGGATGGATAGATGGGAGATGG + Intergenic
1165787073 19:38468045-38468067 ATGGATGGATGGATGGATGATGG - Intronic
1165787101 19:38468204-38468226 ATGGATGGATGGATGGATGATGG - Intronic
1165867574 19:38948446-38948468 ATGAATAAATAAATGGGGGAAGG + Intronic
1166248296 19:41546574-41546596 AAGAAATCATAGAGGGAGGAGGG - Intergenic
1166647678 19:44544195-44544217 ATGGATGGATGGATGGATGACGG - Intergenic
1166666653 19:44684192-44684214 ATGAATGCATAGTTTGGGGAAGG - Exonic
1166935600 19:46330604-46330626 ATGGATGCATGGATGGTGGATGG + Intronic
1166935606 19:46330627-46330649 ATGGATGGATGGATGGTGGATGG + Intronic
1166935621 19:46330707-46330729 ATGGATGGATGGATGGTGGATGG + Intronic
1166935641 19:46330792-46330814 ATGGATGGATGGATGGTGGATGG + Intronic
1167144159 19:47672101-47672123 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144174 19:47672163-47672185 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144182 19:47672194-47672216 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144213 19:47672316-47672338 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144221 19:47672347-47672369 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144229 19:47672378-47672400 ATGGATGGAAGGATGGAGGATGG + Intronic
1167144273 19:47672585-47672607 ATGGATGGATGGATGGAGGCAGG + Intronic
1167150947 19:47709306-47709328 ATGAATGCATTGAGGCAGGTTGG - Intergenic
1167161409 19:47769678-47769700 ATGGATGGATAGATGATGGATGG - Intergenic
1167161417 19:47769727-47769749 ATGGATGGATGGATGGATGATGG - Intergenic
1167161425 19:47769762-47769784 ATGGATGGATGGATGGATGATGG - Intergenic
1167168964 19:47818337-47818359 ATGGATGGATGGATGGATGATGG - Intronic
1167556041 19:50196364-50196386 ATAAATGGATGGATGGATGAAGG - Intronic
1167556046 19:50196394-50196416 ATGGATGGATGGATGGATGATGG - Intronic
1167598418 19:50439461-50439483 GTGAATGCATGGATGGAGCTTGG - Intronic
1167601287 19:50456289-50456311 ATGGATGGATGGATGGATGATGG - Intronic
1167634158 19:50644237-50644259 ATGACTGGATAGATGCTGGAAGG + Intronic
1167810115 19:51822336-51822358 ATGCCCGCAAAGATGGAGGAGGG + Intronic
1167945680 19:52986701-52986723 TTGAATGCAAAGATGGAGCAAGG - Intergenic
1168330880 19:55567779-55567801 GTGAATGGATGGATGGATGATGG + Intergenic
1168330890 19:55567830-55567852 GTGAATGGATGGATGGATGATGG + Intergenic
1168414260 19:56158829-56158851 AGGAATGGATAGGTGGAGGGTGG - Intronic
1168414308 19:56159028-56159050 ATGAATGTACAGATGATGGATGG - Intronic
1168414318 19:56159078-56159100 ATGAATGCATGGGTGGATGATGG - Intronic
1168414333 19:56159147-56159169 ATGAATGTACAGATGATGGATGG - Intronic
1168414337 19:56159174-56159196 ATGAATGCATGGGTGGATGATGG - Intronic
1168414352 19:56159243-56159265 ATGAATGTCTAGATGATGGATGG - Intronic
1168414362 19:56159300-56159322 ATGAATGTACAGATGATGGATGG - Intronic
1168502568 19:56905821-56905843 AGGAATGCATAGATCCAGGGGGG - Intergenic
1168508273 19:56954608-56954630 ATGGGTGGATAGATGGAGGATGG - Intergenic
1202697200 1_KI270712v1_random:133648-133670 ATGAATGCGTGGATGCAGGGTGG + Intergenic
925541185 2:4969547-4969569 ATGGATGGATGGATGGATGATGG - Intergenic
925745307 2:7038870-7038892 ATGGATGCATGGATGATGGATGG + Intronic
925745313 2:7038911-7038933 GTGGATGGATAGATGGATGATGG + Intronic
925745375 2:7039237-7039259 ATGGATGGAGAGATGGATGATGG + Intronic
925925605 2:8667993-8668015 ATGAATGGATGGATGGATGAAGG + Intergenic
925925649 2:8668234-8668256 ATAAATGAATGGATGGATGAAGG + Intergenic
925925677 2:8668372-8668394 ATGGATGGATGGATGGATGAAGG + Intergenic
926214018 2:10892604-10892626 ATGGATGGATGGATGGAAGAAGG - Intergenic
926378465 2:12259868-12259890 ATGAATGAATAAATGAATGAGGG + Intergenic
926577045 2:14593838-14593860 ATGAATGAATCTATGGAGGGAGG + Intergenic
926680648 2:15661541-15661563 ATAGATGCATGGATGGAGGGAGG - Intergenic
926698637 2:15787991-15788013 ATGGATGAATGGATGGAGTATGG - Intergenic
926808758 2:16737857-16737879 CTTGATGTATAGATGGAGGAAGG - Intergenic
927197747 2:20559732-20559754 ATGGATGGATGGATGGATGATGG + Intergenic
928177512 2:29044965-29044987 ATGGATGGATGGATGGATGATGG - Intronic
928234060 2:29524824-29524846 ATGAATGGATGGATGGTAGATGG + Intronic
930669278 2:54131351-54131373 ATCAATGAATAGATGGTGGAAGG + Intronic
930786292 2:55274450-55274472 AGGAATGCAGGGAGGGAGGAAGG + Intergenic
930892866 2:56411491-56411513 ATAAATGCCTAGAGGGAGCAGGG + Intergenic
931169179 2:59784511-59784533 ATGAATGGATGGATGGTGAATGG + Intergenic
931972339 2:67602639-67602661 ATGGATGGATGGATGGATGATGG + Intergenic
932463159 2:71896400-71896422 ATGGATGGATGGTTGGAGGAGGG + Intergenic
932912449 2:75819607-75819629 ATGAATGAATAGATGATGGATGG - Intergenic
933296807 2:80500325-80500347 ATGAATGAATAAATGGATGGTGG - Intronic
933563806 2:83924185-83924207 ATGAATGAATGGAGGGATGATGG - Intergenic
934052915 2:88225285-88225307 ATGAATGAATGGAAGAAGGAGGG + Intergenic
934133367 2:88970755-88970777 ATGAATTCAGAGAAGGAGGTGGG + Intergenic
934220207 2:90075353-90075375 ATGAATTCAGAGAAGGAGGTGGG - Intergenic
934301970 2:91781768-91781790 ATGAATGGATAGAGGGAGGGAGG - Intergenic
934613895 2:95759599-95759621 ATGAATGAATGGATGGATGGAGG + Intergenic
934613919 2:95759781-95759803 ATGAATGGATGGATGGCAGATGG + Intergenic
934613945 2:95759946-95759968 AGGAATGGATAGATGGTGGATGG + Intergenic
934646954 2:96064395-96064417 ATGAATGGATGGATGGTAGATGG - Intergenic
934646988 2:96064630-96064652 ATGAATGGATGGATGGTAGATGG - Intergenic
934647005 2:96064745-96064767 ATGAATGAATGGATGGTAGATGG - Intergenic
934840380 2:97620621-97620643 ATGAATGAATGGATGGTAGATGG - Intergenic
935264079 2:101380065-101380087 ATGAATAGATAGATGAATGATGG - Intronic
935384825 2:102488922-102488944 ATGAATGGATGGATGGATGGAGG - Intronic
935782322 2:106519059-106519081 ATGGATGGATGGATGGATGATGG - Intergenic
936243980 2:110810636-110810658 ATGGATGGATGGATGGATGATGG - Intronic
936244610 2:110815958-110815980 GTGAATGGACAGATGGATGATGG + Intronic
936615951 2:114047987-114048009 ATGGACGGATGGATGGAGGATGG - Intergenic
937207231 2:120244613-120244635 ATGGATGGATGGATGGATGAGGG - Intronic
937268490 2:120632292-120632314 ATGGATGGATGGATGGGGGACGG + Intergenic
938108034 2:128546613-128546635 ATGGATGCATGGATGGATAATGG - Intergenic
938108073 2:128546804-128546826 ATGGATGGATGGATGGAGAATGG - Intergenic
938108109 2:128546969-128546991 ATGGATGCATGGATGGATAATGG - Intergenic
938108156 2:128547180-128547202 ATGGATGGATAGATGGAGAATGG - Intergenic
938169566 2:129062963-129062985 ATGGATGGATGGATGGATGATGG - Intergenic
938581700 2:132652294-132652316 ATGAATGAATAAATGAAGGGAGG + Intronic
938737592 2:134200587-134200609 ATGAGTGAATAAATGGAGAAAGG - Intronic
939192104 2:138929193-138929215 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
939237271 2:139512219-139512241 ATGGATGAATGGATAGAGGAGGG - Intergenic
939310776 2:140472228-140472250 ATGAATGAATAAATGAATGATGG + Intronic
939454950 2:142421960-142421982 ATGAATACATAGAATGAGTATGG - Intergenic
942122034 2:172787548-172787570 ATGAATGAATAGATAAATGAAGG + Intronic
943560563 2:189456628-189456650 ATGACTGTAAAGAGGGAGGAGGG + Intronic
943657181 2:190522068-190522090 AGGAATTAATAGAGGGAGGAGGG + Intronic
944087857 2:195870112-195870134 ATGAGTGCATAAAGAGAGGAAGG - Intronic
945046308 2:205784807-205784829 AAGAAGGCATTGATGGATGAAGG - Intronic
945087909 2:206152407-206152429 ATGTATGCCTACTTGGAGGACGG + Exonic
945270055 2:207929053-207929075 CTGAATGGATAGATGGAAGGAGG - Intronic
945923910 2:215783969-215783991 ATGAATGAATAAATGATGGATGG - Intergenic
946239678 2:218345881-218345903 AGGAAAGGTTAGATGGAGGAAGG - Exonic
946672496 2:222121231-222121253 AAGAAGGAATGGATGGAGGAAGG + Intergenic
946748648 2:222870965-222870987 AAGGATGCATTGATGGAGGAGGG + Intronic
947233680 2:227918168-227918190 ATGGATGGATGGATGGATGATGG - Intronic
