ID: 1141284692

View in Genome Browser
Species Human (GRCh38)
Location 16:82660574-82660596
Sequence TGAAAGAAAGATGACAACCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 445
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 415}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141284690_1141284692 -5 Left 1141284690 16:82660556-82660578 CCGAGGCCAGAGATGAAGTGAAA 0: 1
1: 0
2: 1
3: 31
4: 300
Right 1141284692 16:82660574-82660596 TGAAAGAAAGATGACAACCTAGG 0: 1
1: 0
2: 1
3: 28
4: 415
1141284689_1141284692 -4 Left 1141284689 16:82660555-82660577 CCCGAGGCCAGAGATGAAGTGAA 0: 1
1: 0
2: 1
3: 29
4: 297
Right 1141284692 16:82660574-82660596 TGAAAGAAAGATGACAACCTAGG 0: 1
1: 0
2: 1
3: 28
4: 415
1141284687_1141284692 15 Left 1141284687 16:82660536-82660558 CCTGGCAAAACAGAAACAGCCCG No data
Right 1141284692 16:82660574-82660596 TGAAAGAAAGATGACAACCTAGG 0: 1
1: 0
2: 1
3: 28
4: 415

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141284692 Original CRISPR TGAAAGAAAGATGACAACCT AGG Intronic
901250862 1:7778562-7778584 TTAAAGAAAACTGAAAACCTTGG - Intronic
901558415 1:10049999-10050021 TGATAGAAATATGAGAACATTGG + Intronic
902646698 1:17804570-17804592 TGAAAGGAAGACGACCAGCTGGG - Intronic
902957227 1:19933967-19933989 TGAAAGGAAGCTGAGGACCTGGG + Intergenic
907632645 1:56098613-56098635 TTAAAGAAACATTACACCCTTGG + Intergenic
908288175 1:62632351-62632373 TTAATGTAAAATGACAACCTGGG + Intronic
908680739 1:66658449-66658471 TGAAAGAAACATTACAACTGAGG + Intronic
908954828 1:69611275-69611297 TAAAAGGCAAATGACAACCTAGG - Intronic
909201663 1:72696946-72696968 TGGCAGAAAGATGATTACCTTGG + Intergenic
909253317 1:73385762-73385784 TAAAAGGAAGAGGACAACCAAGG + Intergenic
910291590 1:85605160-85605182 TGAAGGCAAGATTTCAACCTAGG + Intergenic
910914767 1:92277273-92277295 TTAAAGGAAGATGACTAACTGGG - Intronic
911927949 1:103860632-103860654 TGAAAGAGTGTTTACAACCTGGG - Intergenic
912923898 1:113896123-113896145 TGAAGGAGAGAGGAAAACCTAGG + Intronic
913232418 1:116751533-116751555 TGAAAGAAACATAAAATCCTGGG + Intergenic
914419241 1:147513580-147513602 CAAAAGAATGATGACAAACTTGG - Intergenic
914810661 1:151025373-151025395 TGAAAGCAAAATGAGAAACTGGG - Intronic
915982435 1:160428931-160428953 AGAAAGAAAGATTACTTCCTGGG + Intergenic
916303353 1:163301091-163301113 TGAAAGAAAAATGCCAAAATAGG + Intronic
916396287 1:164391351-164391373 TGAAAGAAACATGGGAACTTAGG - Intergenic
916850001 1:168694063-168694085 GGAACTAAAGATGATAACCTAGG - Intergenic
917327529 1:173848196-173848218 AAAAAGAAAGAGGAAAACCTGGG - Intronic
917371245 1:174296631-174296653 TGAAAGAAAAATGAGAATTTCGG + Intronic
921168549 1:212525475-212525497 TGTAAGAAAGAGGAGAAGCTGGG - Intergenic
921833294 1:219751952-219751974 TGTAATGAAGCTGACAACCTTGG - Intronic
922944013 1:229494841-229494863 TGAGAGAAAGATCACAGCATGGG + Intronic
924689591 1:246333295-246333317 TGGAATCAAGATGAAAACCTAGG + Intronic
1063487459 10:6433337-6433359 GGTAGGAAAGAAGACAACCTTGG - Intronic
1064815122 10:19252140-19252162 TGAATGGCAGCTGACAACCTTGG + Intronic
1065540903 10:26766120-26766142 TCAAAGAAAGGTGATAACATAGG + Intronic
1066528623 10:36310900-36310922 AGAAACAGAGATGAGAACCTAGG + Intergenic
1066694691 10:38067287-38067309 TCAAAGAAAAAAGACAAGCTGGG - Intergenic
1067257432 10:44656784-44656806 TGTAAGAAAGATGTAAACCTAGG - Intergenic
1067735459 10:48846939-48846961 TCAAAGACAGATCACAACCAGGG - Intronic
1068407895 10:56616370-56616392 TGAAAAAAAAATGACAAAATAGG - Intergenic
1068803762 10:61171791-61171813 GGAAAGAAAGAGGAGAAGCTGGG + Intergenic
1068836407 10:61559214-61559236 TGTAAGAACGAAGACTACCTGGG + Intergenic
1069023539 10:63515885-63515907 TAAAAGACAGATGACAAACTAGG - Intergenic
1069291089 10:66780449-66780471 TGAAGGAAAGAGAACAATCTAGG + Intronic
1069611729 10:69777473-69777495 TTAAAGAAAGATAACAGGCTGGG + Intergenic
1069948877 10:72005997-72006019 TGAAAGGAAGATGAAGACTTGGG - Intronic
1071146162 10:82575289-82575311 TGAAAGAAAGTTGATAATCCTGG + Intronic
1071243512 10:83737514-83737536 TGAAAGAAAAATAAAAACTTGGG + Intergenic
