ID: 1141284689

View in Genome Browser
Species Human (GRCh38)
Location 16:82660555-82660577
Sequence TTCACTTCATCTCTGGCCTC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 328
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 297}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141284689_1141284695 6 Left 1141284689 16:82660555-82660577 CCCGAGGCCAGAGATGAAGTGAA 0: 1
1: 0
2: 1
3: 29
4: 297
Right 1141284695 16:82660584-82660606 ATGACAACCTAGGGCCCAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 109
1141284689_1141284694 3 Left 1141284689 16:82660555-82660577 CCCGAGGCCAGAGATGAAGTGAA 0: 1
1: 0
2: 1
3: 29
4: 297
Right 1141284694 16:82660581-82660603 AAGATGACAACCTAGGGCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 125
1141284689_1141284696 7 Left 1141284689 16:82660555-82660577 CCCGAGGCCAGAGATGAAGTGAA 0: 1
1: 0
2: 1
3: 29
4: 297
Right 1141284696 16:82660585-82660607 TGACAACCTAGGGCCCAGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 153
1141284689_1141284693 -3 Left 1141284689 16:82660555-82660577 CCCGAGGCCAGAGATGAAGTGAA 0: 1
1: 0
2: 1
3: 29
4: 297
Right 1141284693 16:82660575-82660597 GAAAGAAAGATGACAACCTAGGG 0: 1
1: 0
2: 1
3: 34
4: 365
1141284689_1141284692 -4 Left 1141284689 16:82660555-82660577 CCCGAGGCCAGAGATGAAGTGAA 0: 1
1: 0
2: 1
3: 29
4: 297
Right 1141284692 16:82660574-82660596 TGAAAGAAAGATGACAACCTAGG 0: 1
1: 0
2: 1
3: 28
4: 415
1141284689_1141284700 21 Left 1141284689 16:82660555-82660577 CCCGAGGCCAGAGATGAAGTGAA 0: 1
1: 0
2: 1
3: 29
4: 297
Right 1141284700 16:82660599-82660621 CCAGGAGGGAAGCTTCCAGAAGG 0: 1
1: 1
2: 5
3: 36
4: 327

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141284689 Original CRISPR TTCACTTCATCTCTGGCCTC GGG (reversed) Intronic
901015091 1:6224753-6224775 TTTACTTACACTCTGGCCTCGGG + Exonic
903204395 1:21769805-21769827 TTCACTGCAGCCTTGGCCTCTGG - Intronic
903212743 1:21827987-21828009 TCCACTTCATCTCTGTCTTGGGG - Intronic
904543269 1:31248441-31248463 TTCAGTTCAAGTCTGCCCTCAGG + Intergenic
905866134 1:41377724-41377746 TTCACCTCCTCCATGGCCTCTGG + Intronic
906910605 1:49944464-49944486 ATCACTACAGCTCAGGCCTCAGG + Intronic
907934316 1:59028541-59028563 TTCAGTTCCTCTCATGCCTCTGG - Intergenic
908671041 1:66547999-66548021 TTCCCTTCCTCACTGGTCTCTGG - Intronic
909352880 1:74674453-74674475 ATGACTTGATCTCTGGCCTCAGG + Intergenic
909495459 1:76272668-76272690 TTCTCTTCATCTCTATCATCAGG + Intronic
911969078 1:104407638-104407660 TTCATGTTCTCTCTGGCCTCAGG + Intergenic
912271995 1:108220875-108220897 TTTACTTCTCCTCTGGCCTTTGG - Intergenic
912389504 1:109292566-109292588 TTCACTTCATTGCTGGGCACTGG + Exonic
912723724 1:112041337-112041359 CTAGCCTCATCTCTGGCCTCTGG + Intergenic
912954914 1:114148557-114148579 GTCACTTGCTCCCTGGCCTCTGG - Intronic
913110106 1:115649931-115649953 TTCACTTCTCCTCTGCCATCAGG - Intronic
914959224 1:152191411-152191433 TTCTCTTCACCTCTGGCCCAGGG + Intergenic
915338045 1:155159128-155159150 TTGACTTCATCCCTGCCCTCAGG + Intergenic
916482631 1:165228826-165228848 TTAAAGTCATTTCTGGCCTCTGG - Intronic
