ID: 1141284690

View in Genome Browser
Species Human (GRCh38)
Location 16:82660556-82660578
Sequence TTTCACTTCATCTCTGGCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 333
Summary {0: 1, 1: 0, 2: 1, 3: 31, 4: 300}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141284690_1141284693 -4 Left 1141284690 16:82660556-82660578 CCGAGGCCAGAGATGAAGTGAAA 0: 1
1: 0
2: 1
3: 31
4: 300
Right 1141284693 16:82660575-82660597 GAAAGAAAGATGACAACCTAGGG 0: 1
1: 0
2: 1
3: 34
4: 365
1141284690_1141284696 6 Left 1141284690 16:82660556-82660578 CCGAGGCCAGAGATGAAGTGAAA 0: 1
1: 0
2: 1
3: 31
4: 300
Right 1141284696 16:82660585-82660607 TGACAACCTAGGGCCCAGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 153
1141284690_1141284695 5 Left 1141284690 16:82660556-82660578 CCGAGGCCAGAGATGAAGTGAAA 0: 1
1: 0
2: 1
3: 31
4: 300
Right 1141284695 16:82660584-82660606 ATGACAACCTAGGGCCCAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 109
1141284690_1141284700 20 Left 1141284690 16:82660556-82660578 CCGAGGCCAGAGATGAAGTGAAA 0: 1
1: 0
2: 1
3: 31
4: 300
Right 1141284700 16:82660599-82660621 CCAGGAGGGAAGCTTCCAGAAGG 0: 1
1: 1
2: 5
3: 36
4: 327
1141284690_1141284692 -5 Left 1141284690 16:82660556-82660578 CCGAGGCCAGAGATGAAGTGAAA 0: 1
1: 0
2: 1
3: 31
4: 300
Right 1141284692 16:82660574-82660596 TGAAAGAAAGATGACAACCTAGG 0: 1
1: 0
2: 1
3: 28
4: 415
1141284690_1141284694 2 Left 1141284690 16:82660556-82660578 CCGAGGCCAGAGATGAAGTGAAA 0: 1
1: 0
2: 1
3: 31
4: 300
Right 1141284694 16:82660581-82660603 AAGATGACAACCTAGGGCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141284690 Original CRISPR TTTCACTTCATCTCTGGCCT CGG (reversed) Intronic
900362082 1:2293977-2293999 TCTCCTTTCATCTGTGGCCTCGG + Intronic
901435246 1:9243547-9243569 TTTCCCTCCAACACTGGCCTTGG + Intronic
902110857 1:14077050-14077072 TTGCTCTTCATCTCTGGAATGGG + Intergenic
902859245 1:19232975-19232997 GTTGAATTCATCTCTGGCCAGGG + Exonic
902881130 1:19372437-19372459 TTTCACATCAAGTCTGGCCCTGG - Intronic
903212744 1:21827988-21828010 CTCCACTTCATCTCTGTCTTGGG - Intronic
903430437 1:23294047-23294069 TTTCACTTCATGATTTGCCTAGG - Intergenic
904965890 1:34372261-34372283 TCCCACTTCTTCCCTGGCCTTGG - Intergenic
906011871 1:42534753-42534775 TTTCACCTCCTATCTGGTCTTGG - Intronic
907178463 1:52548090-52548112 TTTCCCTTATTCTCTGGTCTGGG - Intronic
907185512 1:52606142-52606164 GTCCACTTCATCTCTGGGCCTGG - Intronic
908791516 1:67787327-67787349 ACTCACTTCCTCTCAGGCCTTGG - Intronic
909270741 1:73620421-73620443 TTTGACTTCAACTCTGATCTTGG - Intergenic
910051552 1:82979890-82979912 TTCCACTTCATTTCAGGCATTGG + Intergenic
910440472 1:87246714-87246736 TACCACTTGCTCTCTGGCCTTGG + Intergenic
911154729 1:94626414-94626436 TTTAACTTCCTCTCTGGGCAGGG - Intergenic
913110004 1:115649095-115649117 TCTCACTTCCTTTCTGCCCTGGG - Intronic
914232122 1:145772655-145772677 TCTCTCTTTATCTCTGGCTTCGG + Intronic
914462667 1:147899100-147899122 TGTCATTTCAACTCTAGCCTTGG + Intergenic
914868236 1:151451017-151451039 TTTCACCACATCTCTGGTCATGG - Intronic
914959223 1:152191410-152191432 GTTCTCTTCACCTCTGGCCCAGG + Intergenic