947812851 2:233015186-233015208 ATGGATGGATAGATGGTGGGTGG - Intronic
948067348 2:235091116-235091138 ATGGATGGATGGATGGGGGAGGG - Intergenic
948120710 2:235528323-235528345 CTGAGTGCACAGATGGTGGATGG - Intronic
948509923 2:238457327-238457349 ATGAATGCAGATATAGGGGAAGG + Intergenic
949065752 2:241989576-241989598 ATGGATGGATGGATGGTGGATGG - Intergenic
949065765 2:241989631-241989653 ATGGATGGATGGATGGTGGATGG - Intergenic
949065798 2:241989774-241989796 ATGGATGAATGGATGGTGGATGG - Intergenic
949065806 2:241989811-241989833 ATGGATGGATGGATGGTGGATGG - Intergenic
949065822 2:241989872-241989894 ATGGATGCATGGATGATGGATGG - Intergenic
949065828 2:241989902-241989924 ATGGATGCATGGATGGTGGATGG - Intergenic
949065854 2:241990011-241990033 ATGGATGGATGGATGGATGATGG - Intergenic
949065879 2:241990122-241990144 ATGGATGCATGGATGGTGGATGG - Intergenic
949065883 2:241990141-241990163 ATGGATGCATGGATGGTGGATGG - Intergenic
949065894 2:241990186-241990208 ATGGATGCATGGATGGTGGATGG - Intergenic
949065898 2:241990205-241990227 ATGGATGCATGGATGGTGGATGG - Intergenic
949065906 2:241990238-241990260 ATGGATGCATGGATGGTGGATGG - Intergenic
949065920 2:241990289-241990311 ATGGATGGATGGATGGTGGATGG - Intergenic
949065938 2:241990354-241990376 ATGGATGGATGGATGGTGGATGG - Intergenic
949065955 2:241990422-241990444 ATGGATGGATGGATGGTGGATGG - Intergenic
949065977 2:241990504-241990526 ATGGATGGATGGATGGTGGATGG - Intergenic
949065986 2:241990537-241990559 ATGGATGGATGGATGGTGGATGG - Intergenic
949065992 2:241990560-241990582 ATGGATGGATGGATGGTGGATGG - Intergenic
1168756639 20:323102-323124 ATGCATGCATGGATGGAAGAAGG + Intergenic
1168865712 20:1084717-1084739 ATGAATGAATAAATGAATGATGG + Intergenic
1170361177 20:15548084-15548106 ATGGATGAATGGATGGAGGAAGG - Intronic
1170491960 20:16886365-16886387 AGGTATGCAAAGAGGGAGGAAGG + Intergenic
1170501800 20:16982390-16982412 ATGAAGGAAGAGAGGGAGGAAGG - Intergenic
1170679588 20:18514204-18514226 ATGAATGTAGAGCTGGAAGACGG + Intronic
1170814753 20:19704195-19704217 ATGGATGGATAGATGGATGGAGG + Intronic
1171399178 20:24860730-24860752 ATGGGTGGATAGATGGAGGGAGG + Intergenic
1172203981 20:33148922-33148944 ATGGATGGATGGATGGATGATGG + Intergenic
1172615488 20:36280691-36280713 ATAAATGGATAGATGGGTGATGG - Intergenic
1172783396 20:37450540-37450562 ATGAATGAACAGATGGATGGAGG - Intergenic
1172919510 20:38469413-38469435 ATGGATGGATGGATGGATGAGGG - Intergenic
1173087697 20:39940065-39940087 ATGGATGGATAGATGGATGGAGG + Intergenic
1173556239 20:43968065-43968087 GTGAATGAATAGATGGGTGAGGG - Intronic
1173759897 20:45550205-45550227 ATGAATGCATGGATTATGGATGG + Intergenic
1173871491 20:46344859-46344881 ATGGATGGGTAGATGGATGATGG - Intergenic
1173871501 20:46344909-46344931 ATGGATGGATGGATGGATGATGG - Intergenic
1173896876 20:46557845-46557867 TTGAATGAATAAATGGAAGAAGG + Exonic
1174094429 20:48076942-48076964 TTTAATGCAGAGATGGAGGCAGG - Intergenic
1174125625 20:48303018-48303040 ATGAATGGATGGATGAAGAATGG - Intergenic
1174275508 20:49400967-49400989 ATGGATGAATAGAAGAAGGAAGG - Intronic
1174279726 20:49430471-49430493 ATGAGTGGATGGATGGATGATGG - Intronic
1174405542 20:50300714-50300736 ATAAATGGAGAGATGGATGATGG + Intergenic
1174577279 20:51545515-51545537 ATGTGTGGATAAATGGAGGATGG + Intronic
1174577288 20:51545573-51545595 ATGGATGCATGGATGGAAGATGG + Intronic
1174577307 20:51545662-51545684 ATGGATGCATGGATGGAAGATGG + Intronic
1174746952 20:53072954-53072976 ATGGAGGGATAGATGGATGAAGG - Intronic
1174747007 20:53073165-53073187 ATGGAGGGATAGATGGATGAAGG - Intronic
1174747025 20:53073241-53073263 ATGGAAGGATAGATGAAGGAAGG - Intronic
1174747037 20:53073293-53073315 ATGGATGGATGGATGGATGAAGG - Intronic
1174747054 20:53073365-53073387 ATGAATGGATGGAGGGAGGGAGG - Intronic
1174747068 20:53073433-53073455 ATGAATGGATGGATGGATGGAGG - Intronic
1175165308 20:57039329-57039351 ATGATTGGATAGATGATGGATGG + Intergenic
1175165322 20:57039411-57039433 ATGGATGGATGGATGGATGATGG + Intergenic
1175244782 20:57575363-57575385 ATGAAAGGATGGATTGAGGATGG - Intergenic
1175302558 20:57953145-57953167 AGGAATGCAGAGTTGGGGGAAGG - Intergenic
1175305296 20:57971766-57971788 AAGAATGGATGGGTGGAGGATGG + Intergenic
1175305302 20:57971789-57971811 AAGGATGGATGGATGGAGGATGG + Intergenic
1175382676 20:58574641-58574663 ATGGAGAGATAGATGGAGGAAGG - Intergenic
1175526648 20:59638959-59638981 GTGAATGGATTGATGGATGACGG + Intronic
1175687964 20:61045134-61045156 ATTGATGGATGGATGGAGGATGG - Intergenic
1175687983 20:61045213-61045235 ATGGATGAATAGACGGAGGATGG - Intergenic
1175687992 20:61045277-61045299 ATGGATGGATAGATGGTTGATGG - Intergenic
1175687995 20:61045296-61045318 ATGGATGGATGGATGGTGGATGG - Intergenic
1175754182 20:61518976-61518998 ATGAATGGATGGATGAAGGATGG - Intronic
1175754183 20:61518980-61519002 ATGGATGAATGGATGGATGAAGG - Intronic
1175770498 20:61620398-61620420 ATGGATAGATAGATGGATGATGG + Intronic
1175770505 20:61620469-61620491 ATGGATAGATAGATGGATGATGG + Intronic
1175772631 20:61633182-61633204 ATGGATGAATGGATGGAGGATGG - Intronic
1175779243 20:61671858-61671880 ATGAATGGATGGATGGATGGTGG + Intronic
1175779244 20:61671862-61671884 ATGGATGGATGGATGGTGGATGG + Intronic
1175779247 20:61671877-61671899 GTGGATGGACAGATGGAGGATGG + Intronic
1175781064 20:61682358-61682380 ATGGATGGATGGATGGTGGATGG + Intronic
1175798470 20:61787095-61787117 ATGGATGGATGGATGGATGATGG - Intronic
1175799056 20:61790661-61790683 ATGAATGGATGGATGGTGGGTGG - Intronic
1175799084 20:61790824-61790846 ATGAATGGATGGATGGTGGGTGG - Intronic
1175817239 20:61889627-61889649 ATGGATGGATAGGTGGATGATGG + Intronic
1175817250 20:61889696-61889718 ATGGATGGATAGATGATGGATGG + Intronic
1175817281 20:61889855-61889877 ATGGATGGATAGATGGATGGTGG + Intronic
1175817288 20:61889894-61889916 ATGGATGGATAGATGATGGATGG + Intronic
1175817341 20:61890180-61890202 ATGGATGGATAGATGATGGATGG + Intronic
1175817343 20:61890195-61890217 ATGGATGGATAGATGGATGTTGG + Intronic
1175817351 20:61890245-61890267 ATGGATGCATAGATGGATAATGG + Intronic
1175817363 20:61890306-61890328 ATGGATGGATAGATGGATGATGG + Intronic
1175817369 20:61890345-61890367 ATGTATGGATAGATGGATAATGG + Intronic
1175817390 20:61890444-61890466 ATGGATGGATAAATGGATGATGG + Intronic
1175817400 20:61890490-61890512 ATGGATGCATGGGTGGATGATGG + Intronic
1175984129 20:62755636-62755658 ATGAAGGCAGGGATGGAGGGAGG - Intronic
1176047147 20:63098679-63098701 ATGAATTGATGGATGGATGATGG + Intergenic
1176047158 20:63098773-63098795 GTGAATGCATGGATGGATCATGG + Intergenic
1176047174 20:63098894-63098916 GTGAATGCATGGATGGAACATGG + Intergenic
1176047190 20:63099015-63099037 GTGAATGCATGGATGGATCATGG + Intergenic
1176292271 21:5052568-5052590 AGGAATGGATGGATGGAGGGAGG - Intergenic
1176421447 21:6519466-6519488 ATGAATGAACAGATGAAGGGAGG - Intergenic
1178183496 21:30191944-30191966 ATGAATGCGAAGATGGAAGAAGG - Intergenic
1178368630 21:32008817-32008839 ATGAATGAGTAGATGATGGATGG + Intronic
1178368927 21:32010979-32011001 CTGAATACATAAATGGACGACGG - Intronic
1178619601 21:34162028-34162050 AGGAATGCAAGGATGGAAGAGGG - Intergenic
1178666274 21:34549801-34549823 ATGGATGGATGGATGGATGATGG - Intronic
1178672586 21:34604886-34604908 ATGAATGGATTGATGGAGCCAGG + Intronic
1178689667 21:34740568-34740590 ATGGATGGATGGATGGACGATGG - Intergenic
1179006741 21:37521939-37521961 CTGAAAGAATGGATGGAGGAGGG + Intergenic
1179007658 21:37529454-37529476 ATGGATGGATGGATGGAGGGAGG + Intergenic
1179017465 21:37605653-37605675 ATGGATGGATGGATGGATGAAGG - Intergenic
1179081882 21:38178977-38178999 CTGAAAGGAAAGATGGAGGATGG - Intronic
1179125936 21:38590644-38590666 ATGAATACATGGATGATGGATGG - Intronic
1179125937 21:38590648-38590670 ATGGATGAATACATGGATGATGG - Intronic