917311338 1:173682155-173682177 TTAACTGCATCTCTGAGCTCTGG + Intergenic
917758943 1:178134235-178134257 TTTACTTCCTCTCTGGCTTTTGG + Intronic
918760423 1:188397445-188397467 TTCCCTTCACCTCAGGCCTCGGG - Intergenic
920417473 1:205808492-205808514 TTCAGTTCACCTCTGGACCCTGG + Intronic
921149235 1:212386481-212386503 TTCTCCTCATCCCTGCCCTCTGG + Intronic
921426005 1:215001787-215001809 TTCACTTCCCCTCTTGGCTCTGG + Intergenic
922460184 1:225809928-225809950 TTCTCTCCATTTCTGGCCGCGGG + Intergenic
923456657 1:234170681-234170703 TTGTTTTCAGCTCTGGCCTCAGG - Intronic
923740293 1:236648315-236648337 CTCACTGCATCCCTGACCTCCGG - Intergenic
924015332 1:239715042-239715064 TTCACTCTTTCTCTGGCTTCAGG - Intronic
1063523056 10:6758375-6758397 TTCACTTCCTCTTGGGACTCTGG + Intergenic
1063632451 10:7746658-7746680 TTCACTTCCATGCTGGCCTCTGG - Exonic
1063870568 10:10412412-10412434 TTCAGATCATCCGTGGCCTCTGG + Intergenic
1064194386 10:13233540-13233562 TTGACCTCATCTCTGGACTTGGG + Exonic
1064506505 10:16036310-16036332 CTCACTTCCTCTCTGGATTCTGG + Intergenic
1064941022 10:20735563-20735585 TTCCTTTAATCTCTGGCTTCTGG - Intergenic
1064954289 10:20890544-20890566 TTCAGTTCTTCTCTGCGCTCAGG - Intronic
1065797011 10:29317179-29317201 TTCACTTCCTCTCTCCCCTATGG + Intronic
1067234386 10:44435956-44435978 TCCCCTGCATCTGTGGCCTCCGG + Intergenic
1067509199 10:46881464-46881486 TTCCCTTCCCCTTTGGCCTCAGG - Intergenic
1067653054 10:48170391-48170413 TTCCCTTCCCCTTTGGCCTCAGG + Intronic
1068328959 10:55536609-55536631 TTCACTTCCTCTCTCACCTGGGG + Intronic
1069189355 10:65467459-65467481 TTGACTTCATCTCTTGCATCTGG - Intergenic
1069283639 10:66686667-66686689 TTTACCTCATCTCTGGTCCCAGG - Intronic
1070308137 10:75252235-75252257 TTGACTTCAGATCTGGCCTCTGG - Intergenic
1070308315 10:75253715-75253737 TCCAGTTCATTTCTGGCCTCTGG - Intergenic
1070771057 10:79082568-79082590 TTCCTTCCCTCTCTGGCCTCAGG - Intronic
1072044042 10:91637083-91637105 TTCACTTCCCCACTTGCCTCTGG - Intergenic
1072227536 10:93384229-93384251 CCCACTTCCTCTCTGCCCTCAGG + Intronic
1073918414 10:108431866-108431888 TTCCCTTCACCTCTGTCCTTCGG + Intergenic
1075223330 10:120602990-120603012 TGCTCTTCATCCCTGGCCCCAGG + Intergenic
1076633273 10:131865845-131865867 TTCACTGCAGCTCTGGCCCCAGG + Intergenic
1077611274 11:3644480-3644502 TCCACCTCCTCTCTGGCTTCAGG + Intergenic
1078382177 11:10852783-10852805 TTTACTTCATCTCTGGTATTTGG - Exonic
1078739092 11:14049926-14049948 TTCAAAACATATCTGGCCTCAGG + Intronic
1080852475 11:36081751-36081773 TTCTCTTCATCGCTGCCATCGGG - Exonic
1081373923 11:42337397-42337419 TTCACATCCTCTGTAGCCTCAGG - Intergenic
1083718663 11:64593204-64593226 TTCCCTTTGGCTCTGGCCTCGGG + Intronic
1083886917 11:65577431-65577453 GGCACTTGAACTCTGGCCTCTGG + Intronic
1084649734 11:70482138-70482160 TGCTCTTCATCTTTGTCCTCTGG + Intronic
1085966343 11:81532364-81532386 TTAACTTCAGCTTTGACCTCAGG + Intergenic
1086043766 11:82509105-82509127 TTCACTTCTTCTGTGGCGACGGG - Intergenic
1088714923 11:112540487-112540509 ATCACACCATCTCTGGCCTTGGG + Intergenic
1089083078 11:115793888-115793910 ATCACTGCATTTCTGGCCTCTGG + Intergenic