915552751 1:156644696-156644718 TTTCCCATCATCTCAGGCTTAGG + Intronic
915930217 1:160055883-160055905 TTCCACGTCACCTCTGCCCTGGG + Intronic
916000160 1:160607693-160607715 TTTAACAGCATCCCTGGCCTCGG - Intergenic
916349520 1:163833214-163833236 TTTCTCTCCATCTCTGCTCTTGG + Intergenic
916388634 1:164305693-164305715 TATCTCTCCATCTCTGGTCTGGG - Intergenic
918614510 1:186529151-186529173 CTTCACTTCAGCTCTGATCTTGG + Intergenic
918760424 1:188397446-188397468 TTTCCCTTCACCTCAGGCCTCGG - Intergenic
918982644 1:191583399-191583421 TTTCAATTCAACTCTGATCTTGG + Intergenic
920582360 1:207123145-207123167 TTGCACTTAGTCTCTGGGCTAGG + Intronic
921026443 1:211287398-211287420 TTTCTCATCATTTCTGGCCTCGG + Intronic
923119314 1:230976349-230976371 TTTCATTTCTTCTCTGTCCTAGG - Intronic
924900223 1:248389853-248389875 TTTCTCTTCTTCTCTCCCCTTGG - Intergenic
1064194385 10:13233539-13233561 ATTGACCTCATCTCTGGACTTGG + Exonic
1064370198 10:14745299-14745321 CTTCAGTTCCTCTCTGGTCTTGG + Intronic
1064501210 10:15975660-15975682 TCTCATCTCATCTCTGGACTGGG - Intergenic
1064945242 10:20779768-20779790 ATTCATTTCCTCTGTGGCCTGGG + Intergenic
1068211062 10:53921520-53921542 CTTCACTTCACCCCTGGCCAAGG + Intronic
1068328958 10:55536608-55536630 ATTCACTTCCTCTCTCACCTGGG + Intronic
1068357077 10:55923199-55923221 TTTCTCTTCCTCTCTGGGCAGGG - Intergenic
1068878675 10:62025786-62025808 TTCCACTCCACCTCTGGCCTTGG - Intronic
1069063634 10:63919959-63919981 TTACCCTTCATGTCTGCCCTGGG + Intergenic
1069393583 10:67963989-67964011 TTTTTCTTCATCTCTGACCTAGG - Intronic
1069536500 10:69257533-69257555 TGTAACTTCATCTCTGCCTTGGG - Intronic
1072659163 10:97352148-97352170 TGCCACTGCATCCCTGGCCTTGG + Intergenic
1077644210 11:3909182-3909204 TTTGAGATCAGCTCTGGCCTTGG - Intronic
1079354071 11:19715431-19715453 TTTCCCTTCATCCATGGACTTGG + Intronic
1080178571 11:29395522-29395544 TCTCGCTTCACCTCTGGCTTTGG + Intergenic
1081008931 11:37783278-37783300 CTTCAGTTCAGCTCTGACCTTGG - Intergenic
1081202283 11:40231271-40231293 TTTTACTTTATTTCTGTCCTGGG - Intronic
1081397267 11:42601263-42601285 TTTAAGTTCATCTTTGACCTAGG + Intergenic
1081495271 11:43602870-43602892 GATCATTTCCTCTCTGGCCTAGG + Intronic
1083326213 11:61874191-61874213 TTCCACGTCCTCTCTGTCCTTGG - Intronic
1085881765 11:80475473-80475495 TCTCTCTTCATTTCTAGCCTGGG + Intergenic
1087292977 11:96340125-96340147 CTTCCCTTAATCCCTGGCCTGGG - Intronic
1087960381 11:104340856-104340878 TTTAACTTGTTCTCTGGCCTTGG + Intergenic
1088714922 11:112540486-112540508 CATCACACCATCTCTGGCCTTGG + Intergenic
1089272982 11:117314872-117314894 GTTCAGTTCCCCTCTGGCCTGGG + Intronic
1089325626 11:117654902-117654924 TTTCTCTTCATCTCTACCCCAGG + Intronic
1089980094 11:122765214-122765236 TTTCACTGCCTCTCTGTCTTAGG - Intronic
1091030764 11:132185837-132185859 TTTCACTTTATTTTTGGGCTCGG + Intronic
1091572103 12:1695966-1695988 TTTCTCTTTATCTCTGGATTTGG + Intronic
1091994664 12:4983806-4983828 TTTCATTTCATCTGTCGCCTTGG + Intergenic
1092269602 12:7012810-7012832 CTCCACTTGATCTCTGGCATTGG + Intronic
1092824722 12:12387941-12387963 TTTCCCTGGATCTCTGACCTAGG - Intronic
