ID: 1141284687

View in Genome Browser
Species Human (GRCh38)
Location 16:82660536-82660558
Sequence CGGGCTGTTTCTGTTTTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141284687_1141284696 26 Left 1141284687 16:82660536-82660558 CCTGGCAAAACAGAAACAGCCCG No data
Right 1141284696 16:82660585-82660607 TGACAACCTAGGGCCCAGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 153
1141284687_1141284695 25 Left 1141284687 16:82660536-82660558 CCTGGCAAAACAGAAACAGCCCG No data
Right 1141284695 16:82660584-82660606 ATGACAACCTAGGGCCCAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 109
1141284687_1141284693 16 Left 1141284687 16:82660536-82660558 CCTGGCAAAACAGAAACAGCCCG No data
Right 1141284693 16:82660575-82660597 GAAAGAAAGATGACAACCTAGGG 0: 1
1: 0
2: 1
3: 34
4: 365
1141284687_1141284692 15 Left 1141284687 16:82660536-82660558 CCTGGCAAAACAGAAACAGCCCG No data
Right 1141284692 16:82660574-82660596 TGAAAGAAAGATGACAACCTAGG 0: 1
1: 0
2: 1
3: 28
4: 415
1141284687_1141284694 22 Left 1141284687 16:82660536-82660558 CCTGGCAAAACAGAAACAGCCCG No data
Right 1141284694 16:82660581-82660603 AAGATGACAACCTAGGGCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141284687 Original CRISPR CGGGCTGTTTCTGTTTTGCC AGG (reversed) Intronic
No off target data available for this crispr