1089272983 11:117314873-117314895 TTCAGTTCCCCTCTGGCCTGGGG + Intronic
1089371232 11:117959815-117959837 TTCTGTTCATCTCTCTCCTCTGG - Intergenic
1090278185 11:125434055-125434077 TTCCCTGCATCACTGCCCTCAGG + Intergenic
1090327237 11:125899635-125899657 TTCTCTTCATCACTGGCTTTCGG - Exonic
1091092876 11:132789237-132789259 TTTATTTCATGTCTGGCTTCAGG + Intronic
1091312066 11:134581669-134581691 TACATTTTATCTCTGGCCCCTGG + Intergenic
1091714758 12:2768809-2768831 CTCACTCCATATCTGGCATCAGG + Intergenic
1096116939 12:49060369-49060391 CTCCCTTCCCCTCTGGCCTCGGG + Intergenic
1096699330 12:53371716-53371738 TTCTCCTCAACTCTGGACTCTGG + Intergenic
1096816729 12:54206383-54206405 TTCATCTCATCTCTGTTCTCTGG - Intergenic
1098238139 12:68438384-68438406 TCGTCTTCATCTCTGGCCTGAGG + Intergenic
1101238881 12:102818232-102818254 TTTCCTGTATCTCTGGCCTCAGG + Intergenic
1103431855 12:120894590-120894612 TTCCCTTCATCTGAGGCCTCAGG - Intronic
1103512372 12:121484167-121484189 TTCTTTGCCTCTCTGGCCTCTGG - Intronic
1104913039 12:132249197-132249219 TTCATTTCTTCTGAGGCCTCAGG + Intronic
1107053368 13:36076688-36076710 TTCTCTTCTTCCCTGGCATCAGG - Intronic
1107117160 13:36759696-36759718 ATCTCTTCATTTCTGTCCTCTGG + Intergenic
1108018128 13:46097233-46097255 CACACTTCATCTCTGCCATCAGG - Intronic
1108068425 13:46602873-46602895 TTCACTGCAGCACTGACCTCCGG - Intronic
1108138064 13:47386508-47386530 TTCACTTCAGCCCTGGCTCCTGG + Intergenic
1108558593 13:51620876-51620898 TCCACTTCCTCTCTTGCCTCTGG + Intronic
1108697493 13:52915440-52915462 GTAACTTCATTTATGGCCTCTGG - Intergenic
1109627208 13:64991672-64991694 GTCACTACAGCTCTGGGCTCAGG - Intergenic
1110148096 13:72218568-72218590 TTCATTTCTTCTCTTGGCTCAGG + Intergenic
1110604652 13:77418020-77418042 AGCACTTCATCACTGACCTCAGG - Intergenic
1110937199 13:81305821-81305843 TTCACTCCATCTCTGGCAAAAGG - Intergenic
1113536845 13:111074723-111074745 TTCACTTCCTCTTTGCCTTCTGG + Intergenic
1114004844 14:18301258-18301280 ATCACTGCAGCTCTGGGCTCTGG - Intergenic
1118749686 14:68796424-68796446 TGCACTTCCTCTCAGGCTTCAGG + Intergenic
1120941387 14:89953729-89953751 TCTACTTCATCTCTGGGCTGAGG + Intronic
1121485161 14:94309094-94309116 TTCCCTCTATCTCTGACCTCAGG - Intronic
1123060442 14:105591987-105592009 TCCACGTCATGTCTGGCCTGTGG + Intergenic
1123084920 14:105712958-105712980 TCCACGTCATGTCTGGCCTGTGG + Intergenic
1124271199 15:28282160-28282182 TTCACCTCATCGCTGGCAGCTGG - Intronic
1124844165 15:33274711-33274733 GTCACTTCATCCCTAGCTTCGGG - Intergenic
1126648631 15:50899662-50899684 TTCACCTTATCTCTGGACTCTGG + Intergenic
1126700781 15:51365668-51365690 TACACTACACCTTTGGCCTCAGG + Intronic
1126767562 15:52024339-52024361 TTGACTTCATCTCAGTCCTACGG + Intronic
1126795914 15:52260332-52260354 TTCAGTCCACCTCTGGCCGCTGG + Intronic
1127679823 15:61282680-61282702 TCCTCTTCATTTCTGGCATCTGG - Intergenic
1127949071 15:63786739-63786761 TTCCCTTCCTCTCCAGCCTCTGG - Intronic
1128302614 15:66576145-66576167 TTCACTGCATCTCTGCCTCCTGG + Intergenic
1128618823 15:69131757-69131779 TTCACTTCCTCTCTGGGACCAGG + Intergenic
1129049767 15:72770854-72770876 CTGAGTTCATCTCTGGCTTCTGG + Intronic