1094008648 12:25783146-25783168 TTTCACCTCATCTCATGCCCTGG - Intergenic
1094379885 12:29831285-29831307 TGTCACTTCAGCTCCAGCCTTGG - Intergenic
1095571492 12:43687615-43687637 TTTCAGTTCAGCTCTGGTTTTGG - Intergenic
1095601877 12:44022836-44022858 TTTAAATTCATCTCTGTACTTGG - Intronic
1095977669 12:47950817-47950839 GTTCTCTGCATCTCTTGCCTAGG - Intergenic
1096722448 12:53533259-53533281 TTTCACTTCATGTCTCCTCTAGG - Exonic
1098747419 12:74256960-74256982 TTCCATTTTATCTCTGTCCTAGG - Intergenic
1099092377 12:78329283-78329305 TTTCACATCTTCTCTAGCTTAGG - Intergenic
1100028287 12:90154886-90154908 TTTTACTTCATTTTTGACCTTGG - Intergenic
1101547554 12:105730705-105730727 TTGCCTCTCATCTCTGGCCTGGG + Intergenic
1103671055 12:122615748-122615770 TTGCACTCCAGCTCCGGCCTGGG + Intronic
1104269268 12:127267709-127267731 TTGCAATTCTTCTCTGGGCTTGG - Intergenic
1107386094 13:39911165-39911187 TTTCTCCTCAGCTCTGGGCTTGG - Intergenic
1108237138 13:48419529-48419551 CTTCAGTTCTTCTCTGACCTTGG - Intronic
1109069754 13:57749379-57749401 TTTGCCTCTATCTCTGGCCTGGG + Intergenic
1110435424 13:75472932-75472954 TTTCAACTCATCTCTTGCCTTGG - Intronic
1110604437 13:77415334-77415356 AATCCCTTCATCTCTGCCCTGGG - Intergenic
1112078139 13:95935563-95935585 TTTTACTTCAGCACTGACCTTGG + Intronic
1112826044 13:103393511-103393533 TAACACTTGCTCTCTGGCCTGGG + Intergenic
1114486003 14:23062039-23062061 TTTCTCTTCTTCCCTGGCTTTGG - Intronic
1114989349 14:28268112-28268134 TTTCACTTCAACTCTGGTTTTGG - Intergenic
1115010000 14:28534593-28534615 GTTCAGTTCATCTCTGACTTTGG + Intergenic
1116299629 14:43161688-43161710 TTTCACTTCGTGTATGGGCTGGG + Intergenic
1116740172 14:48744691-48744713 TTTCACTGTTTCACTGGCCTGGG + Intergenic
1117225951 14:53659260-53659282 TTTCAATTTATATTTGGCCTAGG + Intergenic
1120058752 14:79956699-79956721 TTTCAGTTCAGCTCTGATCTTGG - Intergenic
1121604948 14:95233831-95233853 TTTCACTTCTGCTCTAGCCAAGG + Intronic
1122012451 14:98761278-98761300 TTTAAAATCATCTCTTGCCTTGG + Intergenic
1122831168 14:104396713-104396735 TTACACTGCTTCTCTGGCATCGG + Intergenic
1124844166 15:33274712-33274734 TGTCACTTCATCCCTAGCTTCGG - Intergenic
1125931912 15:43606227-43606249 TTTCACCTCATCTGTAACCTTGG + Intronic
1125945011 15:43705705-43705727 TTTCACCTCATCTGTAACCTTGG + Intergenic
1126155040 15:45558026-45558048 ATTCACTTCCTCTGTGTCCTGGG + Intergenic
1127483270 15:59396667-59396689 TTTCACATAAACTCTGGGCTGGG + Intronic
1127771358 15:62233853-62233875 TTACAATCCAGCTCTGGCCTTGG + Intergenic
1128246904 15:66139102-66139124 TTTGGCTGCATTTCTGGCCTAGG + Intronic
1128646159 15:69380291-69380313 TTTACCTTCATCTCCGGTCTTGG + Intronic
1129484722 15:75858983-75859005 TTTCTCTTCATCTCTTTTCTTGG + Intronic
1130256376 15:82327865-82327887 TTGCCCTTCATCTCTGGCAAAGG - Intergenic
1130264828 15:82390974-82390996 TTTCTCTTCATCTCTTTTCTTGG + Intergenic
1130507162 15:84555921-84555943 TTTCTCTTCATCTCTTTTCTTGG - Intergenic
1130598575 15:85262123-85262145 TTGCCCTTCATCTCTGGCAGAGG + Intergenic
1131656216 15:94461711-94461733 TTTCACATCATTTCTAGCCAGGG - Intronic
1133445658 16:5858864-5858886 TTTCTCTTCTATTCTGGCCTGGG - Intergenic
1133672862 16:8041097-8041119 TTGGACTTCAACTGTGGCCTTGG - Intergenic
