ID: 1141284692 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:82660574-82660596 |
Sequence | TGAAAGAAAGATGACAACCT AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 445 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 28, 4: 415} |
Found 3 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1141284690_1141284692 | -5 | Left | 1141284690 | 16:82660556-82660578 | CCGAGGCCAGAGATGAAGTGAAA | 0: 1 1: 0 2: 1 3: 31 4: 300 |
||
Right | 1141284692 | 16:82660574-82660596 | TGAAAGAAAGATGACAACCTAGG | 0: 1 1: 0 2: 1 3: 28 4: 415 |
||||
1141284689_1141284692 | -4 | Left | 1141284689 | 16:82660555-82660577 | CCCGAGGCCAGAGATGAAGTGAA | 0: 1 1: 0 2: 1 3: 29 4: 297 |
||
Right | 1141284692 | 16:82660574-82660596 | TGAAAGAAAGATGACAACCTAGG | 0: 1 1: 0 2: 1 3: 28 4: 415 |
||||
1141284687_1141284692 | 15 | Left | 1141284687 | 16:82660536-82660558 | CCTGGCAAAACAGAAACAGCCCG | No data | ||
Right | 1141284692 | 16:82660574-82660596 | TGAAAGAAAGATGACAACCTAGG | 0: 1 1: 0 2: 1 3: 28 4: 415 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1141284692 | Original CRISPR | TGAAAGAAAGATGACAACCT AGG | Intronic | ||