1129063559 15:72881207-72881229 TTCACTTTCTCTCTGTCTTCGGG - Intergenic
1130122480 15:81063032-81063054 TTCCTTTCCTCTCTGGCTTCAGG + Intronic
1132837246 16:1960091-1960113 TCCACTGCACCGCTGGCCTCAGG + Intronic
1134329844 16:13240820-13240842 TTTATTTCCTGTCTGGCCTCTGG + Intergenic
1134330332 16:13244987-13245009 CTCACTGCATCTTTGACCTCTGG + Intergenic
1136581214 16:31152067-31152089 CTCCCTTGAACTCTGGCCTCTGG - Intergenic
1136653831 16:31696801-31696823 TCCTCTTCAAATCTGGCCTCTGG - Intergenic
1137599253 16:49744702-49744724 TTCACTTGACCTTTGGCCTGTGG - Intronic
1137795575 16:51214935-51214957 TTCACTTTATCCCAGGCCTTGGG - Intergenic
1139441921 16:66972673-66972695 TTCTCCTCCTCTGTGGCCTCTGG - Exonic
1139577151 16:67848785-67848807 ATCTCTGCAGCTCTGGCCTCAGG + Intronic
1139585020 16:67896874-67896896 TGCACTTCACCTCAGGCATCTGG + Intronic
1141254933 16:82392098-82392120 TCCACTACATCAATGGCCTCAGG - Intergenic
1141284689 16:82660555-82660577 TTCACTTCATCTCTGGCCTCGGG - Intronic
1141746243 16:85928523-85928545 GTCACTTTATTTCTGGGCTCAGG - Intergenic
1143645016 17:8224286-8224308 GTCACCTCTTCCCTGGCCTCAGG + Intergenic
1144234986 17:13251561-13251583 TACACTTCAGCTGTGCCCTCAGG - Intergenic
1145861120 17:28211340-28211362 TTGTCTTCAACTCTGACCTCAGG - Intergenic
1148549374 17:48541685-48541707 TCCCCTTCTTCCCTGGCCTCTGG + Intronic
1148857251 17:50585531-50585553 GTCACTGCCTCTCTGCCCTCAGG - Intronic
1150417841 17:65001827-65001849 CTCACTTCAGTTCTTGCCTCCGG + Intergenic
1150616455 17:66776158-66776180 GCCTCTTCCTCTCTGGCCTCAGG - Intronic
1151023703 17:70651880-70651902 CTCACTTCATCTCTGCCTCCTGG + Intergenic
1151090853 17:71438784-71438806 GACCCTTCATCTGTGGCCTCAGG + Intergenic
1151682578 17:75629640-75629662 TTCACTTCCCCTCTGCCCTCAGG - Intronic
1152063991 17:78100024-78100046 TTGACTTCATATCTCGCATCTGG + Intronic
1153550475 18:6257268-6257290 TTTAGTTCCTCTCTGCCCTCTGG - Intronic
1155618067 18:27744199-27744221 TCCACTTCATTTCTGGCACCTGG + Intergenic
1155977206 18:32143624-32143646 GTCACACCATCACTGGCCTCTGG - Intronic
1156235694 18:35201946-35201968 TACTCTTCACTTCTGGCCTCCGG + Intergenic
1156936129 18:42709859-42709881 TTCAGTTCATCACTGGCCTTTGG - Intergenic
1157403581 18:47405705-47405727 CTCACTGCACCACTGGCCTCTGG - Intergenic
1159213908 18:65365252-65365274 TTTTCTTCCTCTCTGTCCTCTGG + Intergenic
1160492468 18:79349794-79349816 TTCAGGTCCTCTCTGTCCTCTGG + Intronic
1161608947 19:5230206-5230228 TTCATTTCTTCTCTGGGCTTAGG + Intronic
1162867585 19:13560522-13560544 TTCACTTCCCCTCTCGCCTATGG + Intronic
1163491881 19:17621666-17621688 ATCACTTCATCTCTGACTTCTGG + Intronic
1164950954 19:32336533-32336555 TTCATTTCATCTCTCCCCTATGG - Intergenic
1165738884 19:38194035-38194057 TGGACTTCTTCTCTGGTCTCAGG - Intronic
1166131664 19:40749508-40749530 TTCACATCTTCTCTGCCCTTGGG + Exonic
1166184155 19:41128532-41128554 TTCTCTGCCTCTCTGGCTTCAGG - Intergenic
1166235904 19:41456149-41456171 TTCATCTCGTGTCTGGCCTCAGG - Intergenic
1167198101 19:48044654-48044676 GTCACTCCAACACTGGCCTCTGG + Intergenic
1167213724 19:48150001-48150023 TTCGCAGCATCTCAGGCCTCTGG + Intronic