1134662378 16:15993857-15993879 ATTCACTTGATCTCCGGCCCTGG + Intronic
1135084687 16:19465830-19465852 TTTCACTTGATCACTGGGCCAGG + Intronic
1135413536 16:22252307-22252329 TCTTCCTCCATCTCTGGCCTGGG + Intronic
1137795576 16:51214936-51214958 CTTCACTTTATCCCAGGCCTTGG - Intergenic
1139447083 16:67004586-67004608 TACCACTTCAGCTCTGGCCCAGG + Intronic
1139918649 16:70444446-70444468 TTTCACTTGATCTGTTGCCCAGG - Intergenic
1141284690 16:82660556-82660578 TTTCACTTCATCTCTGGCCTCGG - Intronic
1141623132 16:85247713-85247735 TTTCACTTCATTGCTGCCCCTGG + Intergenic
1144616623 17:16781334-16781356 TTTCAGTTCAGCTCTGATCTTGG + Intronic
1144757285 17:17687313-17687335 CTTCCTTTCCTCTCTGGCCTCGG + Intronic
1144896070 17:18534327-18534349 TTTCAGTTCAGCTCTGATCTTGG - Intergenic
1145752174 17:27363011-27363033 TTTCACTTTCCCACTGGCCTTGG - Intergenic
1148455761 17:47810660-47810682 TTCCACTTCATATCTGGAATTGG + Exonic
1149953599 17:61020056-61020078 TTCCACTTCATCTATGTCCGAGG + Intronic
1150022739 17:61636011-61636033 CTTCACTTCATCTCTTGTTTTGG + Intergenic
1150241314 17:63635744-63635766 TTTCATTCTATCTCAGGCCTAGG - Intronic
1153264392 18:3255236-3255258 TTTCACTTCATCCCTGACTTTGG - Intronic
1153412138 18:4805218-4805240 TTTCACTTCATCACTGATGTAGG - Intergenic
1157259160 18:46163860-46163882 TTTCTCTTCATCTCTATCCGTGG + Intergenic
1157717259 18:49896515-49896537 TCTGACTTCATCTCTGCTCTGGG + Intronic
1157870871 18:51229157-51229179 TTTCCCTTCATCATTGTCCTTGG + Intergenic
1158063848 18:53381002-53381024 TTTCACTTGATCTTTAGCCATGG - Intronic
1158940577 18:62403290-62403312 TTTGCCTTCATCTTTGCCCTGGG - Intergenic
1164685643 19:30164905-30164927 TTTGACTTTATCCCTGGCCTTGG - Intergenic
1166131663 19:40749507-40749529 CTTCACATCTTCTCTGCCCTTGG + Exonic
926047227 2:9718535-9718557 TTCCAATTCATCTCTGGCCCTGG + Intergenic
926454161 2:13043424-13043446 TTTCAGTTCTTCTCTGAGCTTGG - Intergenic
928081769 2:28318378-28318400 TAACAATTCAACTCTGGCCTTGG - Intronic
928354708 2:30600508-30600530 TTTCACTTCAACTCTGATCTTGG - Intronic
930392602 2:50781043-50781065 ATGAACTTCATCTCTGGCCTAGG - Intronic
930636068 2:53806965-53806987 ATTCTCTTCATCTCTCACCTGGG + Intronic
931072820 2:58673295-58673317 TTTTTCTTCAGTTCTGGCCTTGG + Intergenic
932173465 2:69578121-69578143 TTTCACTTCATCTAAAGCCCTGG - Intronic
933002665 2:76945086-76945108 TTTTACTTTATCTGTGACCTTGG - Intronic
934864661 2:97796080-97796102 TTTCACTTAATCTTTGGCTAAGG - Intronic
935532284 2:104249048-104249070 TTTCACTTCTTTCCTGGACTTGG + Intergenic
935814788 2:106837613-106837635 TCACACTTCCTCTCTGGCTTAGG - Intronic
935929677 2:108110624-108110646 TTTCAGTTCAGCTCTGATCTTGG + Intergenic
936267420 2:111021205-111021227 TTGTACTTCAACTCTGACCTGGG + Intronic
936521996 2:113217349-113217371 TTGCTCTTCATCTCAGGCTTTGG - Exonic
936867422 2:117090993-117091015 TTTCACATCATCACTCGTCTTGG + Intergenic
937159496 2:119746765-119746787 TGTCACTTCATCACTGGCCAGGG - Intergenic
938213828 2:129491326-129491348 TTTCCCCTCTTCTCTGACCTGGG - Intergenic
939046056 2:137251579-137251601 TTTCACCTTATATATGGCCTTGG - Intronic
940629741 2:156222805-156222827 TTTCAGTTCAGCTCTGATCTTGG - Intergenic