1179474764 21:41636106-41636128 ATGAATGGATGGATGATGGATGG - Intergenic
1179549152 21:42132383-42132405 ATGAGTGGATGGATGGATGATGG - Intronic
1179623673 21:42634925-42634947 ATGGATGGATAGAAGGATGATGG - Intergenic
1179623729 21:42635365-42635387 ATGGATGGATAGAAGGATGATGG - Intergenic
1179623741 21:42635471-42635493 ATGGATGGATAGAAGGATGATGG - Intergenic
1179681685 21:43026167-43026189 ATGAATGCAGAAAAGCAGGAGGG - Intronic
1179696937 21:43127782-43127804 ATGAATGAACAGATGAAGGGAGG - Intergenic
1179715331 21:43283631-43283653 ATGGATGAATAGATGATGGATGG - Intergenic
1179715348 21:43283755-43283777 ATGGATGAATAGATGATGGATGG - Intergenic
1179715408 21:43284296-43284318 ATGGATGAATAGATGATGGATGG - Intergenic
1179864989 21:44211090-44211112 AGGAATGGATGGATGGAGGGAGG + Intergenic
1180024918 21:45155630-45155652 ATGCATGGAGAGATGGATGATGG - Intronic
1180024926 21:45155700-45155722 ATGGATGAATAGATGGGTGATGG - Intronic
1180025094 21:45156336-45156358 GTGGATGGATAGATGGATGATGG - Intronic
1180025105 21:45156380-45156402 ATGGATGGATGGATGGATGATGG - Intronic
1180814459 22:18780955-18780977 ATGAATGGATAGAGGGAGGGAGG + Intergenic
1181002442 22:19994218-19994240 ATGAATGGATGGATGGGGGATGG + Intronic
1181200647 22:21215291-21215313 ATGAATGGATAGAGGGAGGGAGG + Intronic
1181482150 22:23206966-23206988 ATGGATGGATGGATGGAGGGAGG - Intronic
1181536730 22:23550160-23550182 ATGGATGGGTAGATGGATGATGG - Intergenic
1181536744 22:23550218-23550240 ATGAATGGAAAGATGGATGGAGG - Intergenic
1181737494 22:24893200-24893222 ATGAATGAATAAAGGAAGGAGGG + Intronic
1181824894 22:25507149-25507171 ATGAATAAAAGGATGGAGGATGG - Intergenic
1182006529 22:26964797-26964819 ATGAATGGATAGATAGATTAGGG - Intergenic
1182006546 22:26964873-26964895 ATGAATGGATAGATAGATTAGGG - Intergenic
1182026942 22:27127376-27127398 ATGAATGAATGAATGAAGGAGGG - Intergenic
1182047390 22:27285991-27286013 ATGAATGGATGAATGGATGATGG + Intergenic
1182099733 22:27649414-27649436 ATGGATGGATGGATGGATGATGG + Intergenic
1182862079 22:33568868-33568890 ATGGATGGATGGATGGATGATGG + Intronic
1183100062 22:35578439-35578461 ATGGATGGATGGATGGTGGATGG + Intergenic
1183106509 22:35618870-35618892 ATGGATGGATAGATGGATGGAGG - Intronic
1183106541 22:35618998-35619020 ATGGATGGATAGATGGATGGAGG - Intronic
1183141129 22:35940704-35940726 ATGAATGGATAAATGAAGTATGG + Intronic
1183262291 22:36803516-36803538 ATGGATGGACAGATGGAGGGAGG + Intronic
1183303932 22:37071974-37071996 ATGGATGGATGGATGGATGATGG + Intronic
1183303944 22:37072028-37072050 ATGAATGGATGGATGGTGGATGG + Intronic
1183303975 22:37072197-37072219 ATGAATGGATGGATGGATGATGG + Intronic
1183303979 22:37072216-37072238 ATGGATGGATGGATGGATGATGG + Intronic
1183303999 22:37072322-37072344 ATGGATGAATGGATGGATGATGG + Intronic
1183304000 22:37072326-37072348 ATGAATGGATGGATGATGGATGG + Intronic
1183304003 22:37072341-37072363 ATGGATGGATGGATGGATGATGG + Intronic
1183304027 22:37072467-37072489 ATGGATGGATGGATGGATGATGG + Intronic
1183304035 22:37072523-37072545 ATGGATGAATGGATGGATGATGG + Intronic
1183304038 22:37072542-37072564 ATGGATGAATGGATGGATGATGG + Intronic
1183304039 22:37072546-37072568 ATGAATGGATGGATGATGGATGG + Intronic
1183304042 22:37072561-37072583 ATGGATGGATGGATGGATGATGG + Intronic
1183304049 22:37072595-37072617 ATGGATGGATGGATGGATGATGG + Intronic
1183304080 22:37072749-37072771 ATGGATGGATAGATGGATGATGG + Intronic
1183304090 22:37072798-37072820 ATGGATGGATGGATGGATGATGG + Intronic
1183304094 22:37072821-37072843 ATGGATGGATAGACGGATGATGG + Intronic
1183304098 22:37072840-37072862 ATGGATGGATGGATGGATGATGG + Intronic
1183304122 22:37072980-37073002 ATGGATGGATAGATGGATGATGG + Intronic
1183304128 22:37073010-37073032 ATGGATGGATGGATGGATGATGG + Intronic
1183304142 22:37073075-37073097 ATGGATGGATAGACGGATGATGG + Intronic
1183321929 22:37170114-37170136 ATGGATGGATGGATGGATGAAGG + Intronic
1183425706 22:37738291-37738313 ATGAATGGATAGATGTGGCATGG + Intronic
1183478382 22:38049510-38049532 AGGAAAGCTGAGATGGAGGAAGG + Intergenic
1183543801 22:38444831-38444853 ATGAATGGATGGATGGATGGGGG - Intronic
1183600024 22:38834597-38834619 ATGGATGGATGGATGGATGATGG - Intronic
1184089355 22:42284119-42284141 AGGGATGGATGGATGGAGGAGGG + Intronic
1184293024 22:43508418-43508440 ATGAATGGATAGATGGGGCATGG - Intergenic
1184293036 22:43508463-43508485 ATGGATGGACAGATGGGGGATGG - Intergenic
1184293047 22:43508506-43508528 ATGGATGGATAGATGGATGGGGG - Intergenic
1184293071 22:43508583-43508605 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293145 22:43508832-43508854 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293156 22:43508867-43508889 ATGGATGGATAGATGGGGGATGG - Intergenic
1184293193 22:43508991-43509013 ATGGATGGATGGATGGGGGATGG - Intergenic
1184293202 22:43509018-43509040 ACGGATGGATGGATGGAGGATGG - Intergenic
1184293207 22:43509037-43509059 ATGGATGGATAGGTGGGGGACGG - Intergenic
1184293266 22:43509227-43509249 ATGGATGGATGGATGGGGGATGG - Intergenic
1184293283 22:43509277-43509299 ATGGACGGATAGATGGAGGATGG - Intergenic
1184293314 22:43509389-43509411 ATGGATGGGTAGATGGGGGATGG - Intergenic
1184293378 22:43509631-43509653 ATGGATGGATAGATGGGGGATGG - Intergenic
1184389421 22:44194774-44194796 ATGGATGGATAGATGATGGATGG - Intronic
1184390133 22:44199070-44199092 ATGGGTGCATAGATGGTGGGTGG - Intronic
1184410416 22:44323022-44323044 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410476 22:44323254-44323276 ATGGATGGATGGATGGTGGATGG - Intergenic
1184410502 22:44323362-44323384 ATGGATGGATGGATGGTGGATGG - Intergenic
1184460828 22:44636923-44636945 GTGGATGGATAGATGGATGATGG + Intergenic
1184460850 22:44637030-44637052 GTGAATGGATAGATGGATGATGG + Intergenic
1184460873 22:44637129-44637151 GTGAATGGATAGATGGATGATGG + Intergenic
1184715902 22:46281659-46281681 ATGAAAGCAGAGATCAAGGATGG + Exonic
1184750121 22:46480905-46480927 ATGAATGAAGAAATGAAGGATGG - Intronic
1184930765 22:47679633-47679655 ATGGATGGATGGATGGATGATGG - Intergenic
1184930769 22:47679652-47679674 ATGGATGGATGGATGGATGATGG - Intergenic
1184942727 22:47780951-47780973 ATTAATGGATGGTTGGAGGATGG + Intergenic
1184996753 22:48212786-48212808 ATGAATGGATGAATGGATGATGG - Intergenic
1184996757 22:48212821-48212843 ATGAATGGATGGGTGGATGATGG - Intergenic
1184996768 22:48212928-48212950 ATGAATGGATGGGTGGATGATGG - Intergenic
1184996775 22:48212978-48213000 ATGGATGGATGGATGGATGATGG - Intergenic
1184996781 22:48213024-48213046 ATGAATGGATTAATGGATGATGG - Intergenic
1185005498 22:48274179-48274201 ATGAATGGATGGATGGATGAAGG - Intergenic
1185018785 22:48361099-48361121 ATGGATGGATAGATGATGGATGG + Intergenic
1185018791 22:48361145-48361167 ATGAATGGATAGATAGATGATGG + Intergenic
1185018810 22:48361329-48361351 ATGAATGGATAGATAGATGATGG + Intergenic
1185018845 22:48361662-48361684 ATGGATGGATAGATGATGGATGG + Intergenic
1185018852 22:48361708-48361730 ACGAATGGATAGATGGATGATGG + Intergenic
1185053514 22:48566062-48566084 ATGGATGGATGGATGGATGATGG + Intronic
1185076692 22:48687024-48687046 ATGGATGGATTGATGGAGGATGG + Intronic
1185103657 22:48855167-48855189 GTGAATGCATGGATGGATGATGG - Intergenic
1185104360 22:48858915-48858937 ATGAATGGATGAATGGATGATGG - Intergenic
1185104366 22:48858946-48858968 ATGGATGGATAGATGATGGAGGG - Intergenic
1185104427 22:48859202-48859224 AGGGATGGATGGATGGAGGATGG - Intergenic
1185104449 22:48859291-48859313 ATGAATGGATGGATGGATGATGG - Intergenic
1185108523 22:48887690-48887712 ATGAATGGATGGATGGTGGATGG - Intergenic
1185165588 22:49260426-49260448 ATGAATGGATGGATGATGGATGG - Intergenic
1185165589 22:49260430-49260452 ATGGATGAATGGATGGATGATGG - Intergenic
1185196810 22:49476847-49476869 ATGGATGGATGGATGGTGGATGG + Intronic