1167762558 19:51458610-51458632 TTCTCACCCTCTCTGGCCTCAGG - Intergenic
1167900942 19:52621904-52621926 TTCACTTCCTCCCTAGCTTCTGG + Intronic
925206675 2:2013262-2013284 GTCACTTCTTCCCTGGACTCAGG + Intronic
925818519 2:7776866-7776888 TTCATTTCTCCTCTGGCTTCTGG + Intergenic
926351774 2:12002022-12002044 TTCACCTCATCCTTGACCTCAGG + Intergenic
926392884 2:12412224-12412246 TTCACTGCAGCTTTGACCTCAGG + Intergenic
926771882 2:16385423-16385445 TTCCTTTCATCTCTGGGCCCAGG + Intergenic
927246058 2:20958034-20958056 GTCTCTGCATCCCTGGCCTCGGG + Intergenic
929133804 2:38603278-38603300 TTCACTCCACGCCTGGCCTCGGG - Intronic
933899064 2:86836245-86836267 TTCATTTCAGTTCTGGCCTCAGG + Intronic
935469465 2:103439587-103439609 GTCACTTCAGCTCTGGCCTCAGG + Intergenic
935584025 2:104784634-104784656 TCCACTGCATCTCTGCCCTGAGG - Intergenic
935781487 2:106512981-106513003 TTCATTTCAATTCTGGCCTCAGG - Intergenic
937251795 2:120528516-120528538 CCCACTTCCTCTCTGACCTCAGG - Intergenic
940511443 2:154620426-154620448 TCCACTGCTTCTCAGGCCTCAGG - Intergenic
940839064 2:158558611-158558633 TTCTCTTCAACTCTGTCATCTGG - Intronic
941540052 2:166770923-166770945 TTCAGTTCATCTCTGACTTTTGG - Intergenic
941882068 2:170491279-170491301 TTGATTTTTTCTCTGGCCTCTGG + Intronic
941926668 2:170902444-170902466 CTCCCTTTATCTCTGGCTTCTGG + Intergenic
942148811 2:173054472-173054494 TTAACTGCATCTCCTGCCTCAGG - Intergenic
943971612 2:194415647-194415669 GTTACTACAGCTCTGGCCTCAGG - Intergenic
944814828 2:203364806-203364828 CTCACTGCATCTTTGGCTTCTGG + Intronic
946028943 2:216690304-216690326 TTCCCTTCTGCTCTGGCCCCTGG + Intronic
946490023 2:220139670-220139692 TCACGTTCATCTCTGGCCTCTGG + Intergenic
1169202349 20:3717939-3717961 TCCACTTCTGCTCCGGCCTCTGG - Intergenic
1169267191 20:4173986-4174008 TCAATTTCATGTCTGGCCTCTGG + Intronic
1170789902 20:19499041-19499063 CTCACTGCCTGTCTGGCCTCTGG - Intronic
1170918902 20:20656943-20656965 TTGTCTTCATCTCTCGCATCTGG - Intronic
1171323106 20:24264439-24264461 TTGACTTGATCTCTGGCTTCTGG - Intergenic
1172940219 20:38649022-38649044 TGGACTTCATCCCTGGCCTAGGG + Intronic
1173263388 20:41456677-41456699 TTTCCTTAATCTCTGGGCTCAGG - Intronic
1175834629 20:61985718-61985740 CTCACTTCTCCTCAGGCCTCAGG - Intronic
1175941848 20:62541053-62541075 TTCCCTTCATCCCTGGGCTCAGG + Intergenic
1176085026 20:63292025-63292047 TCCAGCTCATCTCTTGCCTCTGG + Intergenic
1176108303 20:63399708-63399730 CTCTGCTCATCTCTGGCCTCTGG - Intergenic
1176258603 20:64166993-64167015 CTCCCTTCCTCTCTGGCCTGGGG + Intronic
1177393128 21:20501932-20501954 TTGACTTCATGTCTCGCATCTGG + Intergenic
1177537147 21:22442771-22442793 TTCTCTTCATCTCTGACCAATGG - Intergenic
1177589399 21:23143555-23143577 TTAACTGCATCTCTGATCTCTGG + Intergenic
1178461498 21:32806565-32806587 TTAACTTCATCTGTGCCCTCTGG + Intronic
1180168068 21:46040359-46040381 CTCACTTCACCTCTGGCACCAGG + Intergenic
1180429358 22:15232048-15232070 ATCACTGCAGCTCTGGGCTCTGG - Intergenic
1180995060 22:19961473-19961495 TTCTCTTCTGCTCTGTCCTCTGG + Intronic
1181047416 22:20222160-20222182 TGCACTGCAGCTCTGGCCTCTGG + Intergenic