940674965 2:156716460-156716482 TTCCACTTCAGCTCTGATCTTGG + Intergenic
941413518 2:165189815-165189837 TTACTCTTTATCTCTGGCCATGG + Intronic
941600648 2:167539345-167539367 TTTCACTTTATTTTTGTCCTTGG - Intergenic
941963661 2:171278611-171278633 TTTCTCTTTATCTCTGGCTTTGG - Intergenic
942051384 2:172144267-172144289 TTTCATTTCCTCCCTGGCTTTGG + Intergenic
942728990 2:179042858-179042880 TTTCAGTTCAGCTCTGATCTTGG - Intronic
942993768 2:182236025-182236047 TTTAATTACATCTCTAGCCTAGG + Intronic
945306808 2:208266484-208266506 TTTCACCTCAGCTCTGGCCCTGG - Intronic
948039351 2:234887132-234887154 TTTATCTTCAGATCTGGCCTTGG - Intergenic
948197288 2:236105335-236105357 TTTGTCTTCCTCTCTGTCCTTGG - Intronic
948629736 2:239294421-239294443 TTTTTTTTCATCTCTGCCCTGGG - Intronic
948822100 2:240555237-240555259 TTCCACTTCCTGTGTGGCCTTGG - Intronic
1169333163 20:4732334-4732356 TTTCTCTTCCGCTCTGGCCTCGG - Exonic
1169683808 20:8247962-8247984 TTTCACTTCCTCTCTTTCTTGGG + Intronic
1169874152 20:10278483-10278505 TTCCACTTCATCTCTCCCATTGG - Intronic
1170479177 20:16747850-16747872 TTAGAATTCATCTCTAGCCTGGG + Intergenic
1171045098 20:21803095-21803117 TTTCTCTTAATCTCAGGACTAGG - Intergenic
1171063252 20:21987181-21987203 TCTCACTTCATCTTTTTCCTGGG + Intergenic
1171110540 20:22477186-22477208 TTTCACTTCAGCTCTCATCTTGG - Intergenic
1171260390 20:23726839-23726861 TTTCATTTCCTCACTGTCCTAGG - Intergenic
1171269504 20:23802653-23802675 TTTCATTTCCTCACTGTCCTAGG - Intergenic
1172940218 20:38649021-38649043 ATGGACTTCATCCCTGGCCTAGG + Intronic
1176258602 20:64166992-64167014 ACTCCCTTCCTCTCTGGCCTGGG + Intronic
1177106893 21:16967548-16967570 TGCCACTTCACCTCAGGCCTGGG + Intergenic
1177625367 21:23652813-23652835 TCTCACTTCATCCTTGCCCTTGG - Intergenic
1178698748 21:34816256-34816278 TTTCTCTGCAGCTCTGGGCTAGG + Intronic
1180592612 22:16954103-16954125 TTGCACTTCCTGTCTGCCCTTGG + Intergenic
1181067056 22:20311754-20311776 TTTCCCTCCATCCCTGGGCTGGG - Intergenic
1183992370 22:41606311-41606333 TGCCACTGCATTTCTGGCCTGGG + Intronic
1184795314 22:46728777-46728799 TTTATCTCCAGCTCTGGCCTCGG + Intronic
949560968 3:5202250-5202272 TTTGTCTTCATCTCTGACTTGGG + Intronic
952288867 3:31995836-31995858 TGTCACTTCATCTCTGGATAGGG - Intronic
952934962 3:38390237-38390259 TTTCACTTGCTCTGTGGCCCAGG + Intronic
952949678 3:38511711-38511733 TTTCATGTCAGATCTGGCCTTGG + Intronic
954109745 3:48427437-48427459 TTTCACTTAATCTCTGCCACAGG + Intronic
955084051 3:55685491-55685513 TTTAACTTCCTCTCTGTCCCTGG + Intronic
955896542 3:63706584-63706606 TTACTCTTCATCTCTAGCCTTGG - Intergenic
958163615 3:89850357-89850379 ATGCACTTTATCTCTGGCCTAGG - Intergenic
958649918 3:96925948-96925970 CTTCATTTCAGCTCTGACCTTGG + Intronic
959344846 3:105180724-105180746 TTTTCCTTCATCTCTCTCCTAGG - Intergenic
960012868 3:112852433-112852455 TTTCAGTTCAGCTCTGGTTTTGG - Intergenic
960502200 3:118451559-118451581 TTTCAGTTCAGCTCTGATCTTGG + Intergenic
960526230 3:118713892-118713914 CTTTCCTTCATCTCTGACCTAGG + Intergenic
960916661 3:122702094-122702116 TTTCACTTCCTCACTGGTGTTGG - Intronic