1185196815 22:49476870-49476892 ATGGATGGATGGATGGATGATGG + Intronic
1185196821 22:49476893-49476915 ATGGATGGATGGATGGTGGATGG + Intronic
1185196838 22:49476961-49476983 ATGGATAGATAGATGGTGGATGG + Intronic
1185196871 22:49477125-49477147 ATGGATGGATGGATGGTGGATGG + Intronic
1185196886 22:49477190-49477212 ATGGATGGATGGATGGTGGATGG + Intronic
1185196932 22:49477385-49477407 ATGGATGGATGGATGGTGGATGG + Intronic
1185196952 22:49477460-49477482 ATGGATGGATGGATGGTGGATGG + Intronic
1185196988 22:49477593-49477615 ATGGATGGATGGATGGTGGATGG + Intronic
1185196996 22:49477630-49477652 ATGGATGGATGGATGGATGATGG + Intronic
1185197001 22:49477649-49477671 ATGGATGGATGGATGGTGGATGG + Intronic
1185197036 22:49477771-49477793 ATGGATGGATGGATGGTGGATGG + Intronic
1185197042 22:49477794-49477816 ATGGATGGATGGATGGTGGATGG + Intronic
1185197048 22:49477817-49477839 ATGGATGGATGGATGGTGGATGG + Intronic
1203226270 22_KI270731v1_random:80144-80166 ATGAATGGATAGAGGGAGGGAGG - Intergenic
1203264558 22_KI270734v1_random:6642-6664 ATGAATGGATAGAGGGAGGGAGG + Intergenic
949251720 3:1993009-1993031 ATGCATGGATAGTTGGTGGAAGG + Intergenic
949277260 3:2298853-2298875 ATTAATGCATATATGGGAGAAGG + Intronic
949845357 3:8364686-8364708 ATGAATGAATGGATGGATGAAGG - Intergenic
949970671 3:9400423-9400445 ATGATTAAAGAGATGGAGGAAGG - Intronic
950352852 3:12374210-12374232 AGGAATGAATAGGTGGAGTATGG + Intronic
950541286 3:13614801-13614823 ATAAATGGATGGATGGATGAGGG - Intronic
950574019 3:13820273-13820295 ATGAAAGAATGAATGGAGGAAGG + Intronic
950943729 3:16922839-16922861 ATGGATGCCTTGATGGAGGGTGG - Intronic
951441132 3:22725480-22725502 ATGGATGAATAAATGGTGGATGG - Intergenic
953296103 3:41718667-41718689 AGAAATGGATAGATGGATGATGG - Intronic
953827907 3:46270207-46270229 CTGGATGCATAGGTAGAGGAGGG - Intergenic
954954869 3:54510234-54510256 ATGAATGGATGAATGGATGAAGG + Intronic
954975314 3:54688449-54688471 ATGAATGAACAAATGAAGGAGGG + Intronic
955362007 3:58283697-58283719 GTTAATGCAGAGATGGAGGTTGG + Intronic
955614704 3:60794342-60794364 ATAAATGCAAAGAGGAAGGAAGG + Intronic
955824263 3:62928672-62928694 ATGGATGAATAGATGGATGGGGG + Intergenic
955877872 3:63512639-63512661 CTGAATTCAAAGCTGGAGGAAGG + Intronic
956069754 3:65435488-65435510 ATGGATGGATGGATGGAAGATGG + Intronic
956710624 3:72035613-72035635 CTGATTGCACAGATGAAGGAAGG - Intergenic
956748321 3:72327129-72327151 GTGGTTGAATAGATGGAGGATGG - Intergenic
957594001 3:82236992-82237014 AAGGATGCAAAGATGGAGAAAGG + Intergenic
957724208 3:84044035-84044057 ATTTATCCATAGATGGAGGTTGG + Intergenic
957903168 3:86523728-86523750 CTGAATTCGAAGATGGAGGATGG - Intergenic
958700787 3:97586691-97586713 ATGGATGGATAGATGATGGATGG + Intronic
959434052 3:106291284-106291306 ATGTATGCATATATGCAGCAAGG - Intergenic
959443580 3:106409423-106409445 ATGAATCTATAAATGGAAGATGG - Intergenic
959575922 3:107933630-107933652 ATCAAAGCAGAGGTGGAGGAAGG - Intergenic
959920507 3:111863074-111863096 ATAAATGCTTCGATGGGGGAGGG + Intronic
960367728 3:116794155-116794177 ATGGATGGATGGATGGATGAAGG + Intronic
960545472 3:118909581-118909603 ATTAAGGCATAGATGGAGAAGGG + Intronic
961442455 3:126961053-126961075 AGGAATGCAGGGATTGAGGAGGG + Intergenic
961670511 3:128524878-128524900 ATGTATGCATAGCCAGAGGAGGG + Intergenic
961933613 3:130559997-130560019 AGCAATGAATAGATAGAGGATGG + Intergenic
962261637 3:133912905-133912927 ATGAATGTATAAATGGTGGATGG + Intergenic
962309660 3:134316078-134316100 ATGAATGAATTGGTGAAGGAAGG - Intergenic
962543932 3:136412238-136412260 ATGAATGAATAAATGGAGAAAGG + Intronic
962804076 3:138914887-138914909 ATGGATGAATGGATGGATGAAGG + Intergenic
963059815 3:141216309-141216331 ATGAATGAATGAATGGATGATGG + Intergenic
963176886 3:142307460-142307482 CTGAATGCATTGATTGAGCAAGG + Exonic
963318525 3:143786792-143786814 ATGAATGCACAGAGGAAGCATGG + Intronic
964054188 3:152432619-152432641 AAGAATGGATAGATGGATGGAGG + Intronic
964516265 3:157511792-157511814 ATAAATACATAGATGTAGAAAGG - Intronic
965222530 3:165945113-165945135 ATAAATGGATAGATGAAAGAAGG + Intergenic
965356563 3:167681487-167681509 ATGAATGAATGGATGGATCAGGG + Intergenic
965396142 3:168162344-168162366 ATGAGTGCATAGAGGTAGGAAGG + Intergenic
965509729 3:169555196-169555218 ATGAATGAAGACATGAAGGAAGG - Intronic
966238061 3:177724896-177724918 ACAAATACATACATGGAGGAAGG - Intergenic
966256707 3:177925378-177925400 ATGAATGGTTAGATGTTGGATGG + Intergenic
967864246 3:194177331-194177353 TGGAAGGCACAGATGGAGGAAGG + Intergenic
968290049 3:197532231-197532253 ATGGATGCATGGATGATGGATGG + Intronic
968594574 4:1475729-1475751 ATGAATGGATGGAAGGATGATGG + Intergenic
968598367 4:1496901-1496923 ATGGATGGATAGGTAGAGGATGG + Intergenic
968914509 4:3491536-3491558 ATGAATGAATAGGTGGGAGAAGG - Intronic
968931178 4:3580322-3580344 ATGGTTGGATGGATGGAGGATGG - Intronic
968931215 4:3580482-3580504 ATGGATGGATGGATGGAGGATGG - Intronic
968935816 4:3609864-3609886 ATGTATGCATGGATGGATGATGG - Intergenic
968935820 4:3609895-3609917 ATGGATGAGTGGATGGAGGATGG - Intergenic
969032388 4:4225676-4225698 ATGAATGCGTGGATGCAGGGTGG - Intronic
969073727 4:4560666-4560688 ATGAATGCTTTGATGAAGGGAGG + Intergenic
969088628 4:4675432-4675454 ATGGGTGGATAGATGGATGATGG - Intergenic
969166124 4:5315628-5315650 AGGAAGGAATAGATGGAGTAAGG + Intronic
969227274 4:5807236-5807258 ATGAGTGGATGGATGGAGGGAGG + Intronic
969254339 4:5992213-5992235 ATGAATGAAGAGATGATGGAGGG + Intergenic
969424817 4:7118045-7118067 AGGAATGGATAGATGGATGGTGG + Intergenic
969424823 4:7118068-7118090 GTGGATGGATAGATGGAGGAAGG + Intergenic
969424921 4:7118550-7118572 ATGAGTGGATGGATGGATGATGG + Intergenic
969424962 4:7118741-7118763 ATGAGTGGATGGATGGATGATGG + Intergenic
969453975 4:7290658-7290680 ATGTGTGCATACATGGATGAGGG - Intronic
969499509 4:7544176-7544198 ATGGATGAAGGGATGGAGGATGG - Intronic
969510739 4:7616392-7616414 ATGGATGGATAGATGGATTATGG - Intronic
969514939 4:7641922-7641944 ATGGATGGATAGATGATGGATGG + Intronic
969514943 4:7641945-7641967 ATGAATGGATGGATGGTAGATGG + Intronic
969523049 4:7689924-7689946 GTGAATGGATGGATGGAGGATGG + Intronic
969528492 4:7716520-7716542 ATGAATAGATGGATGGTGGATGG - Intronic
969528493 4:7716524-7716546 GTGAATGAATAGATGGATGGTGG - Intronic
969528516 4:7716653-7716675 ATGAATAGATAGATGGTGGATGG - Intronic
969528517 4:7716657-7716679 ATGAATGAATAGATAGATGGTGG - Intronic
969612265 4:8234017-8234039 ATGAATGGATGGATGGATGATGG - Intronic
969612290 4:8234175-8234197 ATGAATGGATGGATGATGGATGG - Intronic
969612291 4:8234179-8234201 ATGGATGAATGGATGGATGATGG - Intronic
969640452 4:8395270-8395292 ATGGATGCATGGATGGTGGGTGG + Intronic
969674077 4:8605377-8605399 ATGAATGAATGGGTGGATGATGG - Intronic
969674088 4:8605451-8605473 ATGAATGGATGGACGGATGATGG - Intronic
969745164 4:9064989-9065011 AGGAATGCATTGCTGGGGGAAGG - Intergenic
970234955 4:13949328-13949350 AAGACTGCATGGATGGAGGGAGG - Intergenic
970689949 4:18611526-18611548 AGGAAGGGATGGATGGAGGAGGG + Intergenic
971127399 4:23769385-23769407 ATGGATGGATGGATGGATGATGG - Intronic
971128084 4:23776080-23776102 ATGAATGCATGAGTGAAGGAAGG - Intronic
971425011 4:26507485-26507507 GTGAATGGATGGATGGAAGAAGG + Intergenic
972910335 4:43808434-43808456 ATGAATGTAGAGAGGGAGGGAGG + Intergenic
973291706 4:48477522-48477544 ATGAATGTCAAAATGGAGGAGGG - Intergenic
973909765 4:55567566-55567588 ATGAATACATAGGTCAAGGAGGG - Intronic
974137787 4:57840580-57840602 ATGCACGCAGAGATGGAGGTGGG + Intergenic
975349199 4:73327373-73327395 ATGGATGCACATATGGAGGATGG - Intergenic
975462507 4:74670942-74670964 ATGAATGAATATATGAAGAAAGG + Intergenic
976075547 4:81295227-81295249 ATGGATGGATGGATGGATGATGG + Intergenic
976279777 4:83315878-83315900 AAGAATGAAGAAATGGAGGAAGG - Intronic