1183505086 22:38204157-38204179 TTCATCTCATCCCTGGCATCTGG - Intronic
1184240454 22:43208959-43208981 TTCACTTCAGCTCAGGCTTGTGG + Intronic
1184795315 22:46728778-46728800 TTATCTCCAGCTCTGGCCTCGGG + Intronic
949249989 3:1972528-1972550 TTCACTTAATCTATGGCCCTAGG - Intergenic
950180371 3:10908681-10908703 AGCACTCCATCTCTGTCCTCAGG - Intronic
950384119 3:12643120-12643142 AACACTGCATCTCTGTCCTCAGG + Intronic
950959795 3:17093728-17093750 CTCACTGCAACTCTTGCCTCAGG + Intergenic
952013999 3:28935245-28935267 TTCATTTCAACTCTAGCCTGTGG + Intergenic
952126716 3:30309339-30309361 TTCTCTTGATCTTTGGCCTTAGG - Intergenic
955370232 3:58344890-58344912 CTCCCTTCAGGTCTGGCCTCCGG - Intronic
956412996 3:68997716-68997738 GTCACTGAATCTCTGGCCTTTGG + Intronic
956623516 3:71244932-71244954 CTCACTTCATCTGAGGGCTCTGG - Intronic
959328717 3:104974056-104974078 TTCCCTTCATCCCCAGCCTCTGG + Intergenic
960860605 3:122148902-122148924 TTGATTTCCTCTCTGGCCTGTGG + Intergenic
961344715 3:126256530-126256552 TTCCCTTCTCCTCTGGCCCCAGG - Intergenic
961591029 3:127982111-127982133 TTCCTTTCCTCTCTGGCTTCTGG + Intronic
961884131 3:130084703-130084725 ATCCCTTCATCTCAGCCCTCTGG - Intronic
963937678 3:151071297-151071319 TTCACATCAGTTCAGGCCTCAGG + Intergenic
966641336 3:182194049-182194071 ATCACTGCATCTTTGGCGTCTGG - Intergenic
966896834 3:184451423-184451445 CTCACTTCACCTCTGCCTTCTGG + Intronic
967231567 3:187342307-187342329 TTCCTTTCTTCTCTGGTCTCTGG - Intergenic
967268334 3:187711968-187711990 CTCCCTTCATCTCTAACCTCTGG - Intronic
967535349 3:190595598-190595620 TTGACTTAGTCTCTAGCCTCAGG + Intronic
967665500 3:192167317-192167339 TTCACCTCTCCTCTGCCCTCTGG + Intronic
967785476 3:193489119-193489141 TTCAAGCCATCTCTGTCCTCTGG - Intronic
968348352 3:198030873-198030895 GGGACTTCATCTCTGCCCTCAGG + Intronic
968921771 4:3525917-3525939 CTCTCATCAACTCTGGCCTCGGG + Intronic
969146114 4:5125545-5125567 CTCCCTGCATCGCTGGCCTCAGG - Intronic
969252097 4:5974645-5974667 TGCTCTTTCTCTCTGGCCTCAGG - Intronic
970074732 4:12204758-12204780 TTTCTTTCATCTCTGACCTCTGG + Intergenic
970488154 4:16544965-16544987 CTCTCTCCATCTCTTGCCTCAGG - Intronic
974375570 4:61071805-61071827 TTCTCTGCACCTCTGTCCTCTGG + Intergenic
974563402 4:63552727-63552749 TTTACTTCATGTCTCGCCTCTGG + Intergenic
976494915 4:85716968-85716990 CTCTCTTGATCTCTGGCTTCAGG - Intronic
977141640 4:93380368-93380390 TTGATTTCATATCTGTCCTCTGG + Intronic
979150591 4:117309541-117309563 TTCTCTTGATTTCTTGCCTCTGG + Intergenic
979150599 4:117309587-117309609 TTCTCTTGATTTCTTGCCTCTGG + Intergenic
979449776 4:120856949-120856971 TTGACTTCATCATTGGCCCCAGG - Intronic
980876629 4:138668183-138668205 TGCTCTTCCTCTCTGGCCACTGG - Intergenic
981192992 4:141885316-141885338 TTCACTACATCTCTGGGACCAGG - Intergenic
981376781 4:144025102-144025124 ATCACTACAGCTCTGTCCTCAGG + Intergenic
981387281 4:144146448-144146470 ATCACTACAGCTCTGCCCTCAGG + Intergenic
982007504 4:151077476-151077498 TCTCCTTCATCTCTAGCCTCAGG + Intergenic
983195331 4:164800115-164800137 TTCACTACTTCTCTTGCCTAGGG + Intergenic
983246801 4:165296757-165296779 TTCACCTAATCTCTGGCACCTGG + Intronic