1071245748 10:83760949-83760971 AGAAAGAATTATGACAGCCTGGG - Intergenic
1071795204 10:88997476-88997498 AGAAAGAAAGAGGACATCCCTGG + Intronic
1072211792 10:93253035-93253057 TGAAAACAAGATGCCAATCTTGG - Intergenic
1075690706 10:124392272-124392294 CAAAAGAAAGATGATAATCTTGG - Intergenic
1076081116 10:127581373-127581395 TGTAAGTAAGACGACAACATGGG - Intergenic
1079166915 11:18052867-18052889 TGAAAGAAAAATGAAAGGCTTGG - Intergenic
1079372308 11:19861999-19862021 TGAAACAAAGAAAGCAACCTGGG - Intronic
1079704069 11:23591145-23591167 TGAAAGAAACATGACAAAATTGG + Intergenic
1079840581 11:25394246-25394268 TTAAAGAAAGATGACAGTATTGG + Intergenic
1080019617 11:27546352-27546374 TAAAATAAAGATGAAAACATAGG + Intergenic
1080227988 11:29982616-29982638 TAAAAGAAAAATGAAAATCTTGG + Intergenic
1081465091 11:43309087-43309109 AGAAAGGAAGAGGAGAACCTCGG + Intergenic
1081512696 11:43791828-43791850 TGAAAAAAATATAATAACCTTGG + Intronic
1082915824 11:58435687-58435709 GGAGAGAGAGGTGACAACCTTGG - Intergenic
1082997106 11:59263263-59263285 GGAAACAAAGATCACACCCTGGG + Intergenic
1084750244 11:71199770-71199792 GGAAAGACCGAGGACAACCTTGG + Intronic
1086607420 11:88712471-88712493 TGAAAGTATGACGACAGCCTGGG + Intronic
1087309829 11:96528419-96528441 TGAAAGAAAGAAGGCACGCTGGG - Intergenic
1087574065 11:99968087-99968109 TGAAAGAAAGGTGAGAAGCCTGG - Intronic
1087759999 11:102095376-102095398 TGAGAGAAAGATGACAGTCAAGG + Intergenic
1087827349 11:102780874-102780896 TTAAAGAGAGCTGACAAGCTTGG + Intergenic
1087947282 11:104178140-104178162 AAAGAGAAAGATGACAAACTTGG + Intergenic
1088128770 11:106461669-106461691 TGAAAGAAAAAGCACAAACTTGG + Intergenic
1088422896 11:109668442-109668464 TGAAACAAAGATGACAACAGCGG - Intergenic
1089188256 11:116635717-116635739 GGAAAGAAAGAAGAAAAACTAGG - Intergenic
1089226913 11:116932246-116932268 TTAAAAAAAGATTACTACCTTGG - Intronic
1089780566 11:120870546-120870568 TGATAGAGCAATGACAACCTAGG + Intronic
1090673436 11:128967949-128967971 TGAAAGAAAGTTGATAATTTAGG + Exonic
1094306559 12:29026429-29026451 TAAAAGAAAGATGCCATCTTTGG - Intergenic
1094428909 12:30345042-30345064 TGAAACAAAGAAAAAAACCTAGG + Intergenic
1095216045 12:39549504-39549526 TGAATGAATAATGACAACCAGGG + Intergenic
1096578675 12:52570547-52570569 TGAAAGAAAGGTTCCAACCAAGG - Intronic
1097831138 12:64224963-64224985 TTAAAAAAAAATGACATCCTGGG + Intergenic
1098204303 12:68091621-68091643 TAAAATAAATATGACAATCTAGG - Intergenic
1100644802 12:96517761-96517783 TGAAAGGATGCTGGCAACCTGGG + Intronic
1103008503 12:117439839-117439861 TGAAAGAAAGGTCAGAGCCTGGG - Intronic
1103415140 12:120738328-120738350 GGGAAGAAAGAAGACAAGCTGGG + Exonic
1103820750 12:123696266-123696288 TGAGAGAAAGATGGCAACTTCGG - Intronic
1105696473 13:22894087-22894109 TGAAAGAAAAATAAAAACCTGGG + Intergenic
1105697437 13:22902742-22902764 TGAAAGAAAAATAACACCTTGGG + Intergenic
1105729295 13:23196106-23196128 TGAAAAACATATAACAACCTAGG - Intronic
1107129594 13:36880719-36880741 TGGAGAAAAGATGACAATCTAGG + Intronic
1107446889 13:40477713-40477735 TGAAAGTAATCTGACAGCCTGGG - Intergenic
1107552355 13:41488616-41488638 AAACAGAAAGAAGACAACCTAGG - Intergenic
1109188044 13:59292927-59292949 TGCAAGGAAGCTGAGAACCTTGG + Intergenic
1109540439 13:63770935-63770957 GGAAAGAAAGAAGCCAGCCTAGG - Intergenic
1110871759 13:80460690-80460712 TGAAAGCAAGATGGCAAGTTTGG + Intergenic
1110952530 13:81514491-81514513 TGAGAGCAAGATGAGAAACTGGG - Intergenic
1111984295 13:95050047-95050069 TCAATGAAAGATGAAAACCATGG + Intronic
1113541557 13:111113886-111113908 GGAAGGAAAGATGTCAACCCGGG - Intergenic
1113811219 13:113143827-113143849 TGAAAGAAAGAGGACGGCCGGGG - Intronic
1115145475 14:30221227-30221249 TGAAAGAAAGATGAACTGCTGGG - Intergenic
1115327000 14:32150836-32150858 TGAATGAAAGATGCCAAAGTAGG - Intronic
1115753895 14:36515234-36515256 AAAAAGAAAGTTGAAAACCTGGG + Intergenic
1116061222 14:39926653-39926675 TCAAAGCAAGATTCCAACCTAGG + Intergenic
1116949046 14:50862053-50862075 GGAAAGGCAGCTGACAACCTTGG + Intronic
1117738697 14:58793437-58793459 TGAAAGAAATATGAATAACTAGG + Intergenic