976413069 4:84739518-84739540 ATGAATGCCCAGAGGGAAGAAGG - Intronic
976909263 4:90280343-90280365 ATGAATGAAGAGAGAGAGGAAGG - Intronic
977113709 4:92994152-92994174 ATAGATGCAGAAATGGAGGAAGG + Intronic
977359831 4:95988070-95988092 GTGTATGCATTTATGGAGGATGG + Intergenic
977642809 4:99376274-99376296 ATGAATGAATAGATAAAGCAGGG - Intergenic
978240872 4:106514856-106514878 ATGGATAGATAGATGGATGATGG + Intergenic
979105742 4:116684580-116684602 ATGAAGGTGTAGATGCAGGAGGG + Intergenic
981638803 4:146911933-146911955 ATGTCTGCAAAGATGGAGGAAGG + Intronic
981788989 4:148514422-148514444 AAGAAAGCATATATTGAGGAGGG - Intergenic
982446135 4:155492522-155492544 ATGAAGACATAGAAGGAAGATGG + Intergenic
982485597 4:155961678-155961700 ATGAATGGATTTATGGAGGCAGG + Intergenic
982788741 4:159566055-159566077 ATGTGTGGATAGCTGGAGGATGG - Intergenic
983622127 4:169772920-169772942 CTGAATGAATGGATGGATGAAGG - Intergenic
983770244 4:171540016-171540038 ATCAATAGATAGATGGATGATGG - Intergenic
984959385 4:185080388-185080410 ATGATTGCATAGCTGTAGAATGG - Intergenic
985249404 4:188008210-188008232 AGGAATGCAGAGGTAGAGGAGGG - Intergenic
985547612 5:517901-517923 ATGGATGGATGGATGGATGATGG - Intronic
985709173 5:1418704-1418726 ATGGATGGATGGATGGATGATGG - Intronic
985709183 5:1418739-1418761 ATGGATGGATGGATGGATGATGG - Intronic
985829666 5:2219189-2219211 GTGAATGCATAGATGGGTGGAGG - Intergenic
986072880 5:4304434-4304456 CTGGATGAATAGATGGATGATGG - Intergenic
986303940 5:6501557-6501579 ATGAATGGATAGATGTTGGATGG + Intergenic
986309192 5:6539165-6539187 ATTGATGGATAGATGGATGAAGG + Intergenic
986413919 5:7509235-7509257 ATGAATGCATGCATGGTGAATGG + Intronic
988087313 5:26488289-26488311 ATGAAGGAAGAGAAGGAGGAAGG - Intergenic
988699363 5:33658033-33658055 ATGAAAGCAGAGGTTGAGGAGGG + Intronic
988999119 5:36742842-36742864 CTGACTTCAAAGATGGAGGAAGG + Intergenic
990317849 5:54601033-54601055 ATGAATGGATAGATGATTGATGG - Intergenic
990887398 5:60610148-60610170 ATGAATGAATACATGAATGAAGG + Intronic
991405419 5:66296462-66296484 AGGAATGAAGAGATGGAGCATGG - Intergenic
992085316 5:73273138-73273160 CTGAATCCACAGATGGAGGAGGG - Intergenic
992389839 5:76320296-76320318 AGGAATGAATAGATGGAGCATGG + Intronic
992462086 5:76970534-76970556 ATGGATGGATGGATGGATGACGG + Intronic
993096416 5:83484318-83484340 ATGAATAGATAGATGATGGATGG - Intronic
993096417 5:83484322-83484344 ATGGATGAATAGATAGATGATGG - Intronic
993124882 5:83821667-83821689 ATACATGCAAAGAAGGAGGAGGG - Intergenic
993881439 5:93366485-93366507 AGGAATGCAAAGATGGTGGAAGG - Intergenic
995176964 5:109189226-109189248 ATAAATGCATATATAGAAGATGG + Exonic
995288413 5:110419193-110419215 AAGAAAGCAAAGATGGAGGAAGG + Intronic
996307702 5:122068816-122068838 ATGAATAAATAAATGGAGAATGG + Intronic
996876258 5:128243597-128243619 ATGAGTGGATAGATGGATGATGG + Intergenic
997115706 5:131123778-131123800 ACGAATGCATTCCTGGAGGAAGG + Intergenic
998080534 5:139271596-139271618 AGGAGTGCAGGGATGGAGGAGGG + Intronic
998808773 5:145944518-145944540 ATGAATAAATAGAAGGAGAAAGG - Intronic
998841838 5:146262472-146262494 TTGATTGAATAGATGAAGGAAGG + Intronic
998949312 5:147375965-147375987 ATGAATGGATGGAGGGAGGCAGG - Intronic
999125094 5:149240563-149240585 ATGACAGCAGAGATGGGGGATGG - Intronic
999445012 5:151632319-151632341 ATGGATGCATGGATGGATAATGG + Intergenic
999524166 5:152384212-152384234 ATGGATAGATAGATGGATGATGG - Intergenic
999711206 5:154320154-154320176 ATGAATGGATGGATAGAGGAGGG + Intronic
999726339 5:154441361-154441383 ATGGATGGATAGATGGATGATGG - Intergenic
999746741 5:154598182-154598204 ATGGATGAATGGATGGATGATGG + Intergenic
999854503 5:155579525-155579547 ATGAATGCATGAATGGATGATGG + Intergenic
999939659 5:156528088-156528110 ATGACAGCAGAGATGGAGAAAGG + Intronic
1000948381 5:167450047-167450069 ATGGATGGATGGATGGATGATGG + Intronic
1000956463 5:167549833-167549855 ATGAATGCATAGAAGTATAATGG - Intronic
1001027320 5:168235153-168235175 ATGAATGCATTGTGGCAGGAAGG - Intronic
1001278400 5:170367518-170367540 ATGGATGGATTGATGGAGGATGG + Intronic
1001413330 5:171526009-171526031 ATGAATGGATAGGTGGATGTAGG - Intergenic
1001421442 5:171590246-171590268 ATGGATGGACAGATGAAGGATGG - Intergenic
1001435457 5:171695939-171695961 ATGGATGGATGGATGGATGATGG + Intergenic
1001686513 5:173598016-173598038 ATGGATGGATGGATGGAGGGAGG - Intergenic
1001701737 5:173711741-173711763 ATGGATGGATGGATGGATGATGG + Intergenic
1001751435 5:174134546-174134568 ATGGATGGATGGATGGATGATGG - Intronic
1001751483 5:174134820-174134842 ATGGATGGATGGATGGATGATGG - Intronic
1001865677 5:175103022-175103044 ATGAATGGATAGATGGATGATGG + Intergenic
1002067640 5:176660128-176660150 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067648 5:176660155-176660177 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067656 5:176660182-176660204 ATGGGTGAATGGATGGAGGAAGG - Intergenic
1002067664 5:176660209-176660231 ATGAGTGAATGGATGGAGGAAGG - Intergenic
1002259076 5:177981880-177981902 ATGAATGGATGGATGGATGGTGG + Intergenic
1002303300 5:178269547-178269569 ATGGATGGATGGATGGATGATGG - Intronic
1002341595 5:178519819-178519841 ATGGACAGATAGATGGAGGATGG + Intronic
1002341632 5:178520069-178520091 ATGGATGGATAGATGGAGGATGG + Intronic
1002439099 5:179255001-179255023 ATGGATGGATGGATGGATGATGG + Intronic
1002511329 5:179720406-179720428 ATGAAGACATGGATGGAGAATGG + Exonic
1003255706 6:4472998-4473020 AGGAAGGCAGAGTTGGAGGATGG - Intergenic
1003353231 6:5340640-5340662 ATAAATGCAAAGATGGAAGTAGG + Intronic
1003617804 6:7671026-7671048 ATGACAGAAGAGATGGAGGAGGG - Intergenic
1003872675 6:10414483-10414505 ATGAATGAATAGAAAGAAGAAGG + Intronic
1003972566 6:11313236-11313258 ATGAATAGATAGATGGTGGGTGG + Intronic
1004088855 6:12478949-12478971 ATGAATATATAGATGGATGAAGG + Intergenic
1004239945 6:13911917-13911939 CAAAATGCATAGATGGTGGAGGG + Intergenic
1004734719 6:18393825-18393847 ATGAATGCATAAATATGGGAGGG - Intronic
1004826597 6:19428168-19428190 ATGGATGTACACATGGAGGAAGG - Intergenic
1005484895 6:26290334-26290356 CTGAATGCAAAGATGGAACAAGG - Intergenic
1005733939 6:28727325-28727347 TGGAATGGATAGGTGGAGGAGGG + Intergenic
1005887642 6:30108900-30108922 ATGAATGCAGAGTTAGAGGTGGG + Intronic
1005925981 6:30446089-30446111 ATGAATCCAAAGATGGAAGAGGG - Intergenic
1005989657 6:30895115-30895137 ATAGATGGATAGATGGATGATGG - Intronic
1007783246 6:44265800-44265822 ATGAATGGAGTGAAGGAGGAAGG - Intergenic
1008333516 6:50271950-50271972 AGGAAGGCAAAGAAGGAGGAAGG + Intergenic
1008422134 6:51313636-51313658 ATGAATGGATGGATGATGGATGG - Intergenic
1008422135 6:51313640-51313662 ATGGATGAATGGATGGATGATGG - Intergenic
1008810863 6:55497112-55497134 ATGAATGCATAAAGGCAGCATGG + Intronic
1009762178 6:68021735-68021757 TTGAAAGTATAGTTGGAGGAAGG - Intergenic
1010373749 6:75141846-75141868 ATGGATGCAAAGATAGAAGATGG + Intronic
1010395853 6:75391165-75391187 ATGAGCGCATGGAAGGAGGAGGG - Intronic
1010466506 6:76173128-76173150 AGGAATGTATAGGTGGAGCATGG + Intergenic
1010510128 6:76708171-76708193 ATGAATAGATAGATGAATGAAGG - Intergenic
1011328193 6:86173902-86173924 ATCCAAGCATAGATGGAGGTAGG - Intergenic
1011851787 6:91638453-91638475 ATGAATGGATAGCTAAAGGAAGG + Intergenic
1012639156 6:101587401-101587423 ATGAATGGATGGATGGACGGAGG - Intronic
1013943419 6:115693255-115693277 ATGGCTTCAAAGATGGAGGAAGG - Intergenic
1015141544 6:129939856-129939878 ATGAATGAATGGATGGATGATGG - Intergenic
1015164150 6:130184752-130184774 ATGGATGAATGGATGGAAGATGG - Intronic
1015903533 6:138092296-138092318 ATGAATGCATACATGCATGAAGG + Intronic
1016317776 6:142808776-142808798 ATGAATGGATGGAGGGAGGAAGG + Intronic
1016635320 6:146282479-146282501 ATGAAAGAAAAGATGAAGGAAGG + Intronic
1017642936 6:156511988-156512010 TTGAATGCAAAGATACAGGATGG - Intergenic