962654561 3:137530211-137530233 TTTCACTACCTTTCTGGGCTAGG - Intergenic
966290328 3:178348815-178348837 TTCTACTGCTTCTCTGGCCTTGG + Intergenic
967089013 3:186119280-186119302 TTCCACTTCTCCTCTGGTCTGGG + Intronic
967335210 3:188336892-188336914 TGCCACTTCAGCTCAGGCCTGGG + Intronic
967792329 3:193562538-193562560 TTTCACTGTATCTAGGGCCTGGG - Intronic
967804482 3:193703200-193703222 TTTCTGCTCATTTCTGGCCTCGG + Intergenic
971167802 4:24202447-24202469 ATTCAGTGCATTTCTGGCCTTGG + Intergenic
971570161 4:28202124-28202146 TGTCACTTCATTTGTGACCTTGG + Intergenic
972247699 4:37262771-37262793 TTTCTGTTCATATGTGGCCTGGG + Intronic
973651080 4:52997584-52997606 TTTCATTTTATTGCTGGCCTGGG + Intronic
974255544 4:59449395-59449417 TTTAATTTCAACTCTGGTCTAGG - Intergenic
974638493 4:64597466-64597488 TTTCCCTTGATCTCTTGCATAGG + Intergenic
975538767 4:75481100-75481122 TTTCCCTTCATCTGTTTCCTTGG - Exonic
976152178 4:82103417-82103439 TTTCACTGCATCTATGCCATCGG - Intergenic
976353271 4:84084703-84084725 TTTCCCTTCTTCTCCTGCCTTGG + Intergenic
979863362 4:125722705-125722727 TTCCACCTCACCTCTGGACTTGG - Intergenic
981011249 4:139927346-139927368 TTTCACTTGATCACTTGCTTAGG + Intronic
983010321 4:162538220-162538242 TCTCTCTTCTTCTCTGGCCCTGG - Intergenic
983195330 4:164800114-164800136 CTTCACTACTTCTCTTGCCTAGG + Intergenic
983477632 4:168234117-168234139 TGTCACTTTATTTCTGTCCTAGG + Intronic
983983090 4:174023477-174023499 TTGCCCTTCAACTCTGGGCTAGG + Intergenic
984685234 4:182659557-182659579 GTTCACTTCATCACTGGTCCAGG + Intronic
985270088 4:188185765-188185787 TGTTACTTCATCCCTGGCCCTGG - Intergenic
988368598 5:30336576-30336598 TTTCCCTTCAACTCTGCCATTGG - Intergenic
989127355 5:38069491-38069513 TTTGGTTTCATCTCTGGCCTTGG - Intergenic
990128239 5:52546069-52546091 TTTCTCTTCATATATGTCCTTGG - Intergenic
990752793 5:59036806-59036828 TTTCAATTCAGCTCTGTCGTGGG + Intronic
991929846 5:71743562-71743584 TTTTACTGCATCTCTGTCCAAGG + Intergenic
992208369 5:74452985-74453007 TTTCACTTCCTCTCTCACCATGG - Intergenic
993508310 5:88738728-88738750 TTGCACATCACCTCTGGCTTAGG - Intronic
994501680 5:100587326-100587348 TTTCACATCATCTTTGGTCCTGG - Intergenic
995134666 5:108667956-108667978 TTTCTCTTAAGCTCTAGCCTGGG - Intergenic
995671655 5:114610368-114610390 TGCCACTTCAGCTCTGGCATAGG + Intergenic
995836334 5:116403130-116403152 TCTCACTTCATCTCAGGCCATGG + Intronic
998927146 5:147138962-147138984 TTTCAGTTCTGCTCTGGTCTTGG + Intergenic
1000134541 5:158334375-158334397 GTTCAGTTCATCTCTGACTTTGG + Intergenic
1000561594 5:162796103-162796125 TTTTACACCATCACTGGCCTTGG + Intergenic
1000854740 5:166384054-166384076 TTTCACTTCATCTCAGGCCCTGG - Intergenic
1000899392 5:166894597-166894619 TATCATTCAATCTCTGGCCTTGG + Intergenic
1001409934 5:171504110-171504132 TTTGACTTCAACCTTGGCCTGGG - Intergenic
1002671703 5:180872811-180872833 TTTCAATTCAGCTGTGGCCATGG + Intergenic
1003846530 6:10180065-10180087 TCTCAATTCATTTCTGCCCTTGG - Intronic
1003965938 6:11252157-11252179 CTTCATTTCATGTCTGTCCTGGG + Intronic
1008454071 6:51688471-51688493 TTTCAGTTCAGCTCTGATCTTGG - Intronic
1008770108 6:54967951-54967973 TTTCAAGTCATCTCTGACCAAGG - Intergenic