1117926209 14:60782432-60782454 TGAAAGAAGGATGACATTCCAGG - Intronic
1118214941 14:63799856-63799878 CGAAAGAAAGATGCCATCCCAGG - Intergenic
1118884338 14:69853884-69853906 TGAAAGTAGGCTGACGACCTGGG + Intergenic
1119031911 14:71199464-71199486 GGAAAGCAAACTGACAACCTGGG + Intergenic
1119604625 14:76004074-76004096 TTAAAGTAAAATGACAAACTGGG - Intronic
1119825198 14:77651914-77651936 TTAAAGTAAAATGACAAACTAGG + Intergenic
1120540154 14:85741208-85741230 TGAAACAGAGCTGACAAGCTTGG + Intergenic
1121295878 14:92822601-92822623 TAAAAGACAGATGACAAGCTGGG - Intronic
1123956732 15:25343693-25343715 TAAAAGACAAATGACAAACTGGG + Intronic
1124841030 15:33242408-33242430 TGAGAGGCAGATGACAACTTGGG - Intergenic
1126547203 15:49886599-49886621 TTAAAGAAAAATGAGTACCTTGG + Intronic
1126669523 15:51103383-51103405 TGAAATAAAGTTGATATCCTTGG - Intronic
1127450663 15:59113352-59113374 TGGAAGAAACTTGACCACCTGGG - Intronic
1127697241 15:61462321-61462343 AGAAAGAAACATGATAAACTTGG - Intergenic
1128474618 15:67986615-67986637 GAAAAGAAAGATGACATCTTTGG + Intergenic
1128627503 15:69224907-69224929 TTCAAGAAAGATGACAAAGTAGG - Intronic
1129498132 15:76006809-76006831 CAAAAGCAGGATGACAACCTAGG + Intronic
1129764443 15:78152787-78152809 TGCAAGAGAGATGACAAACATGG + Intronic
1130207189 15:81888096-81888118 TTAAAGAAAGAGAACAACCTTGG - Intergenic
1130404903 15:83590179-83590201 TTAAAGATAAATGACAAACTAGG - Intronic
1131340750 15:91598477-91598499 TGAAAGAGAGATTACAACTCAGG - Intergenic
1133194391 16:4158589-4158611 TGAAAAGAAGATGCCAGCCTGGG + Intergenic
1133530541 16:6651301-6651323 GGAGAGAAAGATGGCGACCTGGG - Intronic
1133578097 16:7114301-7114323 TGAAAAAAATATGAATACCTGGG + Intronic
1134338201 16:13320710-13320732 TGAAGGGAAGCTGACAAGCTGGG + Intergenic
1137476971 16:48817582-48817604 TGAAAGAACGCTGACATCTTGGG - Intergenic
1138732585 16:59211273-59211295 TGCCAGAAAGATGACAAACGGGG - Intergenic
1141114419 16:81296168-81296190 TGAAACCAAGAAGACAATCTTGG + Intergenic
1141284692 16:82660574-82660596 TGAAAGAAAGATGACAACCTAGG + Intronic
1142790330 17:2259177-2259199 TGAAAGAAAGCTGAAACCATTGG - Intronic
1143601088 17:7946541-7946563 TGGTACAAACATGACAACCTAGG + Intronic
1143865900 17:9923406-9923428 TAAAAGACAAATGACAATCTAGG + Intronic
1147291298 17:39445728-39445750 AGGAATAAAAATGACAACCTGGG + Intronic
1147305339 17:39560090-39560112 TGCATGAAAAAAGACAACCTAGG - Intronic
1148477521 17:47938911-47938933 TGAGATGAAGATGACAACCCGGG - Intergenic
1148576575 17:48716162-48716184 TGAACCAAAGATAATAACCTAGG + Intergenic
1149322067 17:55491857-55491879 TGAAAGAAAGAGAGCAAACTAGG + Intergenic
1149449508 17:56738738-56738760 TGAGAGGAAGATGCCACCCTGGG + Intergenic
1149623256 17:58061711-58061733 AGATGGAAAGAGGACAACCTAGG - Intergenic
1150188917 17:63216529-63216551 AGAAATACAGATGACAACCTGGG + Intronic
1150262001 17:63801349-63801371 TGAAAGAAAGATGTCAAGGCTGG - Intronic
1150629682 17:66870587-66870609 TGTAAGAAACCTGACACCCTGGG - Intronic
1152106780 17:78334817-78334839 GGACAGAAAGATGACAAACAAGG - Intergenic
1152216954 17:79038907-79038929 GGAAGGAAAGATTTCAACCTGGG + Intronic
1153498637 18:5724978-5725000 TAAAAGAAAGATGCCAACTATGG + Intergenic
1153568390 18:6443950-6443972 GGAAAGAAAGATGAAATGCTTGG + Intergenic
1155319845 18:24608569-24608591 TGGCAGAAAGATAACAAACTTGG + Intergenic
1155827922 18:30472160-30472182 TGAAAGAAAGATAACAAATTTGG - Intergenic
1156408441 18:36805340-36805362 GGAAACAAAGATACCAACCTTGG + Intronic
1156662689 18:39365448-39365470 TGGAAGGAAGATCCCAACCTAGG - Intergenic
1158279743 18:55811068-55811090 CAAAAGAAAAATGACAAACTGGG - Intergenic
1159144315 18:64433884-64433906 TCAAAGAATGATGAGAACCATGG + Intergenic
1160051229 18:75435606-75435628 TGAAAGTAATTTGGCAACCTTGG - Intergenic
1162881718 19:13664746-13664768 TAAAACAAAGATGACAGACTGGG + Intergenic
1165783425 19:38446899-38446921 TGAGAGAGAGATGAAAATCTCGG + Intronic
1167218900 19:48184418-48184440 GGAAAGAAAGATGAGAAAGTAGG + Intronic
1167975088 19:53219753-53219775 TGAAAGAAGGAAGACAATCTAGG - Intergenic