1017659036 6:156656056-156656078 ATGAATGAATGGATGGATGAGGG - Intergenic
1018646300 6:165951822-165951844 TTGAATGAATAAATGGAAGAAGG - Intronic
1018853066 6:167655061-167655083 ATGGATGGATGGATGGATGATGG + Intergenic
1018853087 6:167655172-167655194 ATGAATGCCTGGGTGGATGATGG + Intergenic
1018853129 6:167655425-167655447 ATGACTGCATTGATGGATGATGG + Intergenic
1018853166 6:167655635-167655657 ATGGATGAATGGATGGATGATGG + Intergenic
1019326834 7:442639-442661 ATGAATGGATGGATGGATGGAGG + Intergenic
1019327023 7:443520-443542 ATGGATGGATGGATGGTGGATGG + Intergenic
1019345542 7:528314-528336 ATGAATGGATGGATGGATTATGG + Intergenic
1019345620 7:528871-528893 ATGGATGGATAGATGATGGATGG + Intergenic
1019345624 7:528909-528931 ATGAATGGATATATGATGGATGG + Intergenic
1019479979 7:1261893-1261915 ATGGATAGATAGATGGATGATGG - Intergenic
1019503692 7:1379584-1379606 ATGGATGGATGGATGGATGATGG + Intergenic
1019510810 7:1416372-1416394 ATGGATGGATGGATGGAGGATGG + Intergenic
1019555833 7:1630894-1630916 ATAAATGGATGGATGGTGGATGG - Intergenic
1019704490 7:2491068-2491090 ATGGATGGATGGATGGGGGATGG - Intergenic
1019704562 7:2491351-2491373 ATGGATGGATGGATGGGGGATGG - Intergenic
1019704598 7:2491469-2491491 ATGGATGGATGGATGGATGATGG - Intergenic
1019777421 7:2920558-2920580 ATGGATACGTAGATGGATGATGG - Intronic
1019777424 7:2920662-2920684 ATGGATACATAGATGATGGATGG - Intronic
1019914668 7:4125069-4125091 ATGGATGGATGGATGGATGATGG + Intronic
1019914705 7:4125246-4125268 ATGAATGGATGGATGGGTGATGG + Intronic
1019932055 7:4230295-4230317 ATGAATGAATTGATGAAGGAAGG + Intronic
1020382068 7:7557527-7557549 ATGAATGCCCACATGGAGGCAGG + Intergenic
1021246700 7:18271911-18271933 ATGCATCCATAAATGAAGGAAGG + Intronic
1021506207 7:21388373-21388395 AGGAATGAATAGGTGGAGCATGG - Intergenic
1021926848 7:25542166-25542188 ATGAAGTCATAGAGGTAGGAGGG - Intergenic
1022219088 7:28294493-28294515 ATGAATGCATGGATGAATGGAGG + Intergenic
1022267054 7:28767220-28767242 ATAAATGCATACATGGAACAGGG - Intronic
1022327073 7:29342180-29342202 ATGAATGGGTAGATGGATGAGGG + Intronic
1022477237 7:30719598-30719620 ATGGATGGATGGATGGATGATGG - Intronic
1022797509 7:33743976-33743998 ATGAAGGGAAAGATTGAGGAAGG - Intergenic
1022908979 7:34882095-34882117 ATGAATGGATGGATGGATGATGG + Intergenic
1023754959 7:43407794-43407816 ATGAATGGAGGGAAGGAGGAGGG - Intronic
1024920799 7:54552533-54552555 ATGAATGAATAAATGAAGCATGG - Intronic
1025120103 7:56294618-56294640 ATGAATGGATGGATGGTTGATGG + Intergenic
1025120123 7:56294731-56294753 ATGAATGGATGGATAGTGGATGG + Intergenic
1025120134 7:56294787-56294809 ATGAATGGATGAATGGTGGATGG + Intergenic
1026203538 7:68235740-68235762 ATGAATGGATGGAAGGTGGATGG + Intergenic
1026203561 7:68235896-68235918 ATGAATGAATGGATGGATGAAGG + Intergenic
1026203569 7:68235926-68235948 ATGAATGGATGCATGGTGGATGG + Intergenic
1026275188 7:68870217-68870239 ATGGATGGATAGATGGATGATGG + Intergenic
1026275213 7:68870372-68870394 ATGAATGGATGGATGATGGATGG + Intergenic
1026319638 7:69257610-69257632 ATGGATGGATGGATGGATGACGG + Intergenic
1026333078 7:69370121-69370143 TTGAATGAATAAATGAAGGAAGG - Intergenic
1026589032 7:71680307-71680329 AGGAAGGGATAGAGGGAGGAAGG - Intronic
1026903429 7:74049419-74049441 ATAAATGGATGGATGGATGAGGG - Intronic
1026903439 7:74049470-74049492 ATAGATGGATAGATGGTGGATGG - Intronic
1026903473 7:74049625-74049647 ATGGAGGAATAGATGGTGGATGG - Intronic
1026904276 7:74053907-74053929 ATGAATGGGTAGATGGATGAGGG + Intronic
1027569556 7:79847241-79847263 ATGGATGCAGAGCTGGAAGAGGG - Intergenic
1028214390 7:88113864-88113886 AGGAATGCATGAATGGAGGTAGG + Intronic
1028311128 7:89337249-89337271 ATGAAAGCGTAGAGGGAAGAGGG + Intergenic
1029045767 7:97626503-97626525 ATGAATGGATGGATGGATGGAGG + Intergenic
1029321765 7:99768547-99768569 TTGCATGCATAGAGGAAGGATGG - Intronic
1029599728 7:101556647-101556669 ATGGATGGATGGATGGATGATGG + Intronic
1029604804 7:101592117-101592139 ATGGATGGATGGATGGAGGGAGG - Intergenic
1029604820 7:101592212-101592234 ATGAGTGGATGGATGGTGGATGG - Intergenic
1029604861 7:101592455-101592477 ATGGATGGATGGATGGATGATGG - Intergenic
1029673098 7:102047481-102047503 ATGAAGGGAGAGATGGAGGGAGG + Intronic
1030075635 7:105733929-105733951 ATGGATGGATGGATGGATGATGG - Intronic
1030519211 7:110576525-110576547 AGGTATGCAAAGATTGAGGAGGG - Intergenic
1030807583 7:113936616-113936638 GTGAATGCAGGCATGGAGGAAGG - Intronic
1030848362 7:114451560-114451582 ATGAATGAATAAGTGAAGGAAGG - Intronic
1030942411 7:115670448-115670470 ATGAATGCATGGATGAATGATGG + Intergenic
1031106579 7:117550809-117550831 ATGAAGGCAGAGTTAGAGGAAGG + Intronic
1031828723 7:126599952-126599974 ATGAATGGATGAATGGTGGATGG + Intronic
1031888486 7:127265849-127265871 ATGGATGCATGGATGGATGATGG + Intergenic
1031922588 7:127612751-127612773 ATGGATGGATGAATGGAGGATGG + Intronic
1032725167 7:134584350-134584372 ATGAATGGATGGATGGAGGGAGG + Intergenic
1032725206 7:134584528-134584550 AAGGATGGATAGATGGAGGGAGG + Intergenic
1032990619 7:137390856-137390878 ACCAATGCATAGGGGGAGGATGG + Exonic
1034883634 7:154780991-154781013 ATGAGTGAATGGATGGATGATGG + Intronic
1034883651 7:154781084-154781106 ATTAATGGATAGAGGGATGATGG + Intronic
1035278884 7:157765135-157765157 ATGGATGGATGGATGAAGGATGG - Intronic
1035279030 7:157765788-157765810 GTGAGTGAATGGATGGAGGAAGG - Intronic
1035279089 7:157766047-157766069 ATGGATGGATGGATGGAGGAAGG - Intronic
1035279134 7:157766247-157766269 AAGGATGGATGGATGGAGGAAGG - Intronic
1035279151 7:157766328-157766350 ATGGATGGATGGATGAAGGAAGG - Intronic
1035279155 7:157766347-157766369 ATGGATGGGTAGATGGATGATGG - Intronic
1035279181 7:157766477-157766499 ATCAATGGATGGATGGAGGAAGG - Intronic
1035288554 7:157822215-157822237 ATGAGTGTATAGATGGATAATGG - Intronic
1035288587 7:157822445-157822467 ATGAGTGGATAGATGGATGATGG - Intronic
1035288608 7:157822611-157822633 ATGAAAGGGTAGATGGATGATGG - Intronic
1035288681 7:157823073-157823095 ATGCATGCATGGATGGATGATGG - Intronic
1035576426 8:709824-709846 CTGTATGCATGGATGGATGATGG - Intronic
1036662984 8:10720297-10720319 ATGAATGGATGGATGGAGAGTGG + Intergenic
1037087812 8:14874834-14874856 TTGAATGGATAACTGGAGGAAGG - Intronic
1037307044 8:17516018-17516040 ATGAATGGCAAGATGTAGGAAGG - Intronic
1037598690 8:20375276-20375298 ATGGATGGATGGATGGTGGATGG - Intergenic
1037669733 8:21004051-21004073 ATAGATGGATAGATGGAGGATGG + Intergenic
1037921301 8:22808079-22808101 ATGAATGGATGGATAGAGGTTGG - Intronic
1038120468 8:24608692-24608714 ATGAATGAATGAATGGACGAAGG - Intergenic
1038325130 8:26567235-26567257 GTGGATGGATAGATGGATGATGG - Intronic
1038440769 8:27569564-27569586 ATGGATGGATGGATGGATGAAGG + Intergenic
1038440910 8:27570180-27570202 ATGGATGGATGGATGGATGAAGG + Intergenic
1038440918 8:27570216-27570238 ATGGATGCATGGATGGATGAAGG + Intergenic
1040584392 8:48726256-48726278 ATGGATGGATAGATAGATGATGG - Intronic
1040740392 8:50567952-50567974 ATGAATACAGAGATACAGGAAGG - Intronic
1041010257 8:53534936-53534958 ATGGATGGATGGATGGATGATGG + Intergenic
1041307161 8:56473235-56473257 TTGGATGCACAGATGGAGGCCGG + Intergenic
1041413749 8:57584678-57584700 ATGAATGAATGAATGGAGAACGG + Intergenic
1041738796 8:61137931-61137953 ATGAATGAATGAATGGAGGCAGG - Intronic
1042215343 8:66425437-66425459 ATGGATGGATGGATGGATGAAGG + Intergenic
1042964324 8:74334560-74334582 ATGAGTGGATAGATGGTGGGTGG - Intronic
1043376678 8:79657359-79657381 ATGTATGCATGTATGGGGGAGGG - Intronic
1043860427 8:85310176-85310198 ATGAATGTATAGATGAACTAAGG - Intergenic
1044789973 8:95837302-95837324 ATGAATGAATAGATGAATCAAGG - Intergenic
1045711558 8:104990481-104990503 ATGAAGGCATAGATGAAGAAAGG - Intronic
1046112171 8:109738478-109738500 ATGGATGGATGGATGGATGAGGG - Intergenic
