ID: 1141284693

View in Genome Browser
Species Human (GRCh38)
Location 16:82660575-82660597
Sequence GAAAGAAAGATGACAACCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 365}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141284691_1141284693 -10 Left 1141284691 16:82660562-82660584 CCAGAGATGAAGTGAAAGAAAGA 0: 1
1: 0
2: 5
3: 49
4: 729
Right 1141284693 16:82660575-82660597 GAAAGAAAGATGACAACCTAGGG 0: 1
1: 0
2: 1
3: 34
4: 365
1141284690_1141284693 -4 Left 1141284690 16:82660556-82660578 CCGAGGCCAGAGATGAAGTGAAA 0: 1
1: 0
2: 1
3: 31
4: 300
Right 1141284693 16:82660575-82660597 GAAAGAAAGATGACAACCTAGGG 0: 1
1: 0
2: 1
3: 34
4: 365
1141284689_1141284693 -3 Left 1141284689 16:82660555-82660577 CCCGAGGCCAGAGATGAAGTGAA 0: 1
1: 0
2: 1
3: 29
4: 297
Right 1141284693 16:82660575-82660597 GAAAGAAAGATGACAACCTAGGG 0: 1
1: 0
2: 1
3: 34
4: 365
1141284687_1141284693 16 Left 1141284687 16:82660536-82660558 CCTGGCAAAACAGAAACAGCCCG No data
Right 1141284693 16:82660575-82660597 GAAAGAAAGATGACAACCTAGGG 0: 1
1: 0
2: 1
3: 34
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141284693 Original CRISPR GAAAGAAAGATGACAACCTA GGG Intronic