925512171 2:4639982-4640004 TGAATAAAAGATGACAATGTGGG + Intergenic
926450168 2:12993908-12993930 TGAAGGAATGGTGATAACCTTGG - Intergenic
926457294 2:13082571-13082593 TGAAAGGAAAATAAAAACCTGGG + Intergenic
928105379 2:28467493-28467515 GGAAAGAAACATGTGAACCTGGG + Intronic
928669796 2:33590508-33590530 TGAAAGAGAGGTTACAAACTGGG + Intronic
929312951 2:40446537-40446559 TGAAAGGAAGAAGAGAACATTGG - Intronic
930810043 2:55530701-55530723 TGAAACAGAGATGATAATCTGGG - Intronic
930926453 2:56823731-56823753 GCAAAGAGAGATGACAACATTGG - Intergenic
931994861 2:67830185-67830207 TTAAAGCAAGATGGCACCCTCGG + Intergenic
932357293 2:71077255-71077277 TGAAAGAAAGGGGACAGGCTGGG - Intronic
933052636 2:77618617-77618639 TGGAAGAAAGAAGACACTCTGGG - Intergenic
933205092 2:79498157-79498179 TGAAAGAGAAATGAGATCCTTGG + Intronic
933370817 2:81413221-81413243 TGAAAGAAAGATGATGTCTTAGG + Intergenic
933460180 2:82573474-82573496 TGAAAGAAAGGTGGCAATCTAGG - Intergenic
933461323 2:82590365-82590387 GGAATGAAAGCTGACAAGCTTGG - Intergenic
933570698 2:84007296-84007318 TAAAAGAAAGATCAGAAACTGGG + Intergenic
935268813 2:101416203-101416225 TGGAAGAAGGATGACCAACTAGG + Intronic
936740882 2:115506988-115507010 TGAACAAAGGATAACAACCTTGG + Intronic
936793262 2:116176552-116176574 TGAACAAAAGATGACAAATTTGG + Intergenic
937383899 2:121407969-121407991 AGACAGACAGATCACAACCTTGG + Intronic
937532689 2:122848151-122848173 TAAAAGACAAATGACAAGCTAGG - Intergenic
937940440 2:127281181-127281203 GAAAAGAAAGTTGACAATCTAGG + Intronic
938909320 2:135871490-135871512 TGAAAGATAAATGAAAACCCAGG - Intronic
939251622 2:139688224-139688246 TGAAAGAATGATGACCACCTGGG + Intergenic
939302020 2:140355373-140355395 AGACTGAAAGATGACAACCTAGG - Intronic
939981909 2:148792562-148792584 TGAAAGCAAGATAGCCACCTAGG - Intergenic
940249498 2:151659029-151659051 GGAGAGAAAGATGACAACAGGGG + Intronic
940281777 2:151996652-151996674 GGAAAGAAAGGTAAAAACCTTGG - Intronic
940422790 2:153499155-153499177 TGAAAGCAAGATAAGAACCCAGG - Intergenic
940822120 2:158367349-158367371 TGAGATAAAGATGGCAAACTTGG - Intronic
941505463 2:166338303-166338325 CCAAAGAAAGATGACACCCTCGG + Intronic
941532066 2:166682489-166682511 AGAAATACAGGTGACAACCTGGG + Intergenic
941569049 2:167146581-167146603 TGAAAGAAAGATTAAAAGGTAGG + Intronic
941757490 2:169203421-169203443 AGAAAGAAAGATGAAGGCCTTGG - Intronic
942304798 2:174596441-174596463 AGAAAGGAAGATGAGAAACTGGG - Intronic
942567131 2:177277816-177277838 TAAAAGACAAATGACAAACTGGG - Intronic
943810826 2:192187160-192187182 TGAAAGAGATAGGACAACTTAGG - Intronic
944563616 2:200965488-200965510 TGAAAAAAAGATGAAGATCTAGG + Intergenic
944601592 2:201308978-201309000 TGAAAGCAAAATGACAACAAGGG - Intronic
945350041 2:208766623-208766645 TAAAAGAAAAATAACAACCTTGG - Intronic
945635052 2:212338526-212338548 TAAGAGAAAGATGACAAAATAGG - Intronic
945838575 2:214861362-214861384 GGAATAAAAGATGACAAACTGGG - Intergenic
947823049 2:233085519-233085541 TGAAAGGAAAATGACAACACTGG - Intronic
947916979 2:233839080-233839102 GGGAAGACAGATGACAACCAAGG + Intronic
947954452 2:234176176-234176198 TGAAAGAAAAATGACAAAAGAGG - Intergenic
948080292 2:235200201-235200223 TGAGAGACAGATGCCAAGCTGGG + Intergenic
948318650 2:237051293-237051315 TGACAGGAAGAGGACAATCTAGG + Intergenic
948556404 2:238814266-238814288 AGAAAGAGAGATGAGAGCCTGGG - Intergenic
1169609004 20:7358095-7358117 TGAGAGAAAGATAACATCGTTGG + Intergenic
1169897873 20:10523399-10523421 TGAAAGAAGGAAGACAATTTAGG - Intronic
1170640184 20:18145120-18145142 TGAAGAAAAGAAGACAACATGGG + Intronic
1170701008 20:18703530-18703552 TTTAAGAAAAATGACAACCTGGG - Intronic
1172491587 20:35343250-35343272 TGAAAAAAAGCTGAAAACTTGGG + Intronic
1172625536 20:36344607-36344629 AGAAAGGAAGATGAGTACCTGGG - Intronic
1172716119 20:36965008-36965030 AGAAAGAAAGAAGACGGCCTGGG + Intergenic
1172718413 20:36981171-36981193 AGAAAGAAAGAAGACGGCCTGGG - Intergenic
1173045148 20:39502701-39502723 TGAAAGGCAGATGACACCTTAGG - Intergenic
1173358099 20:42314224-42314246 TAAAAGAAATATGACCACTTTGG + Intronic