983593123 4:169436731-169436753 TTGACTTCATCTTTGCCCTGAGG - Intronic
987546819 5:19321226-19321248 ACCACTTCATCTCTAGCATCAGG + Intergenic
987773163 5:22332224-22332246 TTTTCTTCATCTCTGGCCTTTGG - Intronic
988818422 5:34856895-34856917 TTCCCTTCATCCCTGGGATCTGG - Intronic
989363251 5:40627123-40627145 TTCACTTTATTTCAGGCTTCTGG - Intergenic
991389333 5:66125545-66125567 TTCACATCATATCTGCCCTCAGG - Intergenic
991464410 5:66894945-66894967 TTCACTTCATCTCTCCTCACAGG - Intronic
992371565 5:76149353-76149375 TGCACTTCAGCTCTAACCTCAGG - Intronic
992596103 5:78348736-78348758 TTCCCTCCATTTGTGGCCTCAGG - Intergenic
992621430 5:78597215-78597237 TGCACTTCCTGTGTGGCCTCTGG + Intronic
993942746 5:94080578-94080600 ATCACTTCAGAGCTGGCCTCAGG + Intronic
995005205 5:107184300-107184322 TTCAAGTCACCTGTGGCCTCAGG - Intergenic
995042081 5:107600435-107600457 TTCAGTTTATTGCTGGCCTCTGG - Intronic
997250396 5:132384521-132384543 TCCAGTTCTTTTCTGGCCTCTGG + Intronic
1000599203 5:163251923-163251945 TTCACCTCATCACTGGGCTCAGG + Intergenic
1003476798 6:6491180-6491202 TTCACATAATCTCAGGCCTTTGG + Intergenic
1003683112 6:8275397-8275419 TTCACTACAACTTTGCCCTCCGG + Intergenic
1003965939 6:11252158-11252180 TTCATTTCATGTCTGTCCTGGGG + Intronic
1004139611 6:13004781-13004803 TTCACTTCAGATCTGGGCTTTGG + Intronic
1007827227 6:44609771-44609793 TTCATTCCACCTCTAGCCTCAGG - Intergenic
1010765338 6:79772231-79772253 TTGACTGAATCTCAGGCCTCTGG + Intergenic
1011736881 6:90319723-90319745 ATCACTTCTTCACGGGCCTCAGG - Intergenic
1011812820 6:91152789-91152811 TGCACTTCACCTCTTGCTTCTGG - Intergenic
1011951320 6:92968844-92968866 TTAGCAGCATCTCTGGCCTCTGG - Intergenic
1012920726 6:105219107-105219129 TTCCCTTCACCACTGTCCTCTGG + Intergenic
1013924208 6:115448964-115448986 TGCACTTCATCCCTGCTCTCTGG + Intergenic
1014011145 6:116477203-116477225 TTCACTCCATCTCTTGCATCTGG - Intergenic
1015673829 6:135722917-135722939 TTCAAATTATCTCTGACCTCAGG - Intergenic
1015742693 6:136474115-136474137 TTCATTTTCACTCTGGCCTCAGG - Intronic
1016345623 6:143110967-143110989 ATAACTTCATCTCTGGCAACTGG - Intronic
1018193162 6:161329083-161329105 TTAACTGGATCTCTGGGCTCTGG + Intergenic
1019003674 6:168778137-168778159 GTCTCTTGACCTCTGGCCTCAGG - Intergenic
1023412939 7:39905500-39905522 CTCACTGCAACTTTGGCCTCTGG + Intergenic
1025738427 7:64175020-64175042 TTTACCTCATCCCTAGCCTCAGG + Intronic
1026217834 7:68365214-68365236 TTCCCTCCATCCCTAGCCTCTGG - Intergenic
1027583622 7:80028696-80028718 TTCTCTTGACCTCTGGCTTCTGG - Intergenic
1027690129 7:81334925-81334947 TTCTCTTCTTCTATGTCCTCAGG - Intergenic
1028492140 7:91424426-91424448 TTCATTTCCTCCCTGGGCTCTGG + Intergenic
1029300541 7:99579692-99579714 TTCAATACATCTCATGCCTCTGG + Intronic
1029306175 7:99621713-99621735 TTCACTTCATCTATTTCCTAAGG - Intronic
1029346174 7:99980392-99980414 CACACTTCATCTCTGCCTTCTGG - Intergenic
1029392954 7:100287701-100287723 TTCCCTCCAGCTCTGGCCACCGG + Intergenic
1029559003 7:101290123-101290145 CACACTTCATCTCTGCCTTCTGG + Intergenic
1029865203 7:103620360-103620382 TTCAATTCATCTCCGATCTCAGG + Intronic
