ID: 1141284691

View in Genome Browser
Species Human (GRCh38)
Location 16:82660562-82660584
Sequence TCTTTCTTTCACTTCATCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 784
Summary {0: 1, 1: 0, 2: 5, 3: 49, 4: 729}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141284691_1141284700 14 Left 1141284691 16:82660562-82660584 CCAGAGATGAAGTGAAAGAAAGA 0: 1
1: 0
2: 5
3: 49
4: 729
Right 1141284700 16:82660599-82660621 CCAGGAGGGAAGCTTCCAGAAGG 0: 1
1: 1
2: 5
3: 36
4: 327
1141284691_1141284695 -1 Left 1141284691 16:82660562-82660584 CCAGAGATGAAGTGAAAGAAAGA 0: 1
1: 0
2: 5
3: 49
4: 729
Right 1141284695 16:82660584-82660606 ATGACAACCTAGGGCCCAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 109
1141284691_1141284696 0 Left 1141284691 16:82660562-82660584 CCAGAGATGAAGTGAAAGAAAGA 0: 1
1: 0
2: 5
3: 49
4: 729
Right 1141284696 16:82660585-82660607 TGACAACCTAGGGCCCAGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 153
1141284691_1141284694 -4 Left 1141284691 16:82660562-82660584 CCAGAGATGAAGTGAAAGAAAGA 0: 1
1: 0
2: 5
3: 49
4: 729
Right 1141284694 16:82660581-82660603 AAGATGACAACCTAGGGCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 125
1141284691_1141284693 -10 Left 1141284691 16:82660562-82660584 CCAGAGATGAAGTGAAAGAAAGA 0: 1
1: 0
2: 5
3: 49
4: 729
Right 1141284693 16:82660575-82660597 GAAAGAAAGATGACAACCTAGGG 0: 1
1: 0
2: 1
3: 34
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141284691 Original CRISPR TCTTTCTTTCACTTCATCTC TGG (reversed) Intronic
902096946 1:13953604-13953626 TCTTTCTTTTTTTTCTTCTCTGG + Intergenic
902404327 1:16174630-16174652 TCTCTCTGTCTCTTCATCCCAGG + Intergenic
903708553 1:25304904-25304926 TGTTTCCTTGACTTCATCACTGG + Intronic
903718561 1:25387507-25387529 TGTTTCCTTGACTTCATCACTGG - Intronic
904319931 1:29690007-29690029 TCTTGCTTTCCCCTCATCTGAGG + Intergenic
905365388 1:37448463-37448485 GGTTGCTTTGACTTCATCTCAGG - Intergenic
905529267 1:38663768-38663790 TCTTCTTTTCACTTTATCCCTGG - Intergenic
905848572 1:41256166-41256188 TCTTTCTTCCACTCCCTTTCAGG + Intergenic
906711729 1:47935203-47935225 TCTATTTTTCACCTCATCCCTGG + Intronic
906753794 1:48290058-48290080 TTTTTCCTTCATTTCAACTCTGG - Intergenic
907823612 1:57994378-57994400 TCCCTCTTCCACTTCATTTCTGG + Intronic
908915245 1:69118913-69118935 TTTTTCCTTCATTTCAACTCTGG + Intergenic
909678484 1:78264676-78264698 TTTTTCTTTCATTTCAACCCTGG - Intergenic
910059978 1:83078904-83078926 TCTTTCTTGCATTTTATTTCTGG + Intergenic
910109942 1:83672438-83672460 TCTCTCTTTCTCTTCTTCTAAGG + Intergenic
910533159 1:88264443-88264465 TGTTGCTTTTACTTCATTTCAGG - Intergenic
911935668 1:103968070-103968092 TCTTTCTTTGCCTGCATCTTTGG + Intergenic
912389738 1:109294678-109294700 GCTTTATTTCACTTCCCCTCCGG - Intronic
912613890 1:111077949-111077971 TTTTTCTTTCATTTCAGCTTTGG + Intergenic
913233531 1:116761565-116761587 TCTTTTTGTAACTTAATCTCAGG + Intronic
913412889 1:118572660-118572682 TTTTTCTTTCATTTCAACTTTGG + Intergenic
913434561 1:118833128-118833150 TTTTTCTTTCATTTCAACTTTGG - Intergenic
915193348 1:154170497-154170519 TTCTTCTTTGTCTTCATCTCTGG - Intronic
915559693 1:156679443-156679465 TCTTTCTTTCACTTTCTGTCTGG + Intergenic
915654700 1:157349809-157349831 TCTTTCTTTCTTTTCCTTTCAGG + Intergenic
916003710 1:160639986-160640008 TCATTCTTTCACTTTATTTTAGG + Intronic
916191818 1:162186628-162186650 ACTCTCTTTCACTTCTTCTAAGG - Intronic
916344784 1:163775488-163775510 CCTTTCTTTGACCTCTTCTCTGG - Intergenic
916568707 1:166006513-166006535 TCTTTCTTTCATTTCAACCTTGG + Intergenic
916633237 1:166639025-166639047 TTTTTCTTTCATTTCATCCTTGG - Intergenic
917258914 1:173146616-173146638 TCTTTCTTTCAATTCAACTTTGG + Intergenic
917743835 1:177987740-177987762 TTTTTCCTTCACTTCAACTTTGG - Intergenic
919947459 1:202330182-202330204 TCCATCTCTCACTTCATATCTGG + Intergenic
920251967 1:204627928-204627950 TCTTTCTTTCTTTCCTTCTCCGG - Intronic
920588243 1:207190034-207190056 TCTTTCTTTCCCTTGTTATCAGG - Intergenic
920727851 1:208453621-208453643 TCTTTCTTTCTCTCTCTCTCTGG - Intergenic
920730909 1:208483439-208483461 TCTTTCTCTGAATTCATCTTTGG - Intergenic
921026442 1:211287392-211287414 TCTTGCTTTCTCATCATTTCTGG + Intronic
1063614313 10:7589102-7589124 TGTTTCTTTTGCTTCATTTCTGG + Intronic
1063841119 10:10073815-10073837 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1064037030 10:11922412-11922434 TCTTTCCATCAGTTCATTTCTGG - Intronic
1064383084 10:14863743-14863765 TATTTCTTTGAGTGCATCTCAGG - Intronic
1064548287 10:16473263-16473285 TCTTCCTTTGACTTCATCAGGGG - Intronic
1064671668 10:17721248-17721270 TTTTTCCTTCATTTCAACTCTGG + Intergenic
1065014154 10:21446354-21446376 TCTTTCTTTCAATACATATTTGG + Intergenic
1065085556 10:22172000-22172022 TATTTATTCCACTTCATCTTAGG + Intergenic
1065131124 10:22621449-22621471 TCTTTCTTTCCATTCATCCTGGG + Intronic
1065985675 10:30948957-30948979 TTTTTCCTTCATTTCAACTCTGG - Intronic
1066060312 10:31718110-31718132 TTTTTCCTTCATTTCATCTTTGG + Intergenic
1066355496 10:34679709-34679731 TCTTTCCTTCATTTTATCTCAGG + Intronic
1068285462 10:54928372-54928394 TCTTTCTTTCATTTCAACCTTGG + Intronic
1069147219 10:64908980-64909002 TCTTCCTTACACTTCTTCTTAGG - Intergenic
1069635171 10:69920560-69920582 TCTTTCTTCCCCTTCTTCTAGGG - Intronic
1069893694 10:71667530-71667552 TCTTCCTCTCTCTGCATCTCAGG - Intronic
1070553039 10:77506053-77506075 TCTTTCTCTCATTTCCTCTTAGG + Intronic
1070768616 10:79070053-79070075 TCTTTCTTCCTCTCCGTCTCCGG + Intronic
1071062569 10:81590242-81590264 TTTTTCTTTCATTTCAACCCTGG - Intergenic
1071186940 10:83057461-83057483 TCTTTATTTGACTAAATCTCTGG + Intergenic
1071224525 10:83512814-83512836 TCTTTCTTTTTCTTCATTACTGG - Intergenic
1072221404 10:93330603-93330625 TGACTCTTTCTCTTCATCTCAGG - Intronic
1072704371 10:97669771-97669793 TCACTCTTTCCCTACATCTCAGG - Intronic
1073643435 10:105275922-105275944 TCTTTCTTTAACTTTTTTTCTGG - Intergenic
1073866358 10:107808955-107808977 TCTGTCTTCCACATCATCCCTGG - Intergenic
1074014026 10:109514912-109514934 TCTTTTGTTCACTTCATGCCTGG - Intergenic
1075316598 10:121458390-121458412 TCTTTATTCCACTTCATCCCAGG + Intergenic
1075936567 10:126347456-126347478 TCTTTCCTTCATTTCAACTTTGG + Intronic
1076234356 10:128852330-128852352 TCTTTTTTCCCCTTCATATCTGG - Intergenic
1077684044 11:4274080-4274102 TCATTCTTTCCCTGCCTCTCAGG - Intergenic
1077685998 11:4292684-4292706 TCATTCTTTCCCTGCCTCTCAGG + Intergenic
1077691148 11:4343842-4343864 TCATTCTTTCCCTGCCTCTCAGG + Intergenic
1077904490 11:6519403-6519425 TCTCTATTTCACATCTTCTCTGG + Intronic
1077984666 11:7339789-7339811 TCTTTCTTTCATTTCAACCTTGG + Intronic
1078140765 11:8691428-8691450 ACGTTCTTTCACATGATCTCTGG - Intronic
1078140768 11:8691461-8691483 ACGTTCTTTCACATGATCTCAGG - Intronic
1078275984 11:9847198-9847220 ACTTTCTTTCACTGCATCCCTGG - Intronic
1078277399 11:9862951-9862973 TCTTTCATTCTCTTCAATTCTGG + Intronic
1078726610 11:13937802-13937824 TTTTTCCTTCATTTCATCTTTGG + Intergenic
1078841349 11:15078061-15078083 TCTTTTTTTCCCCTAATCTCAGG + Intronic
1079337699 11:19585814-19585836 TTTTTCTTTCATTTCAACTTTGG + Intronic
1079623665 11:22588516-22588538 TATTTTTTTCACAGCATCTCAGG - Intergenic