1173385435 20:42582944-42582966 GGAAAGAGAGATGACAGACTTGG + Intronic
1174472985 20:50774361-50774383 TCAAAGTAACATGACAAGCTGGG - Intergenic
1175055707 20:56195674-56195696 TGAAAAATAGTTGGCAACCTGGG + Intergenic
1176269498 20:64228484-64228506 TGAAGGAAAGAGGACATCTTGGG + Intronic
1176689787 21:9891557-9891579 CAAAAGAAAAATGACAAACTAGG - Intergenic
1177159433 21:17531752-17531774 TGAAGGAAAGATGTAAACATTGG - Intronic
1177235265 21:18381794-18381816 AGATAGTAAGATGACAACTTTGG + Intronic
1178951364 21:36988956-36988978 TTAAAGACAGATGTCAAACTGGG - Intronic
1179137551 21:38693484-38693506 TGAGAGAAAGATAAGAACCAAGG - Intergenic
1180822748 22:18842789-18842811 TGAAAGGTTAATGACAACCTTGG + Intergenic
1181190215 22:21133237-21133259 TGAAAGGTTAATGACAACCTTGG - Intergenic
1181208987 22:21277287-21277309 TGAAAGGTTAATGACAACCTTGG + Intergenic
1181502915 22:23328911-23328933 TGAAAGGTTAATGACAACCTTGG - Intergenic
1181653719 22:24277286-24277308 TGAAAGGTTAATGACAACCTTGG - Intronic
1182625574 22:31643504-31643526 TGAAAGAAACATGTGAACCCAGG + Intronic
1182927504 22:34139442-34139464 TAAGAGGAAGATGACAACTTTGG - Intergenic
1183851951 22:40597080-40597102 AGAAAGGAAGAAGAAAACCTGGG - Intronic
1184944144 22:47789179-47789201 TTCAAGAAAGCTGCCAACCTGGG + Intergenic
1185142467 22:49110505-49110527 TGAAAAAAACCTGACAATCTGGG + Intergenic
1203217952 22_KI270731v1_random:18161-18183 TGAAAGGTTAATGACAACCTTGG - Intergenic
1203272885 22_KI270734v1_random:68696-68718 TGAAAGGTTAATGACAACCTTGG + Intergenic
949365669 3:3277921-3277943 TGAAAGGAAAATAAAAACCTTGG + Intergenic
949443890 3:4113231-4113253 TGAAATATATATTACAACCTGGG + Intronic
949759186 3:7450012-7450034 TAAAAGAATAATGACAAACTGGG + Intronic
950340136 3:12236246-12236268 GGAAAGAAAGATGCCTCCCTTGG + Intergenic
950662807 3:14477216-14477238 TGAAGGACAGATCACATCCTTGG + Exonic
951479311 3:23142500-23142522 TGAACCAAAGATAATAACCTTGG + Intergenic
952695248 3:36257832-36257854 TGAAAGAAAAATAAAAATCTTGG + Intergenic
953071987 3:39529992-39530014 TGAAGAAAAGATGAGACCCTTGG + Intergenic
953262078 3:41349376-41349398 TTAAGGAAACCTGACAACCTAGG + Intronic
953437103 3:42886558-42886580 TGAAAGGAAAATAACAACTTGGG + Intronic
953596180 3:44316543-44316565 TTAAAGAAAAATGAAAAGCTAGG - Intronic
956223834 3:66933858-66933880 GAAAAGAAAGATGACCAGCTGGG - Intergenic
956600853 3:71020741-71020763 TAAAAGACAGATGAGAACTTGGG - Intronic
956630063 3:71307924-71307946 TGAAATAAAGACGACAATCCAGG + Intronic
957230836 3:77511856-77511878 TGAAAGAAAGAAAAAATCCTGGG - Intronic
957411805 3:79851126-79851148 TGAAATAAAGACTCCAACCTTGG - Intergenic
957900654 3:86484444-86484466 TGAAGGAAAGATGAAAAACAAGG + Intergenic
957915362 3:86682028-86682050 TGAAAGTAAGAGGACACTCTGGG + Intergenic
958690476 3:97459554-97459576 TGGAAGAAAAATAAAAACCTAGG - Intronic
958799640 3:98740931-98740953 TGAAAGAAATATAATAACATAGG - Intronic
958855747 3:99383000-99383022 AGAAGGAAAGAAGAGAACCTCGG + Intergenic
959105612 3:102061527-102061549 TTAAAGATTGATGACAAACTGGG + Intergenic
959768381 3:110061733-110061755 TGAAAGATAAATAACAACCTTGG - Intergenic
960920654 3:122744337-122744359 TGAAAGCAATATCAGAACCTGGG + Intronic
960998667 3:123357557-123357579 TGAAAGAGAGATGAACACCAAGG - Intronic
961196327 3:125004696-125004718 TTAAAGAAAAATGCCATCCTGGG - Intronic
961775497 3:129281393-129281415 TGAAATAAAGATAACAGGCTGGG + Intronic
962236104 3:133708980-133709002 TGAAAGAGAGCTGACTCCCTAGG + Intergenic
963577998 3:147086686-147086708 AGAAAGAAAGAAAAAAACCTGGG + Intergenic
964039805 3:152247145-152247167 TGAAAGAAAGATTACAGTTTGGG + Intronic
964086686 3:152827411-152827433 AGAAAGAAAGAAAATAACCTTGG - Intergenic
964230989 3:154467765-154467787 TGAAACAGAAATGAAAACCTTGG + Intergenic
964444403 3:156743738-156743760 GGAAACAAAGATAACAAACTAGG - Intergenic
964950827 3:162290916-162290938 TGAAAAAAAAATGACAATCTTGG - Intergenic
965215438 3:165857893-165857915 TGAGAAAAATATGACAACTTAGG + Intergenic
965768325 3:172154617-172154639 TAAAAGAAAGATGAGCAGCTGGG - Intronic