1046734227 8:117759155-117759177 ATAAGTGGATACATGGAGGAAGG + Intergenic
1046735345 8:117770507-117770529 AAGAAAGCAAAGATGAAGGAAGG - Intergenic
1047306781 8:123659075-123659097 ATGGATGGATAGATGGATGATGG - Intergenic
1047306784 8:123659094-123659116 ATGAATGGATGGATGGATGATGG - Intergenic
1047306802 8:123659191-123659213 ATGGATGGATAGATGGATGATGG - Intergenic
1047306808 8:123659225-123659247 ATGGATGGATTGGTGGAGGATGG - Intergenic
1047306814 8:123659248-123659270 ATGGATGGATAGATGATGGATGG - Intergenic
1047306844 8:123659401-123659423 ATGGATGGATAGATGGATGGAGG - Intergenic
1047306871 8:123659547-123659569 ATGAATGGATAGATGATGGATGG - Intergenic
1047306881 8:123659605-123659627 ATGGATGGATAGATGATGGATGG - Intergenic
1047306889 8:123659670-123659692 ATGAATGGATAAATGATGGATGG - Intergenic
1047306897 8:123659744-123659766 ATGGATGGATGGATGGATGATGG - Intergenic
1047306905 8:123659779-123659801 ATGAATGGATAGATGATGGATGG - Intergenic
1047306935 8:123659973-123659995 ATGGATGAATAGATGATGGATGG - Intergenic
1047756432 8:127922567-127922589 ATGAATGCAAGGATGGAGGTAGG - Intergenic
1048059987 8:130909033-130909055 ATGGATGGATGGATGGTGGATGG - Intronic
1048232173 8:132653206-132653228 ATGGATGGATAGATGGAAGAAGG + Intronic
1048289839 8:133172288-133172310 ATGAATGAATGGATGATGGATGG - Intergenic
1048297016 8:133221903-133221925 ATTAATGGATGGATGGAGGATGG + Intronic
1048297048 8:133222117-133222139 ATGGATGGATGGATGGAGGATGG + Intronic
1048517999 8:135127807-135127829 ATGGATGCATGGATGGCTGAGGG + Intergenic
1048598225 8:135889554-135889576 ATAAATGAATGAATGGAGGAAGG + Intergenic
1048979739 8:139696917-139696939 GTGGATGGATAGATGGATGAAGG + Intronic
1048989541 8:139753155-139753177 ATGGATGGATGGATGGTGGATGG - Intronic
1049042130 8:140120567-140120589 ATGAATGGATGGATGGATGTTGG - Intronic
1049042164 8:140120731-140120753 ATGAATGGATGGATGGATGTTGG - Intronic
1049042168 8:140120758-140120780 ATGAATGGATGGATGTTGGATGG - Intronic
1049042169 8:140120762-140120784 ATGAATGAATGGATGGATGTTGG - Intronic
1049042173 8:140120789-140120811 ATGAATGGATGGATGGATGTTGG - Intronic
1049042181 8:140120835-140120857 ATGGATGGATGGATGGATGATGG - Intronic
1049348210 8:142150195-142150217 ATAAATGGATGGATGGATGATGG + Intergenic
1049348277 8:142150522-142150544 ATAAATGGATGGATGGATGATGG + Intergenic
1049348313 8:142150734-142150756 ATGGATGGATGGATGGACGATGG + Intergenic
1049350698 8:142163007-142163029 ATTGATGTATAGATGGAGGATGG + Intergenic
1049350808 8:142163603-142163625 ATGAATTGATAGATGGATGGAGG + Intergenic
1049350867 8:142163930-142163952 ATGGGTGGATGGATGGAGGATGG + Intergenic
1049350926 8:142164221-142164243 ATGGATGGATGGATGGATGAAGG + Intergenic
1049359770 8:142206968-142206990 ATGAATGCATAGATAGGGGATGG + Intergenic
1049359831 8:142207190-142207212 ATGGATGCATAGATGGGGGATGG + Intergenic
1049359964 8:142207692-142207714 ATGGATGAATAGATGGGGGATGG + Intergenic
1049364290 8:142229244-142229266 ATGAATGGATGGATGGTGGATGG + Intronic
1049364302 8:142229294-142229316 ATGGATGGATGGATGGTGGATGG + Intronic
1049371973 8:142272301-142272323 GTGGATGGGTAGATGGAGGAAGG - Intronic
1049464101 8:142743356-142743378 ATGGATGGATGGATGGGGGATGG + Intergenic
1049464417 8:142744451-142744473 ATGGGTGGATAGATGGGGGATGG + Intergenic
1049464629 8:142745148-142745170 AAGGATGGATGGATGGAGGATGG + Intergenic
1049474724 8:142791466-142791488 ATGGATGCATGGATGGATGGAGG - Intergenic
1049474756 8:142791674-142791696 ATGACTGGATGGATGGAGGATGG - Intergenic
1049474813 8:142791975-142791997 ATGACTGGATGGATGGAGGATGG - Intergenic
1049474926 8:142792728-142792750 GTGAATGGATGAATGGAGGATGG - Intergenic
1050213136 9:3287631-3287653 ATGAATGGATGGATGAATGATGG - Intronic
1051322516 9:15923261-15923283 ATCAATGGATGGATGGATGAAGG + Intronic
1051556119 9:18384486-18384508 ATGAGGGCATTGAAGGAGGAAGG - Intergenic
1051709171 9:19912514-19912536 ATGGTTAGATAGATGGAGGAAGG - Intergenic
1052014417 9:23448182-23448204 ATGAATGAATAAATTAAGGAAGG - Intergenic
1052528803 9:29655897-29655919 CTGAATGCAAAGATGGAACAAGG - Intergenic
1052617531 9:30860831-30860853 ATGGATGGATAGATGGATGGAGG + Intergenic
1053802979 9:41775744-41775766 ATGGATGGATGGATGGTGGATGG - Intergenic
1053802980 9:41775748-41775770 ATGAATGGATGGATGGATGGTGG - Intergenic
1054142279 9:61539358-61539380 ATGAATGGATGGATGGATGGTGG + Intergenic
1054142280 9:61539362-61539384 ATGGATGGATGGATGGTGGATGG + Intergenic
1054454367 9:65422002-65422024 ATGTATGCATGGATGGATGATGG + Intergenic
1054458884 9:65451342-65451364 ATGGATGGATGGATGGATGATGG + Intergenic
1054458905 9:65451432-65451454 ATGGATGGATGGATGGAGGATGG + Intergenic
1054458943 9:65451600-65451622 ATGGATGGATGGATGGAGGATGG + Intergenic
1054462028 9:65470509-65470531 ATGAATGGATGGATGGATGGTGG + Intergenic
1054462029 9:65470513-65470535 ATGGATGGATGGATGGTGGATGG + Intergenic
1054955447 9:70904485-70904507 AAGAGTGCAAAGAAGGAGGAGGG + Intronic
1055399578 9:75908842-75908864 AAGGATGCATGGATGGCGGATGG - Intronic
1055448089 9:76403196-76403218 GTGAATGAATGGATGAAGGAAGG - Intergenic
1056125861 9:83536439-83536461 ATGAATGTGTAGATGATGGAGGG - Intronic
1056135482 9:83625918-83625940 ATGGATGGATGGATGGAAGACGG + Intronic
1056438387 9:86595754-86595776 ATGAATCCATACATGAAGGCAGG + Intergenic
1056490904 9:87105984-87106006 ATGAAAGAAAAGAGGGAGGAAGG + Intergenic
1057008701 9:91583223-91583245 CTGGATGGATGGATGGAGGATGG + Intronic
1059252200 9:112895688-112895710 ATGAATAGACAGATGGATGATGG - Intergenic
1059254955 9:112921446-112921468 TTCAAAGCATAAATGGAGGATGG + Intergenic
1059365505 9:113783693-113783715 ATAGATGAATAGATGGATGATGG + Intergenic
1059409111 9:114120969-114120991 ATGGATGGATGGATGGTGGATGG + Intergenic
1059416404 9:114165340-114165362 ATGGATGGATGGATGGATGATGG - Intronic
1059858949 9:118435288-118435310 ATGAATGGGTAGAAGGATGATGG - Intergenic
1060154662 9:121310924-121310946 ACAAATGCATAGATGCAGGTGGG + Intronic
1060834562 9:126745355-126745377 ATTAATACAGAGATGGAGCAAGG + Intergenic
1061036808 9:128118768-128118790 AGGGATGCAGAGATGGAGGATGG + Intergenic
1061244642 9:129395144-129395166 ATGGGAGGATAGATGGAGGATGG + Intergenic
1061244648 9:129395190-129395212 ATGAAAAAATGGATGGAGGATGG + Intergenic
1061244988 9:129397005-129397027 ATGGATGGAAGGATGGAGGATGG + Intergenic
1061245102 9:129397533-129397555 ATGGATGGGTAGATGGATGATGG + Intergenic
1061256674 9:129457476-129457498 ATGGATGGATGGATGGATGATGG + Intergenic
1061371402 9:130199624-130199646 ATGACAGCATGGAGGGAGGATGG - Intronic
1061417446 9:130454783-130454805 ATGGATGGATGGATGGATGATGG - Intronic
1061417458 9:130454829-130454851 ATGGATGGATGGATGGATGATGG - Intronic
1061417477 9:130454914-130454936 ATGAATGGATGGATGGATAATGG - Intronic
1061417483 9:130454945-130454967 ATAGATGGATAGATGGATGATGG - Intronic
1061417487 9:130454972-130454994 ATGGATGAATGGACGGAGGATGG - Intronic
1061417491 9:130454991-130455013 GTGAATGGATGGATGGATGATGG - Intronic
1061417498 9:130455025-130455047 ATGAATGGATGGATGATGGATGG - Intronic
1061417499 9:130455029-130455051 ATGGATGAATGGATGGATGATGG - Intronic
1061417502 9:130455048-130455070 ATGGATGGATGGATGGATGATGG - Intronic
1061417511 9:130455094-130455116 ATGGATGGATAGACGGATGATGG - Intronic
1061417514 9:130455113-130455135 ATGGATGAATAAATGGATGATGG - Intronic
1061417516 9:130455132-130455154 ATGGATGGATGGATGGATGATGG - Intronic
1061417534 9:130455250-130455272 ATGGATGGATAGATGATGGATGG - Intronic
1061417559 9:130455394-130455416 ATGGATGGATGGATGGGGGATGG - Intronic
1061507720 9:131040945-131040967 ATGAGTGGATGGATGGAGGGAGG + Intronic
1061680069 9:132238633-132238655 ATGAATGCATGGATGGACGCTGG - Intronic
1061911797 9:133728956-133728978 ATAGATGGAGAGATGGAGGACGG + Intronic