1079864946 11:25723175-25723197 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1080192020 11:29562314-29562336 TCTTTTTGTTACTTAATCTCAGG - Intergenic
1081076718 11:38683837-38683859 TCTTTCTTGCACATCTCCTCAGG - Intergenic
1081417036 11:42828218-42828240 TCTTTCATTCACTTCATCTGGGG - Intergenic
1082150742 11:48735588-48735610 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1082151803 11:48749131-48749153 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1082233529 11:49797594-49797616 TTTTTCCTTCACTTCAACTTTGG + Intergenic
1082714036 11:56591102-56591124 TTTTTCCTTCATTTCATCTTTGG + Intergenic
1082728807 11:56770074-56770096 TCTTTCTCTCCCTCCATCCCAGG + Intergenic
1082819611 11:57536039-57536061 TCTCTCTTTCAGATCATCCCGGG + Intergenic
1082905913 11:58308567-58308589 TTTTTCCTTCATTTCATCTTTGG + Intergenic
1084925674 11:72509382-72509404 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1085131948 11:74047654-74047676 TATGTCTTTCTCTTCAGCTCAGG - Intronic
1085620281 11:78032658-78032680 TCTTTCCTCCACATCTTCTCTGG + Intronic
1085620501 11:78034539-78034561 TCTTTCTTTCAAGTCATGTGTGG + Intronic
1085655607 11:78311891-78311913 TGTTTCTCTCACCCCATCTCAGG - Intronic
1085810587 11:79677484-79677506 CCTTTCTTTCACTTCATTTGTGG + Intergenic
1086019083 11:82204242-82204264 TCTTTCATTCAATTCATTTATGG + Intergenic
1086882125 11:92161413-92161435 TGTTTCTTTTACTTTGTCTCTGG - Intergenic
1087533259 11:99410563-99410585 TCTCTCTCTCTCTTCTTCTCTGG - Intronic
1087565269 11:99847874-99847896 GTGTTCTTTCACTTCATTTCAGG - Intronic
1087616368 11:100490390-100490412 TTTTTCCTTCATTTCATCTTTGG - Intergenic
1087641826 11:100763332-100763354 TCTTTCTTTCACTCTTTTTCAGG + Intronic
1087659216 11:100966194-100966216 TCATGATTTCACTTGATCTCTGG + Intronic
1087757375 11:102068937-102068959 TCTCTCTCACACTTCTTCTCTGG + Intronic
1087887948 11:103502205-103502227 TTTTTCTTTCATTTCACCCCTGG - Intergenic
1088017213 11:105075299-105075321 TCTGTCTTTCCCTTCAGCTGTGG + Intronic
1088019785 11:105105400-105105422 TCTGTCTTTCCCTTCACCTGTGG + Intergenic
1089806071 11:121091577-121091599 TTTCTCTTTCAGTTCTTCTCTGG + Intergenic
1090046359 11:123338097-123338119 TCTCTCTTTCACTTCTTATATGG + Intergenic
1090517569 11:127445517-127445539 CCTTTTTTTCACCTAATCTCGGG + Intergenic
1090649321 11:128792532-128792554 TCTTTCTTTCTATCCATCCCTGG + Intronic
1091639923 12:2228681-2228703 TCATTCCATCATTTCATCTCTGG + Intronic
1092079148 12:5699149-5699171 TTTTTCCTTCACTTCAACTTTGG - Intronic
1092637094 12:10463586-10463608 TCTTTCTTTCATTTCTACCCTGG + Intergenic
1092705170 12:11275380-11275402 TCTTTCATTCTCTTCATCCTTGG + Intergenic
1092709567 12:11321020-11321042 TCTTTCATTCTCTTCATCCTTGG + Intergenic
1092954096 12:13533450-13533472 TCTCTTTTTCACTTCAATTCAGG + Intergenic
1093110769 12:15149276-15149298 ATTTTTTATCACTTCATCTCAGG + Intronic
1093196232 12:16132451-16132473 TCTTCCTCTTACCTCATCTCAGG - Intergenic
1094326081 12:29240670-29240692 TTTTTCAATGACTTCATCTCTGG - Intronic
1094359748 12:29617586-29617608 TCTTTCTCTCTTTTCCTCTCTGG - Intronic
1094717787 12:33030476-33030498 TCTTTCTTTCTCTTCATACCTGG - Intergenic
1094861192 12:34468485-34468507 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1096159721 12:49366852-49366874 TCTTTCCGTCAGTTCAGCTCGGG + Intronic
1096751184 12:53759838-53759860 TCTTTCTTTCATCTCATTTAGGG + Intergenic
1096786545 12:54020056-54020078 TCCTTCTTTCTCTCCCTCTCTGG + Intronic
1097624558 12:61983952-61983974 TCATTCTCTCACCTCATCCCTGG + Intronic
1097786068 12:63760557-63760579 TCTTGCTTTCTCTCCATTTCTGG + Intergenic
1098053109 12:66474535-66474557 TTTTTCCTTCATTTCAACTCTGG - Intronic
1098779712 12:74671212-74671234 TCTTTATTTCACTTAATTCCTGG + Intergenic
1098980164 12:76947148-76947170 TCTTTCCCTCACTTGATCTATGG + Intergenic
1099355054 12:81623767-81623789 TCTTACTTTCACTATATCTTAGG - Intronic
1099357865 12:81660754-81660776 TTTTTCTTTCATTTCAACTTTGG - Intronic
1099394700 12:82122800-82122822 TTTTTCTTTCACTTCAACCTTGG - Intergenic
1099473348 12:83077304-83077326 TCTTGGTTTCACTTCACCTTTGG - Intronic
1099484728 12:83214942-83214964 TCTTTCCTTGTCTTCATCACGGG - Intergenic
1099488093 12:83252779-83252801 TCTTGCTTTCACTCTTTCTCTGG - Intergenic
1099933651 12:89101057-89101079 GCTTTCTCTCAGTTTATCTCTGG + Intergenic
1100113356 12:91272426-91272448 TATTCCTTACACTTCACCTCAGG + Intergenic
1100145056 12:91667638-91667660 TCTTTCTTTCACATTATTGCAGG - Intergenic
1100732011 12:97481163-97481185 TTTTTCTTTCATTTCTTCTGAGG + Intergenic
1100742321 12:97607658-97607680 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1100926463 12:99554070-99554092 TCTCTCTTTCTCTTCATATCTGG - Intronic
1101363423 12:104049230-104049252 TCTTTCTCTCACTCTCTCTCAGG + Intronic
1101622214 12:106399534-106399556 TTTTTCTTTCATTTCAACTTTGG - Intronic
1102626928 12:114242608-114242630 TCTTTTTTTCACTTTCTTTCAGG - Intergenic
1102986058 12:117279663-117279685 TCTTCCTCTCGCTCCATCTCTGG - Intronic
1103893587 12:124257977-124257999 TCTTTGTCTCACTTCACCTGAGG + Intronic
1104134401 12:125923580-125923602 TCTTTCTTCCATTTCATCCTTGG - Intergenic
1104938090 12:132377562-132377584 TCTGTCTCTCTCTTCCTCTCTGG - Intergenic
1104938169 12:132378065-132378087 TCTGTCTCTCTCTTCCTCTCTGG - Intergenic
1105072886 12:133246630-133246652 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1105564363 13:21529661-21529683 TCTTTCGTTGACATGATCTCAGG + Intronic
1106377262 13:29201938-29201960 TCTTTCTTTCATTTCAACCTTGG + Intronic
1106914185 13:34494660-34494682 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1107058057 13:36128165-36128187 GCTTTCTTTCACTTCATTTCTGG - Intronic
1107272998 13:38642636-38642658 TCTCTCTCTCTCTGCATCTCAGG - Intergenic
1107765319 13:43728111-43728133 TCTTTCTTTTCCTTCTTCTCTGG + Intronic
1108262615 13:48674056-48674078 TTTTTCCTTCACTTCAGCCCTGG + Intronic
1108841780 13:54626698-54626720 TCTTGGTTTCACTTCCTCTCAGG - Intergenic
1109545843 13:63838834-63838856 TCTTTTTTTCCCTTCATCACGGG - Intergenic
1109556720 13:63985935-63985957 TCTTTCATTCACTCATTCTCTGG + Intergenic
1109675771 13:65674236-65674258 TTTTTCTTTCATTTCATCCTTGG + Intergenic
1109704817 13:66076675-66076697 TCTTTCTTTCAACTCTTATCAGG + Intergenic
1109765291 13:66887722-66887744 TCTTTATTTCACACCATCTCTGG + Intronic
1110152274 13:72269920-72269942 TTTTTCCTTCATTTCATCTTTGG + Intergenic
1110179895 13:72604146-72604168 TAATTCTTTCACTTCATCCCTGG - Intergenic
1110803177 13:79724079-79724101 TCTTTCTTGGACTTGATCTGGGG - Intergenic
1112352493 13:98648029-98648051 TCTGTCTTCCACTTCAGCTTGGG + Intergenic
1112363715 13:98739835-98739857 TTTTTTATTCACTTCATCTCAGG + Intronic
1113106969 13:106782682-106782704 TTTTTCCTTCACTTCAACTTTGG + Intergenic
1113343018 13:109445896-109445918 TTTTTCCTTCATTTCATCTTTGG + Intergenic
1114774587 14:25466715-25466737 ACCTTGTTTCACTTCACCTCTGG - Intergenic
1114956984 14:27834757-27834779 TCTTGCATTAACTTTATCTCTGG - Intergenic
1114989350 14:28268118-28268140 GATTTCTTTCACTTCAACTCTGG - Intergenic
1115309900 14:31968611-31968633 CCCTACTTTCACTTCCTCTCTGG + Intergenic
1115882193 14:37932185-37932207 TTTGGCTCTCACTTCATCTCGGG + Intronic
1116524413 14:45887665-45887687 TTTTTCCTTCACTTCAACTTTGG + Intergenic