966557379 3:181277858-181277880 GGCAGGAAATATGACAACCTGGG + Intergenic
967228208 3:187313101-187313123 AGACAGACAGATGACAGCCTGGG - Intergenic
967418077 3:189241538-189241560 TAAAAGAGATATGACAAACTGGG - Intronic
968680112 4:1912625-1912647 TTAAAAAAAAATGAAAACCTGGG + Intronic
970043711 4:11825777-11825799 TGAAATAATGGTGACAGCCTTGG - Intergenic
970918700 4:21367504-21367526 TGAAAGGAAGATCAAAACCAAGG + Intronic
971078179 4:23174788-23174810 TGAAGGAATGATGACAAGGTAGG - Intergenic
971655696 4:29341617-29341639 TGAGAAAAAGATGACAATCAAGG - Intergenic
971835168 4:31753278-31753300 TGAAACAAAAATGACAATTTGGG - Intergenic
972557969 4:40199473-40199495 TGAAAGAAGGAAAACAAACTTGG + Intronic
972719905 4:41685635-41685657 TTAAAGAAAGGTGACTTCCTAGG + Intronic
972730993 4:41795068-41795090 TGGAAGAAAGATGAAAACGCTGG + Intergenic
973153844 4:46923218-46923240 TGAAATAAAGATTGAAACCTGGG + Exonic
974124929 4:57684606-57684628 TGAAAGCAGGAAGCCAACCTTGG - Intergenic
974351461 4:60752740-60752762 AGAAAGAAAAATGATAACTTGGG + Intergenic
974824578 4:67111437-67111459 TGTAAAAAATATGACAAACTGGG + Intergenic
975397563 4:73894874-73894896 TGAAAAAAAGAAGAAAAGCTTGG - Intergenic
975425437 4:74220289-74220311 TGAAAGAAAGAGAATAACCAAGG + Intronic
976120481 4:81775249-81775271 TGATGGAAAAATGACAGCCTAGG - Intronic
976786670 4:88828929-88828951 TAAAAGGAAATTGACAACCTAGG - Intronic
976942763 4:90726444-90726466 GGAAAAAAAGATGGCATCCTAGG + Intronic
977290865 4:95162817-95162839 TAAACAAAACATGACAACCTTGG - Exonic
978470704 4:109064188-109064210 TGATAGTCAGATGTCAACCTTGG + Intronic
978760689 4:112354141-112354163 GGAAAGAAAAATCACAAACTGGG - Intronic
979537340 4:121838224-121838246 TGAAAGAAAAATGGAAAACTAGG - Intronic
979540551 4:121876327-121876349 GGAAAGAAAGATTACCACCTTGG + Intergenic
979943727 4:126797883-126797905 TGAATTAAAGATTACAACTTTGG + Intergenic
980353199 4:131709501-131709523 CAAAAGAAAAATGACAAACTAGG - Intergenic
980776019 4:137437526-137437548 TGATAGAAAGAGGACACACTTGG + Intergenic
981343551 4:143649471-143649493 GGAAAGAAAAATGTTAACCTGGG + Intronic
981856963 4:149306393-149306415 TAAAAGAAAGAAAACAACTTGGG - Intergenic
982893153 4:160881620-160881642 GGAAATAAAAATGACAACATGGG - Intergenic
983168263 4:164505712-164505734 TGAAAGAAATACTACAACTTGGG - Intergenic
983764832 4:171465537-171465559 TGAATTAAAGAAGACAACTTAGG - Intergenic
983871696 4:172831540-172831562 GGAAAGAAAGATGACTTCCAGGG + Intronic
984217292 4:176930284-176930306 TGAAAAAAATTTGAAAACCTTGG + Intergenic
984278654 4:177640293-177640315 AGAAAGGAAGATGGCAACATGGG - Intergenic
985011142 4:185583286-185583308 TGGAAGAAAGATGACAGGCTTGG + Intergenic
986757884 5:10854941-10854963 TAAAAGAACAATGACCACCTGGG - Intergenic
987376337 5:17238663-17238685 GGAAAAGAAGATGACAAACTAGG - Intronic
987577596 5:19751515-19751537 TGAAAGAAATGTGAAAACATGGG + Intronic
987665742 5:20936787-20936809 TGAAAGAAAGATAAGAACCAAGG - Intergenic
988133247 5:27134743-27134765 AGAAAGAATGATGGCAACATTGG + Intergenic
988451874 5:31351872-31351894 TGAAAGAAAGAGGACTCTCTGGG + Intergenic
988756947 5:34265380-34265402 TGAAAGAAAGATAAGAACCAAGG + Intergenic
989283412 5:39670756-39670778 TGAAGAAAAGAAGACAACCAAGG - Intergenic
989415169 5:41166281-41166303 TGAAATAAAGCTGACAAGGTAGG - Intronic
989739527 5:44753835-44753857 AGAAGCAAAGATAACAACCTGGG + Intergenic
990375666 5:55168014-55168036 TGAAAGAAAAATGACATGTTTGG + Intronic
990519877 5:56568819-56568841 TGAAAGACAGGTTACAAACTGGG + Intronic
990802810 5:59624392-59624414 TGAAAAAAAAATGACAAATTCGG - Intronic
991295871 5:65080068-65080090 TTAAAGAAACATGACCACCTAGG - Intergenic
992531701 5:77658871-77658893 TGAAAAAAAGAACACAAGCTTGG - Intergenic
993411498 5:87579347-87579369 TGAAAGAAAGACTAAATCCTTGG + Intergenic
993614435 5:90094269-90094291 TGAAAGAAATTTCACAACCTGGG + Intergenic
993930790 5:93936666-93936688 TAAAAGAAAGATGAATACTTTGG + Intronic
994514325 5:100751724-100751746 TGAAATAGAGAGGACAAACTTGG - Intergenic
995369489 5:111402870-111402892 GGGAAGAAAGATGACACCATTGG + Intronic