1031928241 7:127658565-127658587 TTTACTGCTGCTCTGGCCTCTGG + Intronic
1031978448 7:128108251-128108273 CTCCCTCCATCTCTGGCTTCTGG - Intergenic
1034486724 7:151369913-151369935 TCCACTCCCTCTCTGGCATCAGG - Intronic
1034750743 7:153566716-153566738 TTCATTTGCTCTTTGGCCTCTGG - Intergenic
1035357992 7:158290384-158290406 TCCACATCATCTCTGGCACCAGG - Intronic
1035365420 7:158346290-158346312 TTCCCTCCACCCCTGGCCTCTGG + Intronic
1036821687 8:11945140-11945162 TCCTCTTCATCTCTGGCGCCTGG - Intergenic
1039479253 8:37859596-37859618 TTCAGATCATCTCATGCCTCAGG - Exonic
1040095340 8:43437164-43437186 TACACTTCATCTCTGGCATGTGG - Intergenic
1042121966 8:65498148-65498170 CTCACTGCATCCTTGGCCTCCGG - Intergenic
1042993498 8:74667173-74667195 TACCCCTCCTCTCTGGCCTCTGG - Intronic
1043376456 8:79655132-79655154 TTGACTTCGTCTCTGTGCTCAGG - Intronic
1043720314 8:83541210-83541232 ATCAGTTCATCTTTGGCGTCTGG - Intergenic
1044771403 8:95639130-95639152 ATCCCTTAATCTTTGGCCTCAGG - Intergenic
1046250517 8:111624621-111624643 TTCACTGCAACCTTGGCCTCCGG + Intergenic
1046710903 8:117510394-117510416 TTCACTGCATTTCTTACCTCAGG - Intergenic
1048894388 8:138976735-138976757 TTCAATGCATCTCTGACCTATGG - Intergenic
1053012849 9:34644926-34644948 TTTACTTGATCTCTGCCCTAGGG - Intronic
1053353187 9:37426629-37426651 TTCACTTCCTCGATGGCCTCCGG - Exonic
1055260830 9:74431427-74431449 TTAATCTCATCTCTGTCCTCAGG + Intergenic
1055569761 9:77604673-77604695 ATGACTTGATCTCAGGCCTCTGG - Intronic
1055722951 9:79196274-79196296 TTCTCATCCTCTCTGGCCCCAGG - Intergenic
1055723297 9:79199671-79199693 TTCCCTTGACCTCTGGCTTCTGG - Intergenic
1057351787 9:94304701-94304723 GTGACTTCAGCTCTGGCCACTGG - Intergenic
1058127080 9:101207515-101207537 CCCACTTCATCTCAGGCCCCTGG - Intronic
1059504056 9:114781915-114781937 TTCCCTTCTCCACTGGCCTCAGG - Intergenic
1059907948 9:119009452-119009474 CCCACTTCATCTCAGGCCTAAGG - Intergenic
1060991848 9:127854049-127854071 TTCACTTTAACCCTGGTCTCTGG - Intronic
1061689383 9:132313432-132313454 TCCACTTAATCTCTGGCTCCTGG - Intronic
1062727401 9:138083389-138083411 ACCACTTCAGCTCTGGCCTATGG - Intronic
1186198634 X:7133981-7134003 TTCAGTTCATATCTGACCTACGG - Intronic
1186976527 X:14912724-14912746 TCCAGTTCATCTTTGGCTTCTGG - Intronic
1188629956 X:32343141-32343163 TTCCTTTCATCTCTGGGCTCAGG + Exonic
1189207848 X:39257055-39257077 GACACTTCAACTCTGCCCTCTGG + Intergenic
1190154645 X:47979464-47979486 TTCACTTGGTCTATGACCTCAGG + Intronic
1194777613 X:97984278-97984300 CTCAGTTCTTCCCTGGCCTCTGG + Intergenic
1194849902 X:98857510-98857532 CACACTTCATCTCTGTCCTATGG - Intergenic
1196341063 X:114598216-114598238 TACACTTCCTCTCTGGGCTTTGG - Intronic
1197735583 X:129848377-129848399 TTGACTTCATCTCTGGACTGTGG + Intergenic
1198102647 X:133435628-133435650 TTCTCTTTCTCTCTGGTCTCAGG - Intergenic
1198269916 X:135047134-135047156 TTCCCTTGCTCTCTGGCTTCTGG + Intergenic
1199553769 X:149083954-149083976 TTCACTTCTGCTCTGGTCTGTGG - Intergenic
1199572916 X:149286318-149286340 TGCAATTCATCTCTGGATTCCGG - Intergenic
1201512987 Y:14786115-14786137 TTAACAGTATCTCTGGCCTCTGG - Intronic