1116626984 14:47277935-47277957 TTTTGCTTCCTCTTCATCTCTGG - Intronic
1117280483 14:54235570-54235592 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1117320635 14:54619969-54619991 TCTTTTTTTTAATTGATCTCAGG + Intronic
1117358603 14:54949709-54949731 TTTTTCTTTCATTTCAACTTTGG - Intronic
1117617494 14:57548526-57548548 TCTTTCAGACACTTCATCTGAGG + Intergenic
1117699546 14:58399252-58399274 TCTTTCTTCCTCTTCTTCCCAGG + Intronic
1117932981 14:60865927-60865949 TCTTTCTTCCCCTCCATTTCAGG + Intronic
1120166061 14:81201780-81201802 GCTTTCAATCATTTCATCTCAGG + Intronic
1120478770 14:85022821-85022843 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1120606976 14:86591451-86591473 TCTTTCCTTCATTTCAACTTTGG - Intergenic
1120625899 14:86826203-86826225 TCTATCTTATACTTCCTCTCAGG - Intergenic
1120706623 14:87752488-87752510 TCTTTCTTTCCCCTCTTCTTTGG - Intergenic
1121922408 14:97894438-97894460 TCTTTCTCTCTCTCCATCTGTGG - Intergenic
1121988540 14:98531563-98531585 TTTTTCTTTCTGTTCACCTCAGG - Intergenic
1122085920 14:99304816-99304838 TCTCTCTTCCTCTTCATATCAGG + Intergenic
1122523841 14:102365781-102365803 TCTATATCTAACTTCATCTCAGG - Intronic
1202838543 14_GL000009v2_random:98492-98514 TCTTTCTCTCTCTTTTTCTCAGG + Intergenic
1202846491 14_GL000009v2_random:182266-182288 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1202907906 14_GL000194v1_random:88560-88582 TCTTTCTCTCTCTTTTTCTCAGG + Intergenic
1202915955 14_GL000194v1_random:172868-172890 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1202885321 14_KI270722v1_random:100731-100753 TCTTTCTCTCTCTTTTTCTCAGG - Intergenic
1123506663 15:20947837-20947859 TCTTTCTTTCATTTCAACCTTGG + Intergenic
1123875534 15:24620419-24620441 TGTTTCTTTCATTTCAACTTTGG + Intergenic
1125245297 15:37629800-37629822 TCTGTCTTCCACCACATCTCTGG + Intergenic
1125807224 15:42503998-42504020 TCCTCCTTTTACTTCCTCTCTGG - Intronic
1126413383 15:48394587-48394609 TCTTCCCTTGACTTCAACTCAGG + Intergenic
1127031926 15:54873396-54873418 TTTTTCCTTCATTTCAACTCTGG - Intergenic
1127330286 15:57932336-57932358 TCTTCCTTTCACTGCATCGGAGG - Intergenic
1128096712 15:64961839-64961861 TGTTTCTCTCGCGTCATCTCAGG - Intergenic
1129655151 15:77519176-77519198 TCTTCCTTTGACAGCATCTCAGG - Intergenic
1129796362 15:78380387-78380409 TTTTTCCTTCATTTCAACTCTGG + Intergenic
1131590000 15:93738833-93738855 TTTTTCTTTCATTTCGTCTTTGG + Intergenic
1131729366 15:95263057-95263079 TCATTCTTTCATTCCATCTTGGG + Intergenic
1131732557 15:95297124-95297146 TTTTTTTTTCACTTCAGCTATGG + Intergenic
1131967550 15:97860072-97860094 TCTGTCTCTCCCTTAATCTCTGG + Intergenic
1132000271 15:98172460-98172482 TATTTCTCTCTCCTCATCTCAGG + Intergenic
1132162256 15:99553748-99553770 TCACTCTTTCTCTTCCTCTCAGG - Intergenic
1202972248 15_KI270727v1_random:248677-248699 TCTTTCTTTCATTTCAACCTTGG + Intergenic
1133730648 16:8575946-8575968 TCTTTCTTTCTCTCCATCACAGG - Intronic
1136015873 16:27400751-27400773 TTTTTCTTTCTCTTGATCTTCGG - Intergenic
1136388269 16:29944221-29944243 TCTTACTGTATCTTCATCTCAGG - Intronic
1136983172 16:35076480-35076502 TTTTTCCTTCATTTCATCTTTGG - Intergenic
1137263218 16:46847670-46847692 TCTCTCTGTCACTTCCTCTATGG - Intergenic
1137326178 16:47439392-47439414 TTTTTCTTTCATTTCAACTTTGG - Intronic
1137347886 16:47682195-47682217 TTTTTCTTTCATTTCAACTTTGG + Intronic
1137907216 16:52335100-52335122 TTTTTCCTTCATTTCAACTCTGG - Intergenic
1139736776 16:68996958-68996980 TCTTTATTTCATTTCCTCTATGG - Intronic
1141245052 16:82298205-82298227 TCTGTCTATGTCTTCATCTCTGG + Intergenic
1141284691 16:82660562-82660584 TCTTTCTTTCACTTCATCTCTGG - Intronic
1141287548 16:82686659-82686681 TCTTTCATGCACGTTATCTCCGG - Intronic
1144057427 17:11555455-11555477 TCTCTCTCTCAGTACATCTCTGG - Intronic
1144597186 17:16580579-16580601 TCTCTCTCTCACTTCCTCTCTGG - Intergenic
1144662434 17:17079996-17080018 TCTTTCTTTCCCCACATCCCTGG - Intronic
1145116122 17:20211901-20211923 TCTTCCTTTCACATGACCTCAGG + Intronic
1147415716 17:40288085-40288107 TTTTCCCTTCACTTCACCTCAGG - Exonic
1148455760 17:47810654-47810676 TTGTTCTTCCACTTCATATCTGG + Exonic
1148596026 17:48856247-48856269 TATTTTTTTCACTACATCTCTGG - Intronic
1148823575 17:50375883-50375905 TCTTTCTTTCCTGTCTTCTCAGG - Exonic
1149106597 17:52974897-52974919 TCTTTCTTTCATTTGGTCACGGG + Intergenic
1149290054 17:55209278-55209300 TCTTTCTAACAATTCATCTGGGG + Intergenic
1149305468 17:55342798-55342820 TCTGTCTGTCCCTTCATCACAGG - Intergenic
1149338592 17:55663296-55663318 TCACTCTCTCAATTCATCTCAGG + Intergenic
1149425177 17:56548085-56548107 TCTTTCTGTCTCATGATCTCTGG - Intergenic
1150626961 17:66848059-66848081 TCTTTCTCACCCTTCATGTCGGG + Intronic
1151541617 17:74767617-74767639 ACCTTCTTTCACCTCATCTTTGG + Intronic
1153158586 18:2177404-2177426 CTTTTCTTTCTCCTCATCTCAGG + Intergenic
1153324522 18:3804412-3804434 TATTTCCTTCAGTTCATCTGGGG - Intronic
1153419995 18:4894276-4894298 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1153495008 18:5688964-5688986 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1154185989 18:12183334-12183356 TCTTTCCTTCATTTCAACTTTGG - Intergenic
1155090884 18:22509791-22509813 TTTTTCTTTCTCCTCTTCTCTGG + Intergenic
1155321454 18:24623482-24623504 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1155675147 18:28420976-28420998 TCTTTCCTTCATTTCAACTTTGG + Intergenic
1155821356 18:30381656-30381678 TCATTATTTCACAGCATCTCAGG + Intergenic
1157267536 18:46240516-46240538 TCTTTCTCTCACTTTAATTCTGG + Intronic
1157408580 18:47444796-47444818 TCTCTCTGTCTCTTCATTTCTGG + Intergenic
1157908611 18:51593959-51593981 TCTGTCTTTGAATTCATCTGGGG + Intergenic
1157920950 18:51712092-51712114 TCTCTCTTTATCTTCATTTCAGG - Intergenic
1158013158 18:52752170-52752192 TCTTTCTTCCACTTGATCACTGG - Exonic
1158051909 18:53232493-53232515 TCTTTCATTCTCTTCATGCCAGG + Intronic
1158101260 18:53832810-53832832 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1158114319 18:53978162-53978184 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1158414187 18:57234748-57234770 TCTTTCTTTCTCTGGGTCTCTGG + Intergenic
1158469308 18:57720803-57720825 TTTTTCTTTCATTTCAACTTTGG - Intronic
1159465485 18:68777484-68777506 TCTAACTTTCACTTCATGTTGGG + Intronic
1159563231 18:70018160-70018182 TCTTACATTCACTTTATCCCAGG + Intronic
1159829241 18:73253289-73253311 TCTTTATTTCAATTGATTTCTGG - Intronic
1160014964 18:75133571-75133593 TCTTTCTTTCTCTCCATTTGGGG + Intergenic
1161122914 19:2540009-2540031 TCTTTCTTTCTCTTTCTCTCTGG + Intronic
1163976082 19:20853761-20853783 TTTTTCTTTCATTTCAACTTCGG - Intronic
1164064482 19:21703839-21703861 TCTTTCTTTTATTACATCTAGGG - Intergenic
1165287991 19:34859046-34859068 TTTTTCCTTCATTTCATCTTTGG - Intergenic
1166025368 19:40078333-40078355 TTATTTTTTCTCTTCATCTCTGG - Intronic
1166316027 19:41990767-41990789 TCTTTCTCTCACTTTCTCTCTGG + Intronic
1166911538 19:46162224-46162246 TCTTTCTTTCATTTCAACCTTGG + Intergenic
1167349912 19:48968146-48968168 TATTTTTTTCATCTCATCTCCGG + Exonic
1202651399 1_KI270707v1_random:7956-7978 TCTTTCTCTCTCTTTTTCTCAGG + Intergenic
925220396 2:2134876-2134898 TCTCACTTTCTCTTCATCACAGG + Intronic
925399400 2:3560984-3561006 TCTTTTTTTATCTTAATCTCTGG + Intergenic