1010344970 6:74800518-74800540 TGTCACTCCAGCTCTGGCCATGG + Intergenic
1010812207 6:80313755-80313777 TTTCAGTTCATCTTTGATCTTGG + Intronic
1011109935 6:83826402-83826424 TTGCACTCCAGCTCTAGCCTGGG + Intergenic
1011214421 6:84990161-84990183 TTTCAGTTCTTCTCTGATCTTGG - Intergenic
1012171838 6:96025867-96025889 TTGTCCTTCATCTCTGACCTAGG - Intronic
1012988387 6:105899170-105899192 TGTCTCTTCATCTCTTGGCTGGG - Intergenic
1013693418 6:112671875-112671897 TTTCTCTACATCTCTGGATTTGG + Intergenic
1013987178 6:116208892-116208914 CTTCAATTACTCTCTGGCCTGGG - Intronic
1014776612 6:125518259-125518281 TTTCTCTTTCCCTCTGGCCTGGG - Intergenic
1015054635 6:128885021-128885043 ATTCACTTCATCTTGTGCCTGGG - Intronic
1016492849 6:144626679-144626701 TGCCACTGCATCTCTAGCCTGGG - Intronic
1018029607 6:159831585-159831607 CTCCACTTCTTCCCTGGCCTTGG - Intergenic
1018630158 6:165815526-165815548 TTTCACAACATCTGAGGCCTTGG - Intronic
1019344768 7:523806-523828 TTTCCCTTTATCTCTGGGCAAGG + Intergenic
1019659540 7:2216298-2216320 TTTCCCTTCTTCTCTGTCCCTGG - Intronic
1019853760 7:3584415-3584437 TTTCACTTCGTTTCTGGACTTGG + Intronic
1022393951 7:29968960-29968982 TTGCACTTCATCTCTGGGCCGGG + Exonic
1023424155 7:40016965-40016987 TGTCTCTTCATCACTGGCCATGG - Intronic
1023666809 7:42531605-42531627 CTTCACTTCAGCTCTGATCTTGG - Intergenic
1024613446 7:51086524-51086546 TGCCACTTCAACTCTGACCTTGG + Intronic
1027386929 7:77668014-77668036 TTTCACTCAAACACTGGCCTAGG - Intergenic
1029733449 7:102452472-102452494 CTGCACTCCAGCTCTGGCCTGGG - Exonic
1030403531 7:109082859-109082881 TTTCATTTCATCTCTAATCTTGG + Intergenic
1031738144 7:125393548-125393570 TTTCACTTAATCTTTGACATGGG + Intergenic
1033248244 7:139736557-139736579 TTTCAGGTCAGCTCTGGCCTTGG - Intronic
1034364028 7:150530285-150530307 TTTCACTTCAGCTCTGATTTTGG + Intergenic
1035192981 7:157188572-157188594 TTTCAATGCATCACTGCCCTGGG + Intronic
1037039763 8:14216964-14216986 TTTCACCACATATGTGGCCTTGG - Intronic
1039366881 8:36937642-36937664 TGTCACTTCATCCCAGGCCATGG - Intergenic
1040641875 8:49344674-49344696 TTTCCCTTCATTTCTGGGATAGG + Intergenic
1042562950 8:70087070-70087092 TTGCCCTTCAGCTCTGGCCCTGG - Intergenic
1042845666 8:73167545-73167567 TTTCTGTTCACCTGTGGCCTTGG + Intergenic
1043145429 8:76648058-76648080 TTTCACTTCCACACTGCCCTAGG - Intergenic
1043357077 8:79426124-79426146 TTTGCCATCATCTCTTGCCTGGG - Intergenic
1044761040 8:95517915-95517937 TATCACTCCATCTCTGTCCCTGG + Intergenic
1045156916 8:99486541-99486563 TTTCACCTCTTCTCTGTCCTAGG + Intronic
1045545954 8:103128485-103128507 ATTCCCTTCATCTTTTGCCTGGG + Intergenic
1046113029 8:109749816-109749838 TTCCCCTTCGTCTCTGCCCTTGG - Intergenic
1046777991 8:118184294-118184316 GTTTACTTCATCTCTGACCCTGG - Intergenic
1046929062 8:119824919-119824941 TTTCTCTTCTGCACTGGCCTAGG - Intronic
1047112517 8:121806423-121806445 TTACCCTGCATCTCTGGCATGGG - Intergenic
1047712478 8:127566469-127566491 TTGGACTTCATCTCTTGACTGGG - Intergenic
1048168853 8:132086168-132086190 TTTCACTTTATATCTTCCCTAGG + Intronic
1048778156 8:137970544-137970566 TTTCAGTTCATTTCTGGCTCAGG - Intergenic