1061950533 9:133933543-133933565 ATGGATGGATGGATGGTGGATGG + Intronic
1061950538 9:133933562-133933584 ATGGATGGATGGATGGTGGATGG + Intronic
1061950597 9:133933828-133933850 ATGGATGGATGGATGGTGGATGG + Intronic
1061950625 9:133933937-133933959 ATGGATGGATGGATGGTGGATGG + Intronic
1061981030 9:134103739-134103761 ATGGATGGATAGATGGATGCTGG - Intergenic
1061981052 9:134103846-134103868 ATGGATGGATAGATGGATGCTGG - Intergenic
1061981085 9:134104006-134104028 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981101 9:134104077-134104099 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981184 9:134104430-134104452 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981191 9:134104467-134104489 ATGGATGGATGGATGGTGGATGG - Intergenic
1061981249 9:134104706-134104728 ATGGATGGATGGATGGTGGATGG - Intergenic
1062092308 9:134684890-134684912 GTGAATGGATAGATGGTGGATGG - Intronic
1062092317 9:134684933-134684955 ATGGATGAATGGATGGTGGATGG - Intronic
1062092322 9:134684956-134684978 ATTAATGGATGGATGGTGGATGG - Intronic
1062092328 9:134684987-134685009 ATTAATGGATGGATGGTGGATGG - Intronic
1062092341 9:134685049-134685071 ATGGATGGATGGATGGTGGATGG - Intronic
1062092354 9:134685095-134685117 ATGAATGGATGGATGGTGGATGG - Intronic
1062092368 9:134685157-134685179 ATGAATGGATGGATGGTGGATGG - Intronic
1062092369 9:134685161-134685183 ATGAATGAATGGATGGATGGTGG - Intronic
1062092399 9:134685301-134685323 ATGAATGGATGGATGGTGGATGG - Intronic
1062092419 9:134685391-134685413 ATTAATGGATGGATGGTGGATGG - Intronic
1062092430 9:134685445-134685467 ATGGATGGATGGATGGATGATGG - Intronic
1062092459 9:134685580-134685602 ATGGATGGATGGATGGAGGATGG - Intronic
1062092471 9:134685629-134685651 ATGCATGGATGGATGGTGGATGG - Intronic
1062092472 9:134685633-134685655 ATGGATGCATGGATGGATGGTGG - Intronic
1062092488 9:134685707-134685729 ATGGATGGATAGATGGATGATGG - Intronic
1062092506 9:134685793-134685815 ATGGATGGATAGATGGATGATGG - Intronic
1062092529 9:134685899-134685921 ATGAATGGATGGATGGATGGTGG - Intronic
1062092538 9:134685934-134685956 ATGGATGGATGGATGGTGGATGG - Intronic
1062092820 9:134687455-134687477 ATGAATGGATGGATGGATGATGG - Intronic
1062103550 9:134740584-134740606 CTGGATGGATAGAAGGAGGACGG - Intronic
1062172226 9:135141240-135141262 ATGGATGGATGGATGGATGATGG + Intergenic
1062172238 9:135141335-135141357 ATGAATGGACAGATGATGGATGG + Intergenic
1062172241 9:135141350-135141372 ATGGATGGATAGATGAGGGATGG + Intergenic
1062172270 9:135141566-135141588 ATGAGTGGACAGATGGATGATGG + Intergenic
1062172282 9:135141651-135141673 ATGGATGGATAGATGATGGATGG + Intergenic
1062172296 9:135141736-135141758 ATGGATGGATAGATGATGGATGG + Intergenic
1062172306 9:135141799-135141821 ATGGATGGATAGATGATGGATGG + Intergenic
1062201235 9:135303907-135303929 ATGGATGGATAAATGGAGGGTGG + Intergenic
1062201269 9:135304090-135304112 ATGAATGGATAGACAGATGATGG + Intergenic
1062201320 9:135304333-135304355 ATGAGTGGATAGATGGATGATGG + Intergenic
1062201331 9:135304386-135304408 ATGAGTGGATAGATGAATGATGG + Intergenic
1062201342 9:135304435-135304457 ATGAATGGATAGATGGATGATGG + Intergenic
1062201371 9:135304545-135304567 ATGAGTGGATGGATGGATGATGG + Intergenic
1062201393 9:135304644-135304666 ATGAGTGGATAGATGGATGATGG + Intergenic
1062247967 9:135579329-135579351 ATGGGTGGATAGATGGTGGATGG - Intergenic
1062248010 9:135579607-135579629 AAGAATGGATGGATGGAAGATGG - Intergenic
1062274546 9:135724499-135724521 ATGCCTGCATACGTGGAGGAAGG - Intronic
1062281326 9:135753106-135753128 ATGGATGGAGAGATGGATGATGG + Intronic
1062520696 9:136956669-136956691 ATGGATGGATGGATGGATGATGG + Intronic
1062609005 9:137364734-137364756 GTGAATGCATTGATGGAGGTGGG - Intronic
1185481895 X:452689-452711 ATGATAGAATAGATGGATGATGG - Intergenic
1185503921 X:618696-618718 ATGAATGGATGAATGGATGAAGG + Intergenic
1185543743 X:925356-925378 ATGGATGGATGGATGGTGGATGG + Intergenic
1185543748 X:925375-925397 ATGGATGGATGGATGGTGGATGG + Intergenic
1185546998 X:953845-953867 CTGAATGAATGGATGGATGAGGG - Intergenic
1185611416 X:1395598-1395620 ATGGATGGATGGATGGATGATGG + Intergenic
1185629963 X:1508678-1508700 ATGGATGGATGGATGGATGATGG - Intronic
1185630011 X:1509340-1509362 ATGGATGGATGGATGGATGATGG - Intronic
1185633070 X:1530082-1530104 ATGGATACATAGATGGATGACGG - Intronic
1185638903 X:1575471-1575493 ATGAATGAACAGATGATGGATGG + Intergenic
1185639257 X:1577641-1577663 ATGGATGGATGGATGGATGATGG + Intergenic
1185744350 X:2560044-2560066 ATGGATGTATATATGGATGATGG + Intergenic
1185744368 X:2560175-2560197 ATGGATGGATATATGGATGATGG + Intergenic
1185744374 X:2560206-2560228 ATAAATGGGTAGATGGATGATGG + Intergenic
1185780599 X:2841432-2841454 ATGGATGGATGGATGGATGATGG + Intronic
1185837418 X:3358106-3358128 ATAGATGGATATATGGAGGATGG - Intergenic
1185840504 X:3385246-3385268 ATGAATGGATAGATAGGTGATGG + Intergenic
1185840520 X:3385577-3385599 ATGAATGGATGGATGAAAGACGG + Intergenic
1185840705 X:3388111-3388133 ATGAATGGATAAATAGATGATGG - Intergenic
1185867852 X:3639265-3639287 ATGGATGGATGGATGGATGAAGG + Intronic
1185883520 X:3761207-3761229 ATGAATGTATGGATGGATGAGGG + Intergenic
1185883547 X:3761449-3761471 ATGAATATATAGATGGAACATGG + Intergenic
1186001900 X:5021914-5021936 ATGGATGAATGGATGGAAGATGG - Intergenic
1186002030 X:5023561-5023583 ATGAATGGATGGATGGATGGTGG - Intergenic
1186055577 X:5646182-5646204 ATGGATGGATGGATGGATGATGG - Intergenic
1186150435 X:6669189-6669211 ATGAATGGATAGATTGATGATGG + Intergenic
1186150470 X:6669474-6669496 ATGAATGAATGGATGGAGAGTGG + Intergenic
1186178642 X:6951213-6951235 ATGGATGGATGGATGGATGATGG - Intergenic
1186213403 X:7273801-7273823 ATGAATGCATGGATGGGGGCAGG - Intronic
1186400700 X:9256822-9256844 TAAAATGCATAGATGGATGATGG + Intergenic
1187708376 X:22029720-22029742 ACAAATGGATAGATGGGGGATGG - Intergenic
1187716776 X:22110601-22110623 ATGGCTGCATAGAGGGAGGGGGG - Intronic
1188465075 X:30470502-30470524 AAGAATGCATAGACTGATGATGG - Intergenic
1189301303 X:39954510-39954532 ATGAATGAACAAATGAAGGAAGG + Intergenic
1190257897 X:48777589-48777611 ATGAAGGAATAGAAGAAGGAAGG + Intergenic
1191669107 X:63732525-63732547 ATTAAGGCATAGCTTGAGGAAGG - Intronic
1192235733 X:69294383-69294405 ATGAATGCATACATGCATGAAGG - Intergenic
1193061471 X:77212612-77212634 GTGAATGCTTAGAGGGAGGCAGG + Intergenic
1193853997 X:86576043-86576065 ATGAATGAATGGATGAAGAAAGG - Intronic
1193915669 X:87359796-87359818 ATGAATGAAAAAATGAAGGAAGG + Intergenic
1194217387 X:91147892-91147914 ATGAACACAGACATGGAGGATGG - Intergenic
1194786486 X:98090876-98090898 GTGAAAGCAAAGATGGAGAAGGG + Intergenic
1195416442 X:104625173-104625195 ATGCATGGATGGATGGAGGATGG - Intronic
1195416443 X:104625177-104625199 ATGGATGCATGGATGGATGGAGG - Intronic
1196650126 X:118159915-118159937 ATGGATGGATGGATGGAGAATGG + Intergenic
1197882207 X:131178561-131178583 ATGAATGTATGAATGGAGCAGGG + Intergenic
1198579419 X:138047493-138047515 ATGAGTGAATAAATGAAGGAGGG + Intergenic
1198954521 X:142113260-142113282 ATGGATGAATAGATGGAACACGG - Intergenic
1199081041 X:143577150-143577172 ATTGATGCATAGATGGAGGGTGG + Intergenic
1199664041 X:150082575-150082597 GTGACTGAATAGATGGATGAGGG + Intergenic
1200553901 Y:4611684-4611706 ATGAACACAGACATGGAGGATGG - Intergenic
1200781575 Y:7221077-7221099 ATGGATGAATGGATGGATGATGG + Intergenic
1200781948 Y:7224705-7224727 GTGAATGGATAGATGGGTGATGG - Intergenic
1201235489 Y:11906555-11906577 ATGAATGAATGGATGAAAGATGG - Intergenic
1201238382 Y:11933705-11933727 ATAGATGGATAGATAGAGGATGG + Intergenic
1201289495 Y:12408927-12408949 ATAAATGGATAGATAGATGATGG - Intergenic
1201305896 Y:12550326-12550348 ATGGATGCATGGATGATGGATGG + Intergenic
1201954101 Y:19602112-19602134 AAGAATGCAGTGATGGAGGAAGG + Intergenic