925662089 2:6213354-6213376 TCTTTCTTTGACTTTATAGCAGG - Intergenic
925963418 2:9040022-9040044 TTTTTCTTTCATTTCAACTTTGG - Intergenic
926573514 2:14555457-14555479 TCTTTCTCACACTTCTTATCTGG + Intergenic
926693261 2:15752103-15752125 TGTTTCTATCTCCTCATCTCAGG + Intergenic
926932603 2:18055343-18055365 GCTTTCTGTTACTTTATCTCAGG - Intronic
927410472 2:22819851-22819873 TATATCTGTCACTTCATTTCTGG - Intergenic
927759873 2:25743307-25743329 TCTCTCATTAACTTCCTCTCTGG + Intronic
928053360 2:28025065-28025087 GATTTCTCTAACTTCATCTCTGG + Intronic
928672181 2:33612894-33612916 TCTTTCTTTCTCTGCATGTCGGG + Intergenic
928675275 2:33644946-33644968 TTTTTCTTTCTCTTCTCCTCTGG + Intergenic
929421145 2:41790914-41790936 TCTATCTTCCTCTTCCTCTCTGG + Intergenic
929756372 2:44768778-44768800 GCTTTCTTCCTCTCCATCTCTGG + Intronic
930014674 2:46962179-46962201 TCTTCCCTTCACTTCTTCTTGGG + Intronic
930220510 2:48741398-48741420 TTTTTCTTTCATTTCAACTTTGG - Intronic
930339528 2:50095023-50095045 TCTTTCTTCTGCTTCATCCCTGG + Intronic
930942632 2:57030536-57030558 TATTTCTTACATTTCTTCTCTGG + Intergenic
931111601 2:59117184-59117206 ACTCTATTTCACTTCCTCTCAGG - Intergenic
931217151 2:60256693-60256715 TCCTTCTTTCACTTTTTCACTGG - Intergenic
931677334 2:64710490-64710512 TATTTCTTTAAATTCATCACTGG + Intronic
931729326 2:65139111-65139133 TCTGGCTTTCATTTCATCTATGG - Intergenic
931860661 2:66351315-66351337 TTTTTCTTTCATTTCAACTTTGG + Intergenic
933016714 2:77137182-77137204 TTTTTCCTTCATTTCATCTTTGG - Intronic
933018672 2:77163533-77163555 TTTTTCCTTCACGTCATCTTTGG - Intronic
933159281 2:79006681-79006703 TCTTGCTTGCACTTCAACTCTGG + Intergenic
933187228 2:79291522-79291544 CCTTTCTTTCATTTCCTCCCAGG + Intronic
933318066 2:80738536-80738558 TTTTTCTTTCATTTCAACTTTGG - Intergenic
933410668 2:81921041-81921063 TTTTTCTTTCATTTCAACTTTGG + Intergenic
934250941 2:90354779-90354801 TTTTTCCTTCATTTCATCTTTGG + Intergenic
934258622 2:91448631-91448653 TTTTTCCTTCATTTCATCTTTGG - Intergenic
934480298 2:94633216-94633238 TCTTGCATTAACTTTATCTCTGG + Intergenic
934864662 2:97796086-97796108 TTTTTTTTTCACTTAATCTTTGG - Intronic
935676400 2:105598202-105598224 TCATTCTTTCACTTCCTCCCAGG - Intergenic
935825124 2:106939523-106939545 GCTTTCCTGCACTTCATTTCAGG + Intergenic
935858175 2:107298257-107298279 TCTTTCCTTCATTTCAACTTTGG + Intergenic
935929788 2:108112072-108112094 TTTTTCTTTCATTTCATCCTTGG + Intergenic
936524601 2:113234230-113234252 TCCCACTTTCACTGCATCTCAGG + Intronic
936727220 2:115333858-115333880 TTTTTCCTTCACTTCAACTTTGG + Intronic
936896759 2:117436395-117436417 ACTTTCTTTTATGTCATCTCAGG - Intergenic
937758962 2:125576406-125576428 TTTTCCTGTAACTTCATCTCTGG + Intergenic
938246057 2:129778865-129778887 TGGGCCTTTCACTTCATCTCAGG - Intergenic
938799770 2:134750948-134750970 TTTTTCTTTCATTTCAGCTTTGG + Intergenic
938944132 2:136195601-136195623 TTTGTCTTGCTCTTCATCTCAGG + Intergenic
938953610 2:136279174-136279196 GCTTTCAACCACTTCATCTCTGG + Intergenic
939210604 2:139170532-139170554 TCTTTCTTCCACTTTATTTTTGG - Intergenic
940095321 2:149967414-149967436 TTTTTCTTTCATTTCAACTTTGG - Intergenic
940298438 2:152154304-152154326 TTTTTTATTCACTTCGTCTCTGG - Intronic
941090771 2:161172603-161172625 TCTTTCTGTCACTTTATGTCTGG + Intronic
941286826 2:163624411-163624433 TTTTTCTTTCTCTTCTTCTTAGG - Intronic
941593275 2:167446298-167446320 TTTTTCCTTCACTTCAACTTTGG + Intergenic
941626586 2:167836734-167836756 TTTTTCCTTCATTTCAACTCTGG - Intergenic
942114962 2:172719866-172719888 TCTGTTGATCACTTCATCTCAGG + Intergenic
942731479 2:179065612-179065634 TTTTTCTTTCATTTCAACTTTGG + Intergenic
942956432 2:181779596-181779618 TGTTTCTTTCATTCCATCTCTGG - Intergenic
943143567 2:184014043-184014065 TTTTTCTTTCACTTCCTTTGAGG + Intergenic
943730468 2:191297964-191297986 AGGTTCTTTCACTTCATTTCAGG - Intronic
943795564 2:191988760-191988782 TCTTTCTTTCACATCTTCTGAGG - Intronic
943941107 2:193998721-193998743 TATTTGTTTCACTTAATCTTTGG - Intergenic
944196944 2:197064008-197064030 TTTTTCCTTCATTTCATCTTTGG - Intronic
944918631 2:204387609-204387631 TCTGTTTTTCATTACATCTCTGG - Intergenic
945016137 2:205519019-205519041 TCTTTCTTTCATTTCAACCTTGG + Intronic
945171644 2:207002470-207002492 TTTTTCCTTCATTTCATCTTTGG - Intergenic
945306809 2:208266490-208266512 TCTCACTTTCACCTCAGCTCTGG - Intronic
945325491 2:208477417-208477439 TCTTTGTTTTAGTTCATCTGTGG + Intronic
945525887 2:210887772-210887794 GCTTTCTCCCACTTCAGCTCAGG - Intergenic
946933720 2:224697610-224697632 TCTTTCTTCCTCTTCTTCCCTGG - Intergenic
947179567 2:227400123-227400145 TCTTTCTCTCACTTCTTGTTAGG + Intergenic
947822167 2:233079669-233079691 CCCTCCTTTCCCTTCATCTCTGG - Intronic
947833969 2:233162005-233162027 TTTTTCTTACCCATCATCTCAGG - Intronic
947861689 2:233363994-233364016 TCTCTCTTTCTCTTCATCTATGG - Intronic
1169788102 20:9382164-9382186 TCATTCTTTCACATCATGTCTGG + Intronic
1170315469 20:15036027-15036049 GCTTTATTTCCCTTCATTTCTGG - Intronic
1170317453 20:15058063-15058085 TCTTTCTTTCACCTTGTCTGAGG + Intronic
1170779397 20:19410714-19410736 TCTTTCATTCACTTATTTTCAGG - Intronic
1172791154 20:37506351-37506373 TCCTTCTTTGAGTGCATCTCTGG + Intronic
1173012205 20:39192432-39192454 TCTTTCGTATATTTCATCTCAGG - Intergenic
1173703572 20:45094070-45094092 TCTTTCTCTCACATCAGCCCTGG + Exonic
1174022790 20:47544674-47544696 TTTTTCTTTCAGTTGATATCAGG + Intronic
1174217660 20:48929563-48929585 TCTTTCCTTCAGTACTTCTCGGG - Intronic
1174348948 20:49953012-49953034 TCTTTCTTCTAATTCATCTGAGG - Exonic
1174788914 20:53459991-53460013 TTTTTCCTTCATTTCAACTCTGG + Intronic
1174790609 20:53474214-53474236 TTTTTCCTTCATTTCAACTCTGG - Intronic
1174793920 20:53505419-53505441 TTTTTCCTTCATTTCAACTCTGG - Intergenic
1175030622 20:55950280-55950302 CCTTTCCTTCACTTCAGATCTGG - Intergenic
1176600743 21:8791689-8791711 TCTTTCTCTCTCTTTTTCTCAGG - Intergenic
1176627266 21:9103247-9103269 TCTTTCTCTCTCTTTTTCTCAGG + Intergenic
1177255367 21:18654569-18654591 TCAGGCTATCACTTCATCTCAGG - Intergenic
1177313396 21:19425866-19425888 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1177328559 21:19627189-19627211 CCTTTCTTTTTCTCCATCTCTGG - Intergenic
1177569928 21:22874343-22874365 TTGTTCTCTCACATCATCTCTGG - Intergenic
1178131537 21:29578235-29578257 TTTTTCTTTCACTTTTTATCTGG - Intronic
1178329541 21:31675840-31675862 TCTTTATTTCACACCATTTCAGG - Intronic
1178339779 21:31776352-31776374 TCTAGCTTTCCCTTCCTCTCTGG + Intergenic
1178414022 21:32389286-32389308 TGCTTCTTTGACTTCATCTCAGG - Intronic
1178811722 21:35889110-35889132 GCTTTCCTGCACTTCATTTCAGG - Intronic
1178916631 21:36708724-36708746 CCTTTCTTTCCCTGCTTCTCCGG - Intronic
1180069481 21:45429210-45429232 GCTTTCTTTAACTGCATCCCTGG + Intronic
1180328212 22:11451353-11451375 TCTTTCTCTCTCTTTTTCTCAGG - Intergenic
1180343029 22:11683226-11683248 TCTTTCTCTCTCTTTTTCTCAGG - Intergenic
1180414847 22:12699281-12699303 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1180417613 22:12782856-12782878 TCTTTCTCTCTCTTTTTCTCAGG + Intergenic
1180598917 22:17001073-17001095 TTTTTCTTTCATTTCAACTTTGG + Intronic
1181342103 22:22189534-22189556 TTTTTCCTTCATTTCAACTCTGG - Intergenic