1048824816 8:138413904-138413926 TTTCACCTCCCCTCTTGCCTTGG + Intronic
1049270477 8:141693075-141693097 TGTCTCCTCCTCTCTGGCCTGGG - Intergenic
1049765910 8:144355120-144355142 TTTCTCTCCAGCTCAGGCCTAGG - Intronic
1050374563 9:4957726-4957748 TGCCACTTCAGCTCAGGCCTTGG - Intergenic
1050584409 9:7095425-7095447 TTTCTATTCATTTTTGGCCTTGG - Intergenic
1050666963 9:7949835-7949857 TTGCAGTTCAAATCTGGCCTCGG - Intergenic
1053012850 9:34644927-34644949 ATTTACTTGATCTCTGCCCTAGG - Intronic
1053874577 9:42530013-42530035 GGTCACTTCAGCTCTAGCCTTGG - Intergenic
1054267757 9:62936742-62936764 GGTCACTTCAGCTCTAGCCTTGG + Intergenic
1054994754 9:71373265-71373287 CTTCACTTCAGCTCTGATCTTGG - Intronic
1055341272 9:75286191-75286213 CTTCACTTCATCTCTGATTTTGG + Intergenic
1055456963 9:76481789-76481811 TGGCACTTCATCTCTGGCCCAGG - Intronic
1055723393 9:79200680-79200702 TTTCTTTCCATCTCTGGCCTTGG - Intergenic
1055841992 9:80516400-80516422 TTTCAGTTCAGCTCTGATCTTGG + Intergenic
1056074610 9:83025714-83025736 TTTAACTTGCTCTCTGACCTGGG - Intronic
1057194229 9:93107857-93107879 TTTCCCTTCCTTTCTGGGCTGGG + Intronic
1057980214 9:99653261-99653283 TTTCACTTCAGCTCTGATTTTGG - Intergenic
1059026459 9:110638184-110638206 TTTCACTTTATCTTGAGCCTTGG + Intergenic
1059968938 9:119644532-119644554 TTTCAGTTGATCTCTGGATTGGG - Intergenic
1060622068 9:125076471-125076493 TCTCACTCCCTCTGTGGCCTAGG - Intronic
1060643545 9:125259379-125259401 CTTCCCTTCCTCCCTGGCCTGGG + Intergenic
1061255560 9:129453018-129453040 CTTCTCTTCCTCTCTAGCCTAGG + Intergenic
1062232426 9:135489318-135489340 TTGCACGTCATCTCTGCCCTGGG - Intergenic
1186478238 X:9875714-9875736 TTTCACATCATCTCTAGCATAGG + Intronic
1186913082 X:14190625-14190647 CTTCAGTTCAGCTCTGGTCTTGG + Intergenic
1189653381 X:43214213-43214235 ATTCACTTCATCTCCGACTTTGG - Intergenic
1190445419 X:50519244-50519266 CTTCATTTTCTCTCTGGCCTTGG + Intergenic
1191950253 X:66583355-66583377 TTTCAGTTCAGCTCTGATCTTGG - Intergenic
1192612388 X:72580170-72580192 TTTCCCTTCCTCTCTGGAATTGG + Exonic
1192801732 X:74471802-74471824 TTTCTCTTCTTCTCAGTCCTTGG + Intronic
1193176944 X:78405102-78405124 TTTCACTTCAGCTCTGATCTTGG - Intergenic
1193736430 X:85162301-85162323 CTTCAGTTCATCTCTGGTTTTGG - Intergenic
1194142577 X:90223095-90223117 TCTCTCTTCTTCTCTGGCCCTGG - Intergenic
1195404794 X:104501196-104501218 TACCACTTCACTTCTGGCCTAGG - Intergenic
1195678465 X:107525321-107525343 TTTACCTTCTTCCCTGGCCTTGG + Intronic
1198143950 X:133835941-133835963 TATCACTACTTCTCTAGCCTAGG - Intronic
1198682360 X:139196422-139196444 CTTTCCTTCTTCTCTGGCCTGGG - Intronic
1200319098 X:155166643-155166665 TTTTTCTCTATCTCTGGCCTTGG + Intergenic
1200488331 Y:3792196-3792218 TCTCTCTTCTTCTCTGGCCCTGG - Intergenic
1200921319 Y:8615879-8615901 TTTCACTTCTGTTCTGTCCTAGG - Intergenic
1202269845 Y:23061002-23061024 GTCCACTTCTGCTCTGGCCTCGG - Intergenic
1202375629 Y:24233784-24233806 TTTCTCTTCATCTCTTTTCTTGG - Intergenic
1202422839 Y:24694748-24694770 GTCCACTTCTGCTCTGGCCTCGG - Intergenic
1202447950 Y:24975338-24975360 GTCCACTTCTGCTCTGGCCTCGG + Intergenic
1202495151 Y:25436334-25436356 TTTCTCTTCATCTCTTTTCTTGG + Intergenic