ID: 1141284693 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 16:82660575-82660597 |
Sequence | GAAAGAAAGATGACAACCTA GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 401 | |||
Summary | {0: 1, 1: 0, 2: 1, 3: 34, 4: 365} |
Found 4 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1141284689_1141284693 | -3 | Left | 1141284689 | 16:82660555-82660577 | CCCGAGGCCAGAGATGAAGTGAA | 0: 1 1: 0 2: 1 3: 29 4: 297 |
||
Right | 1141284693 | 16:82660575-82660597 | GAAAGAAAGATGACAACCTAGGG | 0: 1 1: 0 2: 1 3: 34 4: 365 |
||||
1141284691_1141284693 | -10 | Left | 1141284691 | 16:82660562-82660584 | CCAGAGATGAAGTGAAAGAAAGA | 0: 1 1: 0 2: 5 3: 49 4: 729 |
||
Right | 1141284693 | 16:82660575-82660597 | GAAAGAAAGATGACAACCTAGGG | 0: 1 1: 0 2: 1 3: 34 4: 365 |
||||
1141284687_1141284693 | 16 | Left | 1141284687 | 16:82660536-82660558 | CCTGGCAAAACAGAAACAGCCCG | No data | ||
Right | 1141284693 | 16:82660575-82660597 | GAAAGAAAGATGACAACCTAGGG | 0: 1 1: 0 2: 1 3: 34 4: 365 |
||||
1141284690_1141284693 | -4 | Left | 1141284690 | 16:82660556-82660578 | CCGAGGCCAGAGATGAAGTGAAA | 0: 1 1: 0 2: 1 3: 31 4: 300 |
||
Right | 1141284693 | 16:82660575-82660597 | GAAAGAAAGATGACAACCTAGGG | 0: 1 1: 0 2: 1 3: 34 4: 365 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1141284693 | Original CRISPR | GAAAGAAAGATGACAACCTA GGG | Intronic | ||