1183112195 22:35658593-35658615 TCTTTATTTCATTTCTCCTCAGG + Exonic
1184368305 22:44066873-44066895 TCTTTCTTTTTCTTCTTCTTAGG + Intronic
1185234056 22:49701035-49701057 TCTGTCTCTCTCTTCCTCTCAGG + Intergenic
949411524 3:3770336-3770358 TGTGTCTTCCACTTCATCTAGGG - Intronic
950051276 3:9991702-9991724 TGTTTTTTCCACTTCATATCAGG + Intronic
950432720 3:12960207-12960229 CCTCTCTTTCCCATCATCTCGGG + Intronic
951469931 3:23045211-23045233 TTTTTCTTTCATTTCAGCTTTGG - Intergenic
951701529 3:25502114-25502136 TCTTTCTGTCACTCCATCATGGG + Intronic
952025222 3:29072417-29072439 TCTTTCTCTCCCTTTTTCTCTGG + Intergenic
952040847 3:29259847-29259869 TCTTGCTGTTACTTCATATCTGG - Intergenic
952925865 3:38318738-38318760 TCTTGCCCTCACTTCACCTCTGG - Intergenic
953317722 3:41944118-41944140 TCTTTCTTCCCCTTCCTCCCTGG + Intronic
953501452 3:43438935-43438957 TCTTTCTGTCTCTTCTCCTCTGG - Intronic
955644398 3:61121301-61121323 TTTTTCTTTCATTTCAACTTTGG - Intronic
956432651 3:69203072-69203094 TTTTTTTTTTACTTCATCTTAGG - Intronic
956557869 3:70541930-70541952 TATCTCTTTCACCTCTTCTCAGG + Intergenic
956830923 3:73047305-73047327 TCTTTCCTTCATTTCATCAAAGG - Exonic
956866328 3:73372894-73372916 TTTTTCCTTCATTTCATCTTTGG + Intergenic
957219762 3:77366750-77366772 TCTCACTCTCACTTCCTCTCTGG - Intronic
957308473 3:78488718-78488740 TCTTTCCTTCATTTCAACTTTGG - Intergenic
957445959 3:80313200-80313222 TTTTTCTTTCATTTTATCCCTGG - Intergenic
957495947 3:80991447-80991469 GATTTATTTCACTTCATTTCTGG + Intergenic
957814710 3:85280917-85280939 TTTTTATTTTACTTCATCTTTGG - Intronic
957918987 3:86723982-86724004 TTTTTCTTTCACTTCAACCTTGG + Intergenic
958022130 3:88010671-88010693 TTTTTTTTTCACTTCATCTAAGG - Intergenic
958208395 3:90435091-90435113 TTTTTCCTTCATTTCATCTTTGG + Intergenic
958656187 3:97006598-97006620 TATCTCTTTCAGTTCTTCTCTGG + Intronic
959043810 3:101449426-101449448 TTTTTCTTTCATTTCAACTTTGG - Intronic
959520025 3:107315173-107315195 TCTTTCTTTCATTTCAGCCTCGG + Intergenic
959595465 3:108124476-108124498 GCTTTCATTCACTTCCTCTTTGG - Intergenic
959676535 3:109042025-109042047 TCTTTCTCTCATTTCTTCTAGGG - Intronic
959843953 3:111011509-111011531 TCTCTTTTTTACTTCATCTTTGG - Intergenic
959955907 3:112237891-112237913 TTTTTCTTTCATTTCAACTTCGG + Intronic
960007900 3:112799808-112799830 CCATTCTTTCGCTTCTTCTCAGG - Intronic
960343068 3:116498722-116498744 ACTTTCTTTCATTTCATTTGTGG - Intronic
960821663 3:121739495-121739517 TCTTGTTTTCACTTTATTTCTGG - Intronic
960841730 3:121965383-121965405 TCTTTCTTTCATTTCAACCTTGG - Intergenic
961186161 3:124917027-124917049 TCTTTGTTTCAGTTCTCCTCTGG - Intronic
961774441 3:129274175-129274197 TTTTTTTTTTTCTTCATCTCTGG - Intronic
961941948 3:130647055-130647077 TCTTTTTTTCACCTCCTCTGTGG + Intronic
962169317 3:133083864-133083886 TTTTTTTTTTACTTTATCTCAGG - Intronic
962185181 3:133251003-133251025 TGTTTGTTTCACTTCATTTGAGG + Intronic
962566275 3:136663498-136663520 TCTTTCATTCCCCTTATCTCTGG - Intronic
962717162 3:138136575-138136597 TCTATCTTCCCCTTCTTCTCAGG - Intergenic
963567224 3:146945109-146945131 TTTTTCTTTCATTTCAACTTTGG + Intergenic
963885984 3:150582812-150582834 TCTTTCATTCACTTTTTATCGGG + Intronic
965196095 3:165597004-165597026 TCTATGTTCCTCTTCATCTCAGG + Intergenic
965485011 3:169267850-169267872 TCTTCCTTTTCCTGCATCTCTGG - Intronic
965973125 3:174587810-174587832 TTTTTCCTTCATTTCAACTCTGG + Intronic
966000380 3:174942466-174942488 TCTTTCTTTCATTTCAACCTTGG + Intronic
966490139 3:180518181-180518203 TCTTTCTTTCATTTCAACCTTGG - Intergenic
967502903 3:190221055-190221077 TCTTTCTTTCATTTCAACCTTGG + Intergenic
967697376 3:192547980-192548002 TCATTTTTTGACTTCATTTCTGG - Intronic
970864244 4:20740290-20740312 TCTTTCCTTCATTTCAACTTTGG - Intronic
971175570 4:24279328-24279350 TCTTTCTTTCTCATGATGTCTGG - Intergenic
971283279 4:25260769-25260791 TCCTTCTTTCACTTAATCCTTGG + Intronic
971683724 4:29736347-29736369 TATTTTTTTAACTTCATCTTAGG + Intergenic
971708376 4:30078428-30078450 TTTTTCTTTCATTTCATCCTCGG + Intergenic
971838699 4:31803245-31803267 TCTTTCTCTGTCTCCATCTCAGG + Intergenic
972066227 4:34948862-34948884 TTTTTTTTTCACTTGGTCTCAGG - Intergenic
972757192 4:42059432-42059454 TCTTTCTTTCATTTCCACTTAGG - Intronic
972945919 4:44255234-44255256 CCTTTCTTTCAGTTCTTCTGTGG + Intronic
973055511 4:45652877-45652899 TTTTTCCTTCATTTCATCTTTGG - Intergenic
973168482 4:47108952-47108974 TCTCTCACTCACTTCACCTCGGG - Intronic
973289581 4:48457313-48457335 TCTCTCTTTTACTTCCCCTCTGG - Intergenic
973364183 4:49194437-49194459 TCTTTCTCTCTCTTTTTCTCAGG - Intergenic
973396899 4:49602306-49602328 TCTTTCTCTCTCTTTTTCTCAGG + Intergenic
973689236 4:53408429-53408451 TTTTTCCTTCATTTCATCTTTGG + Intronic
973842905 4:54880606-54880628 TCTTTCTTCCTCTTCTTCTAAGG + Intergenic
974567821 4:63601155-63601177 TCTTTCTTTGATCTCTTCTCTGG + Intergenic
974697615 4:65396567-65396589 TCATTCTTCCATTTCATCACTGG - Intronic
974787245 4:66634990-66635012 TATTTCTGTCACTTGGTCTCTGG + Intergenic
974806616 4:66888791-66888813 TCCTTCTTTCTCTTAAACTCAGG + Intergenic
974918768 4:68210429-68210451 TATTTCTTACACTTCCTCTGAGG - Intergenic
975154660 4:71058268-71058290 TTTTTCCTTCACTTCAACTTTGG + Intergenic
975239292 4:72038178-72038200 TCTTTAAGTCATTTCATCTCGGG + Intronic
975324738 4:73046646-73046668 TCTAGCTTTCAGTTCATCTTGGG + Intergenic
975352562 4:73361813-73361835 TTTTTCTTTCATTTCAACTTTGG - Intergenic
975491283 4:74991505-74991527 TCTCTCTCTCTCTGCATCTCTGG - Intronic
975979944 4:80145892-80145914 TTTTTCTTTCTCTACATCTCTGG - Intergenic
976823623 4:89234954-89234976 TCTTTCTTCCTCTTCCTCCCTGG - Intergenic
977456892 4:97272860-97272882 TTTTTCTTTCATTTCAACTTTGG - Intronic
977509241 4:97940231-97940253 TCTTTCTTTCATTTCAACCTTGG + Intronic
977843832 4:101743328-101743350 TTTTTCTTTCATTTCAACTTTGG + Intronic
978235152 4:106449007-106449029 TCTTTCTTATATTTTATCTCTGG - Intergenic
978296594 4:107212626-107212648 ATATTCTTTCACTTCTTCTCAGG + Intronic
978835344 4:113142716-113142738 TCTTTCTTTTTCTTCATCTCGGG - Intronic
978850639 4:113331939-113331961 TCTTTCTTTCACTGCTGCTTTGG + Intronic
978952747 4:114580969-114580991 TCTTTCTTTCATTTCAACCTTGG + Intergenic
979757769 4:124362943-124362965 TTTTTCCTTCATTTCATCTTTGG - Intergenic
980231372 4:130050635-130050657 TTTTTCCTTCATTTCAACTCTGG + Intergenic
980421731 4:132569825-132569847 TACTTCTTCCACTTCATCTTTGG + Intergenic
980565916 4:134540582-134540604 TCTGTCTTTCTCTTCCTCTAAGG - Intergenic
980645123 4:135634241-135634263 TTTTTCTTTCATTTCAACTTTGG + Intergenic
980965520 4:139517164-139517186 TCTTTCTTTCACATCATAAAAGG + Intronic
981188648 4:141835311-141835333 TTTTTCCTTCATTTCATCTTTGG - Intergenic
981501755 4:145459224-145459246 TTTTTCCTTCATTTCATCTTTGG - Intergenic
981850191 4:149220108-149220130 TCTTTCTTTCATTTCAACCTTGG - Intergenic
982646326 4:158028096-158028118 TTTTTCTTTCATTTCAGCTCAGG - Intergenic
982675429 4:158369874-158369896 TTTTTCTTTTACTTCATTTATGG + Intronic
983553190 4:169036818-169036840 TCTTTCTTCCCCTTCTTCCCAGG + Intergenic
983565908 4:169151559-169151581 ACTTTCTCTCACCTCATCTAAGG - Intronic
983699889 4:170579171-170579193 ACTTTCTTTCTCCTCCTCTCTGG + Intergenic
984740129 4:183153357-183153379 TCTTTGCTTCACTGCCTCTCAGG + Intronic