996127061 5:119738108-119738130 TGAAACAAATATGATATCCTTGG - Intergenic
996572782 5:124950301-124950323 TGAAAAGAAGACAACAACCTTGG - Intergenic
996584638 5:125071735-125071757 TGAAAGAATGATCACAAATTGGG + Intergenic
997764275 5:136484183-136484205 TGAAGAAAAGATGTCAAGCTAGG - Intergenic
997900902 5:137763222-137763244 TGAAAGTAAGGTAACCACCTTGG + Intergenic
998295388 5:140965212-140965234 TGGAAGAAATGTGAGAACCTGGG + Intronic
998672947 5:144374350-144374372 TGAAGTAGAGATGATAACCTCGG + Intronic
999437496 5:151574490-151574512 TGAAAGAATGGTGACATTCTAGG + Intergenic
999437700 5:151576703-151576725 TGAAAGAATGGTGACATTCTAGG + Intergenic
1000680771 5:164181495-164181517 TGGAAGAAAGATGAAAAGGTAGG - Intergenic
1001025415 5:168220215-168220237 AGAAAGGAAGATGAAAATCTCGG - Intronic
1001902304 5:175442685-175442707 TGAGAGAAAGATGACCCCCAAGG - Exonic
1002386850 5:178874783-178874805 TGGAGGAAAGAAGACACCCTGGG + Intronic
1003201872 6:3968932-3968954 TGAAAGGAAAATAAAAACCTGGG + Intergenic
1004701152 6:18080658-18080680 AGAAAGAAAGGAGACAACCTGGG + Intergenic
1004962409 6:20805035-20805057 AGAAAGAAAAATTAAAACCTGGG + Intronic
1005029735 6:21497658-21497680 AGAAAGAAAAATGACAGCCCTGG - Intergenic
1005043425 6:21620074-21620096 TGAACGAAGGATGAGAACTTGGG - Intergenic
1005419740 6:25636627-25636649 TAAAAGATAGATGACAAACTGGG + Intergenic
1005601218 6:27428226-27428248 GGAGAGAAAGATGAAAAACTGGG - Intergenic
1005921484 6:30405808-30405830 TGAAAGAAAGATAAAATCTTGGG + Intergenic
1005944251 6:30584130-30584152 GGAAAGAAAGATGAGACTCTTGG + Intronic
1007510724 6:42372562-42372584 TGAAAGAAAACTCACGACCTAGG + Intronic
1007881308 6:45170599-45170621 TGAAATAAAAATGACTACCAAGG + Intronic
1010038446 6:71353714-71353736 TCAAAGACAGCTGACAAACTGGG - Intergenic
1010593487 6:77737031-77737053 AGAAAATAAGATGACAAACTAGG + Intronic
1011123289 6:83978479-83978501 TGAAAGAAAAATAAGAACTTGGG - Intergenic
1011724971 6:90201598-90201620 TGAAAGATAAAAGACAAGCTGGG - Intronic
1013324208 6:109028132-109028154 GGAAAAAAAGTTTACAACCTGGG - Intronic
1013929860 6:115517322-115517344 TGCAAGAAAGCTAAGAACCTTGG + Intergenic
1013982369 6:116147137-116147159 TTAAAGATAAATGACAAACTGGG + Intronic
1015170138 6:130243089-130243111 TGAAAGAAAGATGAGGCTCTTGG - Intronic
1015821010 6:137260242-137260264 TGAAAGGAAAATAAAAACCTGGG + Intergenic
1015841537 6:137482210-137482232 TGATAGAAAGATGAGCAACTTGG + Intergenic
1016893331 6:149028466-149028488 TGAAAGAAAGAGGAAAAAATTGG + Intronic
1017055401 6:150431524-150431546 AGAAGGAAAGATGACAATCAGGG + Intergenic
1017316409 6:153036535-153036557 TGGATGAAATATGACAATCTGGG - Intronic
1017760938 6:157567494-157567516 TGAAAAACAGATCACAACTTTGG + Intronic
1021499175 7:21310927-21310949 TGAATGAAACATGACCAGCTGGG + Intergenic
1021715801 7:23461007-23461029 TGAAAGAAAGGTTACATCCCAGG + Intronic
1021844630 7:24752544-24752566 TGAAAGAAAGAAGGCTCCCTGGG + Intronic
1022181680 7:27926563-27926585 TGAATGAGAGATGACAAAATAGG - Intronic
1023190973 7:37582277-37582299 TGAAACAAAGATGAAAATGTAGG - Intergenic
1023334554 7:39154723-39154745 TGAAAAAAAGATGACAACTGGGG + Intronic
1023594873 7:41818201-41818223 CCAAAGAAAAATTACAACCTAGG - Intergenic
1023694220 7:42828248-42828270 TTAAAGAATGATGGCAACCTTGG - Intergenic
1024381400 7:48701128-48701150 TTAAAAACAGATGACAACATAGG + Intergenic
1028892813 7:96007770-96007792 AGTAAGAAAGATGACACCTTGGG + Intronic
1028993859 7:97078067-97078089 TGAAGCACAGGTGACAACCTGGG + Intergenic
1029592789 7:101518375-101518397 TGAAACAAAGCTGGCAGCCTTGG - Intronic
1029677723 7:102081985-102082007 TGAAAGAAAGAAGGGAACCCAGG - Intronic
1029695847 7:102212686-102212708 TGAAGGACACATGACAAACTGGG - Intronic
1029930636 7:104366811-104366833 TGAAACAGAAATGAGAACCTAGG + Intronic
1031113730 7:117644050-117644072 TGAAAAAAAAAAGACAAACTTGG - Intronic
1031963681 7:128011882-128011904 TGAAGCAAATATGACAACTTTGG + Intronic
1038246570 8:25862191-25862213 TTAAAGAAAGCTAACAACATGGG + Intronic
1038304953 8:26391631-26391653 GGTAAGAAAAATGACAATCTGGG - Intronic
1038738038 8:30190062-30190084 TGAAAAAAAGTTGAAAACTTGGG + Intergenic