984960156 4:185088974-185088996 TCCTTCTTTCTCTTCACCACTGG - Intergenic
985303562 4:188514756-188514778 TCTCTCTTCCAGTTCCTCTCTGG + Intergenic
1202761498 4_GL000008v2_random:115564-115586 TCTTTCTCTCACTTTTTCTCAGG - Intergenic
985507200 5:290067-290089 TCTTTCCTTCATTTCATCAAAGG + Intronic
985705135 5:1396114-1396136 TCTCTTTTCTACTTCATCTCTGG - Intronic
986026325 5:3854627-3854649 GCTTCCTTTCACTGCAGCTCCGG - Intergenic
986415325 5:7522400-7522422 TGTTTCTTGCACTTCATCCCAGG - Intronic
986791174 5:11162345-11162367 CCATTCTTTCACTTCTTGTCAGG - Intronic
987431778 5:17843616-17843638 TCTTTCTTTCATTTCAACCTTGG + Intergenic
987571188 5:19661948-19661970 TTTTTCATTTACTTCACCTCAGG + Intronic
987605989 5:20137016-20137038 TCTTTCCTTCATTTCAACTTTGG + Intronic
987983494 5:25118171-25118193 TTTTTCCTTCATTTCAACTCTGG + Intergenic
988266058 5:28952483-28952505 TTTTTCATTCATTTCATCTTTGG + Intergenic
988269243 5:28992729-28992751 TTTTTCCTTCATTTCATCTTTGG - Intergenic
988331581 5:29848679-29848701 TCTTTCTTTTTCTTCCTCTTTGG + Intergenic
988737489 5:34037321-34037343 TTTTTCTTTCTCTTCTTCCCTGG - Intronic
989370478 5:40701739-40701761 TCTTTCTTTCATTTCAACCTTGG - Intergenic
989551569 5:42741552-42741574 TCTTTCTTCCACCTAATCTGAGG + Intergenic
989616585 5:43342458-43342480 TTTTTCTTTCATTTCAACTTTGG - Intergenic
989660621 5:43793329-43793351 TTTTTCTTTCATTTCAACTTTGG - Intergenic
989824472 5:45837255-45837277 TTTTTCCTTCATTTCATCTTTGG + Intergenic
989949615 5:50281784-50281806 TTTTTCCTTCACTTCAACTTTGG - Intergenic
990167987 5:53016694-53016716 TCTTTCTTTCCCTTTCTTTCAGG + Intronic
990192014 5:53269696-53269718 TTTTTCCTTCATTTCATCTTTGG - Intergenic
990500477 5:56391331-56391353 TCTTTCTTTCATTTCAACCTTGG - Intergenic
991233637 5:64366774-64366796 TTTCGTTTTCACTTCATCTCTGG - Intronic
991545396 5:67776263-67776285 CCTTTCTTTTCCTTCATTTCTGG + Intergenic
992007538 5:72492668-72492690 TTTTGCTTTCAGATCATCTCAGG - Intronic
992873216 5:81026255-81026277 TCTTTTTTTTTCTTCCTCTCAGG + Intronic
993018831 5:82566030-82566052 TCTTTCTTTCATTTCAGCCTTGG - Intergenic
993142519 5:84052016-84052038 TTTTTCCTTCATTTCATCTTTGG - Intronic
993275226 5:85849267-85849289 CTTTTCTTTGACTTAATCTCAGG - Intergenic
993370471 5:87086108-87086130 TTTTTCTTTCATTTCAACTTTGG - Intergenic
993603913 5:89963468-89963490 TTTTTTTTTCTCTTCCTCTCAGG - Intergenic
994882606 5:105517682-105517704 TTTTTCCTTCATTTCATCTTTGG + Intergenic
995014845 5:107298268-107298290 TCCTCCTTTTACTTCATTTCTGG - Intergenic
995116973 5:108492124-108492146 TTTTTCCTTCACTTCAACTTTGG - Intergenic
995219827 5:109635404-109635426 TCTTTCTTTCATTTCAACCTTGG - Intergenic
995258484 5:110074214-110074236 TTTTTCTTTCATTTCAACCCTGG + Intergenic
995565436 5:113429256-113429278 TCTTTCTGTCTCTTCATATAAGG - Intronic
995570045 5:113470616-113470638 TTTTTCCTTCATTTCAACTCTGG + Intronic
995785735 5:115825594-115825616 TTTTTCTTTCATTTCAACTTTGG + Intergenic
995836331 5:116403124-116403146 ACTCCCTCTCACTTCATCTCAGG + Intronic
995896012 5:117011271-117011293 TTTTTCTTTCATTTCAACTTTGG + Intergenic
996261712 5:121479171-121479193 TCTTTCTGTCTTTGCATCTCTGG + Intergenic
996355958 5:122596968-122596990 TTTTTCTTTCATTTCAACTTTGG + Intergenic
997017337 5:129951793-129951815 TCTGCCTTTCAATTCATATCTGG - Intronic
997107979 5:131043634-131043656 TCTCTCTTTCAATTCTGCTCTGG - Intergenic
997316867 5:132943867-132943889 TCCGTCTTTCCCTTCAGCTCAGG - Intronic
998526811 5:142850032-142850054 TCTTTCCTTCCCTTCCTCTGTGG + Intronic
998571672 5:143264805-143264827 TCTTTCATACACATCATCTTAGG - Intergenic
998927145 5:147138956-147138978 TATTTCTTTCAGTTCTGCTCTGG + Intergenic
999338403 5:150744497-150744519 TTTTTCTTTCATTTCAACTTTGG - Intronic
999475380 5:151893351-151893373 TCTTTCTTTCATTTTAGTTCTGG + Intronic
999846654 5:155488863-155488885 GATTTCTTTCAGTTCAGCTCTGG + Intergenic
999867613 5:155718372-155718394 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1000448613 5:161356741-161356763 TGTTTCTTTCTCTGCATCTCTGG - Intronic
1000854741 5:166384060-166384082 TGTATGTTTCACTTCATCTCAGG - Intergenic
1001009086 5:168081865-168081887 TTTTTCTTTCATTTCAACTTTGG + Intronic
1001428699 5:171642752-171642774 TCTTTCTCTCTCTTCGTCTTTGG - Intergenic
1001436095 5:171700629-171700651 TCCTCCTTGCACTTGATCTCAGG - Intergenic
1001846103 5:174922831-174922853 TCTCTCTTTCTCCTCATCTTTGG + Intergenic
1002611390 5:180420706-180420728 TCTTTATTTCACCTCATTCCTGG - Intergenic
1002846530 6:950617-950639 ACTTTCTTACACTTCCTCTGTGG - Intergenic
1003437465 6:6105099-6105121 TCTTTCTTCCATTTCAGCTTTGG + Intergenic
1003484234 6:6561981-6562003 CCCTGCTTTAACTTCATCTCAGG + Intergenic
1004040243 6:11968030-11968052 TATTTTTTTCTCTTCATCTCGGG + Intergenic
1004763166 6:18693803-18693825 TCTTTCTATCCCTTGCTCTCTGG + Intergenic
1005437122 6:25826081-25826103 TGTTTCATTAATTTCATCTCTGG - Intronic
1006040330 6:31247518-31247540 TCTTTCTTTCATTTCAACCATGG - Intergenic
1006346679 6:33488001-33488023 TCTTTCTTTCTCTACCTCCCGGG - Intergenic
1006471163 6:34229652-34229674 TGTTTTTTTCACTTGATCTCAGG - Intergenic
1006543292 6:34757890-34757912 TCTTCCTTTCACCTCTTTTCAGG + Exonic
1007155435 6:39738094-39738116 TCTTTCCTTCATTTCAACTTTGG - Intergenic
1007314679 6:40977667-40977689 TTTTTCTTTCATTTCAACCCTGG + Intergenic
1008082851 6:47211741-47211763 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1008163284 6:48104158-48104180 TTTTTCCTTCACTTCAACTTTGG - Intergenic
1008640559 6:53458252-53458274 TGGTTCTTTCATTTCCTCTCTGG + Intergenic
1008655051 6:53603551-53603573 TCTTTCTTTCACTTTGACCCAGG + Intronic
1008708222 6:54189973-54189995 TCTTTTTTTCACTTTTACTCAGG - Intronic
1008922945 6:56861910-56861932 TCTTTTTTTCAACTCACCTCAGG - Intronic
1009289302 6:61864696-61864718 TTTTTCTGTCATTTCATCTTTGG + Intronic
1009393413 6:63168673-63168695 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1009919011 6:70033227-70033249 TGTTTCTTTCACTTCATCACTGG + Intronic
1010075235 6:71790130-71790152 TCTTTCTCTCTCTTTCTCTCTGG - Intergenic
1010075237 6:71790190-71790212 TCTTTCTCTCTCTTTCTCTCTGG - Intergenic
1010279850 6:74011610-74011632 TTTTTCCTTCACTTCAACTTTGG + Intergenic
1010579063 6:77571654-77571676 TCTTTCTTTCTTTACATTTCAGG + Intergenic
1010634540 6:78241269-78241291 TTTTTTTTTTTCTTCATCTCTGG - Intergenic
1010782990 6:79966739-79966761 TCTTTCTTTTATTTTATCTTTGG - Intergenic
1010918683 6:81653179-81653201 TCTTTCTATAACTTCATTTATGG - Intronic
1011024498 6:82852637-82852659 TTTTTCCTTCATTTCATCTTTGG - Intergenic
1011181654 6:84627916-84627938 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1011200481 6:84830862-84830884 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1011392981 6:86874526-86874548 TCTTTCCTTCATTTCAACTTTGG - Intergenic
1011709756 6:90040665-90040687 TTGTTTTTTCTCTTCATCTCAGG + Intronic
1011716624 6:90112309-90112331 TCTTTCTTTCATTTCAACCTTGG - Intronic
1012692041 6:102326660-102326682 ATTTTCTCTCACTTCATTTCTGG + Intergenic
1012933117 6:105337675-105337697 TCCTGCTTTCATTTCATCTTTGG + Intronic
1013690067 6:112631620-112631642 TGTTTCCTTCATTTCATCTTTGG + Intergenic
1013736032 6:113228057-113228079 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1013949274 6:115759949-115759971 TCTTTCTTTCATGGCTTCTCAGG - Intergenic
1014316260 6:119869194-119869216 TGTTATTTTCACTTCCTCTCAGG - Intergenic
1014387483 6:120819420-120819442 TTTTTCCTTCATTTCACCTCTGG - Intergenic
1014767370 6:125422171-125422193 GCTTTTCTTCACTTCATCTGTGG - Intergenic
1014923618 6:127243325-127243347 TCATTGTTTCACTTCATTTATGG - Intergenic
1015432350 6:133146507-133146529 TTTTTCCTTCACTTCAACTTTGG + Intergenic
1015488467 6:133798913-133798935 TCTTTCTTTCATTTCAACCTTGG + Intergenic
1016816532 6:148308130-148308152 TCCCTCTTTCACTTCTTCTGTGG + Intronic
1017535807 6:155347371-155347393 TCTTTCTTTCATTTCAACCTTGG + Intergenic
1017544988 6:155440958-155440980 CATTTCTTTCACGCCATCTCCGG + Intronic
1017990358 6:159482605-159482627 TCCTTCTTTCACCTCATATAAGG - Intergenic
1018537297 6:164835101-164835123 TCTTTTGTTCACATCAGCTCTGG - Intergenic
1019038616 6:169084134-169084156 TCTTCCTTTCATTTCGTCACTGG + Intergenic
1020516443 7:9126575-9126597 TTTTTCTGTCACTTCATGACAGG + Intergenic
1020802036 7:12743755-12743777 TCTTCCTTTCACTTGAACACTGG - Intergenic
1020893613 7:13911459-13911481 TCATTCTTTCATTTCATGTGTGG - Intronic
1020925110 7:14314839-14314861 TTTTTCCTTCATTTCATCTTTGG - Intronic
1021069419 7:16217998-16218020 TTTTTCCTTCATTTCATCTTTGG - Intronic
1021082631 7:16382426-16382448 TTTTTCTTTCATTTCAACTTTGG + Intronic
1021201883 7:17736392-17736414 TCTTTCCTTCATTTCAACTTTGG - Intergenic
1021425804 7:20497664-20497686 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1021480413 7:21109306-21109328 TCTTTCTTTCTTTTCACATCTGG - Intergenic
1022572122 7:31465118-31465140 TCTTTCTCTCCCTCCTTCTCTGG + Intergenic
1022619255 7:31965665-31965687 TTTTTCTTTCATTTCATCTTTGG - Intronic
1022790060 7:33679271-33679293 TCTTTCTTGCACTTGATTTATGG + Intergenic
1023495772 7:40795191-40795213 GCTTTCTTTCAGTGCACCTCTGG - Intronic
1024225516 7:47323407-47323429 TCTTCATTTTCCTTCATCTCTGG - Intronic
1025245936 7:57317439-57317461 TCTCTCTTTCTTTTCTTCTCAGG + Intergenic
1026303081 7:69115853-69115875 CCTCTCTGTCACTTCATCTCGGG + Intergenic
1026396481 7:69959610-69959632 TCATACTGTCACTGCATCTCAGG + Intronic
1027055898 7:75049124-75049146 TCTTTTTTTCTCTTCTTTTCTGG + Intronic
1028137710 7:87239709-87239731 TTTTTCCTTCATTTCATCTTTGG - Intergenic
1028218726 7:88168115-88168137 TCTTTCTTTTTTTTCCTCTCAGG + Exonic
1028298787 7:89170474-89170496 TCTTTCTTTTAGTTTATATCTGG + Intronic
1028511602 7:91631498-91631520 TATGTCCTTTACTTCATCTCTGG + Intergenic
1028770905 7:94620222-94620244 TTCTTCTTTGACTTCATCTCAGG - Intronic
1029025434 7:97412407-97412429 TCTTCCTTTCTCTTCATCATTGG + Intergenic
1029633696 7:101769599-101769621 TCTTCCTTTCATTTCCTCTCTGG + Intergenic
1029865128 7:103619729-103619751 TCCCTCTTTCCCTTCTTCTCTGG - Intronic
1030229778 7:107195478-107195500 TCTTACTTTAAATTCATTTCTGG - Intronic
1030376401 7:108757434-108757456 TCTTTCTTTCATTTCAGCCTTGG - Intergenic
1030406577 7:109122267-109122289 TCTTTCTCTGTCTTCAACTCTGG + Intergenic
1030420678 7:109303026-109303048 TCTCTCTTTCTCTCTATCTCTGG - Intergenic
1030749065 7:113207233-113207255 TCTTTCCATAACTTCCTCTCTGG + Intergenic
1030813117 7:114001017-114001039 TCTTTCTTTCATTTCAACTTTGG - Intronic
1031336751 7:120543227-120543249 CTTTTTTTTCACTTCCTCTCTGG + Intronic
1031635640 7:124098526-124098548 TTTTTCCTTCACTTCAACTTTGG + Intergenic
1031657114 7:124370377-124370399 TCTTTCATTCACTCCACCTAAGG - Intergenic
1032416812 7:131741790-131741812 GCTTTCCTTCCCTTCATTTCAGG - Intergenic
1032503412 7:132417231-132417253 CCTTTCTGCCATTTCATCTCTGG - Intronic
1032785100 7:135194416-135194438 TTTTTCTTTTACTTCATTTGTGG - Intronic
1032814783 7:135461995-135462017 TCTTTCTTTTAATAAATCTCTGG - Intronic
1033393008 7:140946427-140946449 TCTTTTAATCACTTTATCTCTGG + Intergenic
1033576081 7:142686164-142686186 TCTGTCTTTCCCTTCCTCTCAGG - Intergenic
1033812458 7:145031753-145031775 TGTTTGTTTCACCTCACCTCTGG - Intergenic
1033953615 7:146816297-146816319 TCTACCTTTCCCTTCATCCCAGG - Intronic
1035167099 7:156997997-156998019 TCTTCCTTTCACTTGAACTTAGG + Intronic
1035211305 7:157330295-157330317 TCTTTCCTTCTCTGCTTCTCAGG + Intergenic
1035847423 8:2880252-2880274 TCTTTCTTTCTCTTCATTTCTGG - Intergenic
1036128920 8:6090207-6090229 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1037677704 8:21066076-21066098 TCTCTCTTTCAACTCACCTCTGG + Intergenic
1037855028 8:22365885-22365907 TACTTATTTCACTTTATCTCTGG + Intergenic
1038422705 8:27443597-27443619 TCTTTCTTTCTCTTCTTATAAGG + Intronic
1038580009 8:28739724-28739746 CCATTCTTGCACTTCACCTCAGG + Intronic
1038881332 8:31616766-31616788 TCTTTCTTTGACTTTTTTTCTGG + Intergenic
1038919993 8:32072342-32072364 TCTATCTTTCATTTCCTCTGGGG + Intronic
1038989061 8:32845913-32845935 TCTTTTTACCACTTCATCTAGGG + Intergenic
1039079972 8:33724333-33724355 TCCTTCCTTCCCCTCATCTCTGG + Intergenic
1039146192 8:34450174-34450196 TTTTTCCTTCACTTCAACTTTGG + Intergenic
1039362311 8:36890572-36890594 TCTTTCTTTCCTGTCTTCTCTGG - Intronic
1039672215 8:39614006-39614028 TCTCTCTTTCACTCCATTTCAGG - Intronic
1040376624 8:46831550-46831572 TTTTTCCTTCATTTCATCTTTGG - Intergenic
1040998158 8:53422486-53422508 TCTTTCTTTGAGATCAACTCAGG + Intergenic
1041301573 8:56416793-56416815 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1041343978 8:56876491-56876513 TCTGTCTCTCACGTCATCACAGG - Intergenic
1041765545 8:61414688-61414710 TTTCTCTTTCTCTTCATCTGTGG - Intronic
1041875195 8:62679660-62679682 TCTCTCTTTCCCTTCTGCTCTGG - Intronic
1041877823 8:62711170-62711192 TCTTTCTTTCATCTCAACTTTGG + Intronic
1042420851 8:68587121-68587143 TCTCTTTTTCTCATCATCTCTGG + Intronic
1042541918 8:69915952-69915974 TCTTATTTTCCCTTCATCTAAGG - Intergenic
1042629631 8:70802885-70802907 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1043060375 8:75492837-75492859 TTTTTCTTTCACTTTTTCTCAGG - Intronic
1043102531 8:76064163-76064185 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1043605642 8:81995614-81995636 TTTATCTTTCAGTTCATCTAGGG + Intergenic
1043680646 8:83021170-83021192 TATTGTTTTAACTTCATCTCTGG + Intergenic
1043928218 8:86061660-86061682 TCATTCTTTCTATGCATCTCTGG - Intronic
1044278987 8:90334867-90334889 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1044916905 8:97123573-97123595 TCTTCCTTTCATTTCATATGAGG - Intronic
1045788863 8:105957356-105957378 TTTTTCCTTCACTTCAACTTTGG - Intergenic
1046104015 8:109645096-109645118 TTTTTTTTGCACTTGATCTCAGG + Exonic
1046214280 8:111122886-111122908 GGTTTCTATCACTTCATTTCAGG - Intergenic
1046233275 8:111386415-111386437 TCTTACTTTTTCTTCTTCTCAGG + Intergenic
1046344652 8:112906657-112906679 TCTTTTTTTCACCTCACCTAAGG + Intronic
1046415730 8:113910742-113910764 TTTTTCCTTCATTTCAACTCTGG + Intergenic
1047156367 8:122323779-122323801 TTTCTCTTTCTCTTCGTCTCTGG - Intergenic
1047579799 8:126201102-126201124 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1047589997 8:126317496-126317518 TTTTTCCTTCATTTCATCTTTGG + Intergenic
1048524578 8:135190445-135190467 CCTTTTTTTCACTTCATTTGTGG + Intergenic
1048594421 8:135851768-135851790 TTTTTCCTTCATTTCATCTTTGG + Intergenic
1049941856 9:553662-553684 TTTTTCTCATACTTCATCTCTGG - Intronic