1039260767 8:35768985-35769007 CAAAATGAAGATGACAACCTGGG - Intronic
1041680088 8:60579926-60579948 TGAAACAAAAATGTTAACCTAGG - Intronic
1043177057 8:77034997-77035019 GTTAGGAAAGATGACAACCTGGG + Intergenic
1043193454 8:77257194-77257216 GGAAATAAATATGACCACCTGGG - Intergenic
1044712199 8:95068751-95068773 GGAAGGAGAGATGACAGCCTTGG - Intronic
1044807184 8:96020503-96020525 AGAAAGAAAGATGACAGATTTGG - Intergenic
1044910529 8:97053788-97053810 TGGAAGAAAGATAATAGCCTAGG + Intronic
1044917056 8:97125991-97126013 TGAAAGAAAGATGTTTATCTGGG + Intronic
1045220822 8:100198354-100198376 TAAAAGACAAATGACAAACTAGG + Intronic
1046149092 8:110200323-110200345 TGAAAAACAGATTACAAACTGGG - Intergenic
1046255098 8:111686252-111686274 TGAAAGAATGAAGACAAGTTTGG - Intergenic
1046704049 8:117430825-117430847 TGAAAGAAAAAAGATAAACTTGG + Intergenic
1049638564 8:143703283-143703305 TGGAAGACAAATGACAATCTTGG - Intronic
1050958259 9:11692523-11692545 TGAAAGAAAGAGCAGTACCTTGG + Intergenic
1051133517 9:13891106-13891128 GGAAAGAAAGATGGCAACTCTGG - Intergenic
1051999501 9:23260038-23260060 TGATAAAAATATGAAAACCTAGG - Intergenic
1052830649 9:33212474-33212496 TGAAATAAAGATGAAGACATAGG - Intergenic
1053086941 9:35232995-35233017 AGAAAGAAACATGACACCATTGG - Intronic
1053117941 9:35521882-35521904 GGAAAGACAGATGACCTCCTGGG + Intronic
1053779473 9:41589916-41589938 CTAAAGAAAAATGACAAACTAGG + Intergenic
1054167429 9:61800157-61800179 CTAAAGAAAAATGACAAACTAGG + Intergenic
1054670113 9:67780743-67780765 CTAAAGAAAAATGACAAACTAGG - Intergenic
1054838182 9:69702558-69702580 TAAAAGAAAGTTAACAAACTAGG - Intergenic
1055466595 9:76572521-76572543 TGATAGTAAGTTGACTACCTTGG + Intergenic
1055809133 9:80131270-80131292 TAAAAGAAAGATGCCTACCCTGG + Intergenic
1056120429 9:83482687-83482709 TGAAAGAAGTAAGACATCCTAGG + Intronic
1056327851 9:85495353-85495375 TTAAACAAAGATGATAACCAGGG + Intergenic
1056972760 9:91221361-91221383 TGAAAGAAGAATGCCAAGCTTGG - Intronic
1058817680 9:108700352-108700374 TGAAAGGAAGCTGTCAAACTGGG - Intergenic
1059220395 9:112611114-112611136 TTAAAGAACAATGATAACCTTGG - Intronic
1059974487 9:119701065-119701087 TGGAAAAAAAATAACAACCTAGG + Intergenic
1203414120 Un_KI270589v1:33713-33735 TAAAAGAAAGATTCCAATCTGGG + Intergenic
1187221905 X:17335865-17335887 TAAAAGAAGCATGACAAACTAGG - Intergenic
1188237876 X:27751598-27751620 ATCAAGAAAGATGACAACCAGGG + Intergenic
1188400702 X:29740420-29740442 TGAAGGAAAGATAACAAGTTTGG - Intronic
1188728318 X:33612388-33612410 TGAAACAAAGATGAATATCTGGG + Intergenic
1188944546 X:36282461-36282483 TGAAAGATAGATTAAAAGCTAGG + Intronic
1189684316 X:43548175-43548197 TGAAAGAATGTTGGCAACTTTGG - Intergenic
1191059642 X:56281181-56281203 TAAAAGACAGATGAAAAACTTGG - Intronic
1194420934 X:93672328-93672350 TTAAAGAATGTTGACAAGCTCGG - Exonic
1194692835 X:97008987-97009009 TGAAGGGAAGAAGACAACCCTGG - Intronic
1195252850 X:103064621-103064643 TGAAAGAAACACTTCAACCTGGG + Intergenic
1196334607 X:114517045-114517067 TGAAAGAAAGATACGTACCTAGG - Intergenic
1196505330 X:116435250-116435272 TAAATGAAAGAAGCCAACCTTGG - Intergenic
1196681532 X:118474919-118474941 TGAATGAAAGTAGACAACCAGGG + Intergenic
1197669558 X:129261187-129261209 TGAATGAAAGATGATAAAGTGGG + Intergenic
1198187254 X:134265625-134265647 TGAGGGAAAGATGAAAATCTAGG + Intergenic
1198582765 X:138084757-138084779 CAAAGGAATGATGACAACCTTGG - Intergenic
1198762078 X:140042719-140042741 AGAAAGAAAGAAACCAACCTAGG + Intergenic
1199512006 X:148632881-148632903 TGACAGAAAGATGGAAACCCAGG + Intronic
1199916173 X:152343277-152343299 TGAAAGAAAGAAAACAAACAAGG - Intronic
1200410465 Y:2855847-2855869 TCAAAGAATGAAGACAAACTTGG + Intronic
1200643442 Y:5751379-5751401 TGCAAGGAAGATGAGAGCCTTGG - Intergenic
1202258563 Y:22945233-22945255 TGGAAGAGAGATGACAACAGTGG - Intergenic
1202411552 Y:24578991-24579013 TGGAAGAGAGATGACAACAGTGG - Intergenic
1202459230 Y:25091081-25091103 TGGAAGAGAGATGACAACAGTGG + Intergenic
1202581175 Y:26381999-26382021 TGAAAGACAAATGACAGACTAGG - Intergenic