1050713834 9:8497766-8497788 TCTTTTTTTCTCTTCTTCTTTGG - Intronic
1051545395 9:18268624-18268646 TCTCTCTTTCTCTTTTTCTCTGG - Intergenic
1051761349 9:20468587-20468609 TTTTTCTTTTACTGCATCACAGG - Intronic
1052700878 9:31936655-31936677 TTTTTCCTTCATTTCATCTTTGG + Intergenic
1052889696 9:33686947-33686969 TTTGTCTTTCCCTTCCTCTCAGG - Intergenic
1053677551 9:40450702-40450724 TCTTGCATTAACTTTATCTCTGG - Intergenic
1054286170 9:63174209-63174231 TCTTGCATTAACTTTATCTCTGG + Intergenic
1054290624 9:63286228-63286250 TCTTGCATTAACTTTATCTCTGG - Intergenic
1054388645 9:64590775-64590797 TCTTGCATTAACTTTATCTCTGG - Intergenic
1054507071 9:65925596-65925618 TCTTGCATTAACTTTATCTCTGG + Intergenic
1055202816 9:73687487-73687509 TCTTTCTTTCTCTGAAACTCAGG - Intergenic
1055787302 9:79884516-79884538 CCTTTCTTTCCCTTCACCACAGG - Intergenic
1055956170 9:81775662-81775684 TTTCTCTTCAACTTCATCTCAGG + Intergenic
1056060732 9:82883332-82883354 TCTTTTTTTTTTTTCATCTCAGG + Intergenic
1056127723 9:83553406-83553428 TCTTTCTTTCATTTCAACCTTGG + Intergenic
1056706591 9:88957240-88957262 TCTTTCTTTTATTGCATTTCAGG - Intergenic
1057339947 9:94191507-94191529 TCTCTCTCTCACTCCTTCTCTGG - Intergenic
1057447918 9:95131414-95131436 TCCCTCTCTCCCTTCATCTCTGG + Intronic
1057682920 9:97206846-97206868 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1058056753 9:100456513-100456535 TTCTTTTTTAACTTCATCTCAGG + Intronic
1058315163 9:103555697-103555719 TCTTTTTTTCATTTCAACTTTGG - Intergenic
1058431120 9:104920431-104920453 TCTTTTTTTCTTTTCATGTCTGG + Intronic
1058555464 9:106162040-106162062 TCTTTCTTTTACTTCAATTTTGG + Intergenic
1059163631 9:112058676-112058698 TTTTTCTTCCAGTTCATATCAGG - Exonic
1059812034 9:117866023-117866045 TCTTTCTTTGTCTTCTTCTCTGG - Intergenic
1060512311 9:124242981-124243003 GCTTCCTTTCTCTTCCTCTCCGG + Intergenic
1203750108 Un_GL000218v1:70933-70955 TCTTTCTCTCTCTTTTTCTCAGG + Intergenic
1203758086 Un_GL000218v1:154822-154844 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1203483870 Un_GL000224v1:33428-33450 TCTTTCTCTCTCTTTTTCTCAGG - Intergenic
1203542269 Un_KI270743v1:100441-100463 TCTTTCTCTCACTTTTTCTCAGG - Intergenic
1185558592 X:1040808-1040830 TGTTTCTTGCACTTCAAATCTGG + Intergenic
1186913080 X:14190619-14190641 TATTTCCTTCAGTTCAGCTCTGG + Intergenic
1187191294 X:17037871-17037893 TCAGTCTTTCCCTTGATCTCAGG + Intronic
1187199701 X:17123170-17123192 TCTTTCTTCAACCTCATCCCTGG + Intronic
1188794876 X:34450511-34450533 TGTTTCTTTCTCTGCTTCTCTGG - Intergenic
1189299126 X:39939775-39939797 GCTTTTATTCACTTCATTTCTGG + Intergenic
1189708640 X:43785665-43785687 ACTTTCTTTCACTTGAACACTGG + Intronic
1189920388 X:45897392-45897414 TCTCTCTTTCCCTTCACCCCAGG - Intergenic
1190209714 X:48435145-48435167 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1190780157 X:53586146-53586168 TTTTTGTTTCAGTACATCTCAGG - Intronic
1190921579 X:54858371-54858393 TTTTTCCTTCACTTCAACTTTGG + Intergenic
1191134660 X:57050610-57050632 TTTTTCCTTCATTTCATCTTTGG - Intergenic
1191178031 X:57527620-57527642 TCTTTCTTTCACTTTGCCTTTGG + Intergenic
1191232852 X:58109799-58109821 TTTTTCCTTCATTTCATCTTTGG - Intergenic
1191800291 X:65072056-65072078 TCTTCCATTCTCCTCATCTCAGG + Intergenic
1191808577 X:65162201-65162223 TTTTTCCTTCATTTCATCTTTGG + Intergenic
1191814279 X:65226082-65226104 TTTTTCCTTCATTTCATCTTTGG - Intergenic
1191827404 X:65380164-65380186 TTTTTCCTTCACTTCAACTTTGG - Intronic
1192084312 X:68080622-68080644 TCTTTTTTTCCCTTTCTCTCTGG + Intronic
1192136329 X:68603952-68603974 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1192293900 X:69827134-69827156 TTTTTCTTTCATTTCAACTTTGG + Intronic
1192660362 X:73036113-73036135 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1192662967 X:73061364-73061386 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1192701602 X:73480749-73480771 TCTTTCCTTCATTTCAACCCTGG + Intergenic
1192720302 X:73689128-73689150 TCTTTTTTTCACTTGAACACTGG + Intergenic
1192871324 X:75187457-75187479 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1192907647 X:75568211-75568233 TCTTGCTTTCATTTCCCCTCTGG + Intergenic
1192985473 X:76394558-76394580 TATTTCCTTCACTTCTGCTCTGG + Intergenic
1193061339 X:77211331-77211353 TCTTTCTTTCATTTCAACCTTGG + Intergenic
1193136024 X:77971411-77971433 ACTTTCCTTTACTTCATCTAAGG + Intronic
1193391865 X:80938254-80938276 TTTTTCCTTCACTTCAACTTTGG - Intergenic
1193752588 X:85364683-85364705 TCTTTCTTTCATTTCAACCTTGG + Intronic
1194108051 X:89796416-89796438 TTTTTCTTTCAATTCATTTTTGG - Intergenic
1194270215 X:91804341-91804363 TTTTTTTCTCACTTCCTCTCCGG - Intronic
1194761601 X:97802349-97802371 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1194803713 X:98301907-98301929 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1194951907 X:100136509-100136531 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1195987297 X:110644453-110644475 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1196790131 X:119457243-119457265 TCTTTCTTTCTCTTCTTTCCAGG - Intergenic
1197039873 X:121923752-121923774 TATTTCTTTCACTTCAACCTTGG - Intergenic
1197092990 X:122560487-122560509 TCTTTCCTTCACTTCAGCCTTGG - Intergenic
1197543115 X:127790472-127790494 TTTTTCCTTCATTTCATCTTTGG - Intergenic
1197575008 X:128200629-128200651 TTTTTCCTTCATTTCATCTTTGG - Intergenic
1197678190 X:129353509-129353531 TTTTTCCTTCATTTCATCTTTGG - Intergenic
1197736971 X:129858082-129858104 TTTTTCCTTCATTTCATCTTTGG + Intergenic
1197860075 X:130960498-130960520 TTTTTCCTTCACTTCAACTTTGG - Intergenic
1197877608 X:131127649-131127671 TTTTTCTTTCATTTCAACTTTGG + Intergenic
1198696523 X:139345662-139345684 TATTTTTTTCACTTAATCACAGG - Intergenic
1199012987 X:142778852-142778874 ACTTTCTGTCATTTCAACTCTGG + Intergenic
1199326229 X:146501794-146501816 ACATTCTTTCAGTTCATCACTGG - Intergenic
1199479619 X:148283798-148283820 TGTTTGTTTCACTTCATATGAGG + Intergenic
1199528201 X:148816286-148816308 TCTTTCTTTCATTTCAAAACTGG - Intronic
1199585379 X:149410693-149410715 TCTTTCTTTCACTCCTCTTCTGG + Intergenic
1199820945 X:151445333-151445355 TATTTGTTTCATTTCATCTAAGG + Intergenic
1200460707 Y:3451147-3451169 TTTTTCTTTCAATTCATTTTTGG - Intergenic
1200587452 Y:5025784-5025806 TTTTTTTCTCACTTCCTCTCCGG - Intronic
1200722951 Y:6628351-6628373 TTTTTCTTTCATTTCAACTTTGG - Intergenic
1200796001 Y:7341904-7341926 ACTTGCTTTCACTTGATCTATGG - Intergenic
1200800530 Y:7383088-7383110 CCTTTCTCTGAATTCATCTCAGG + Intergenic
1201057264 Y:10007591-10007613 TCATTATTTCAGTTAATCTCTGG - Intergenic
1201066214 Y:10097370-10097392 AATTTCTTTCAATTCAGCTCTGG + Intergenic
1201163761 Y:11188572-11188594 TCTTTCTCTCTCTTTCTCTCAGG + Intergenic
1201246911 Y:12013750-12013772 TTTTTCTTTCATTTCAGCTTTGG + Intergenic
1201405982 Y:13650994-13651016 TTTTTCCTTCACTTCATCCTTGG + Intergenic
1201462437 Y:14241018-14241040 TTTTTCCTTCATTTCATCTTTGG - Intergenic
1202075872 Y:21037605-21037627 CCTTTATTTCACTCCATCTTTGG - Intergenic
1202253818 Y:22900430-22900452 TTTTTCCTTCATTTCAACTCTGG + Intergenic
1202406808 Y:24534179-24534201 TTTTTCCTTCATTTCAACTCTGG + Intergenic
1202463973 Y:25135902-25135924 TTTTTCCTTCATTTCAACTCTGG - Intergenic