ID: 1141284693

View in Genome Browser
Species Human (GRCh38)
Location 16:82660575-82660597
Sequence GAAAGAAAGATGACAACCTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 401
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 365}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141284691_1141284693 -10 Left 1141284691 16:82660562-82660584 CCAGAGATGAAGTGAAAGAAAGA 0: 1
1: 0
2: 5
3: 49
4: 729
Right 1141284693 16:82660575-82660597 GAAAGAAAGATGACAACCTAGGG 0: 1
1: 0
2: 1
3: 34
4: 365
1141284689_1141284693 -3 Left 1141284689 16:82660555-82660577 CCCGAGGCCAGAGATGAAGTGAA 0: 1
1: 0
2: 1
3: 29
4: 297
Right 1141284693 16:82660575-82660597 GAAAGAAAGATGACAACCTAGGG 0: 1
1: 0
2: 1
3: 34
4: 365
1141284687_1141284693 16 Left 1141284687 16:82660536-82660558 CCTGGCAAAACAGAAACAGCCCG No data
Right 1141284693 16:82660575-82660597 GAAAGAAAGATGACAACCTAGGG 0: 1
1: 0
2: 1
3: 34
4: 365
1141284690_1141284693 -4 Left 1141284690 16:82660556-82660578 CCGAGGCCAGAGATGAAGTGAAA 0: 1
1: 0
2: 1
3: 31
4: 300
Right 1141284693 16:82660575-82660597 GAAAGAAAGATGACAACCTAGGG 0: 1
1: 0
2: 1
3: 34
4: 365

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141284693 Original CRISPR GAAAGAAAGATGACAACCTA GGG Intronic
900671977 1:3859845-3859867 GAAAGAAAGATAACATCCAAAGG - Intronic
900918307 1:5653543-5653565 GAAATAAAGAGGAAAACCAAGGG + Intergenic
901912649 1:12473045-12473067 GAAAGAAATAGCACACCCTACGG + Intronic
904316334 1:29668136-29668158 GAAAAAATGACGACAACATATGG + Intergenic
904407177 1:30300001-30300023 GAAAGACAGAAGACACCCTATGG + Intergenic
909855647 1:80527149-80527171 GAAAGAAATATCAAAAGCTAAGG - Intergenic
910859033 1:91725311-91725333 GAAAGAAAGATGTCTACTAAGGG - Intronic
911357465 1:96839931-96839953 GAAAGAAAAATTATAAGCTATGG + Intergenic
911575129 1:99567131-99567153 CAAATAAATATGTCAACCTATGG + Intergenic
911898611 1:103471684-103471706 GAAAGAAAGAGGAAAGCCCAGGG + Intergenic
911903831 1:103539846-103539868 GAAAGAAAGAAAACAAGCAAAGG - Intronic
911930752 1:103900280-103900302 GAAAGAAAGCTGACAATTTTAGG - Intergenic
912219091 1:107651470-107651492 GAGATAAAGAGCACAACCTATGG - Intronic
912524768 1:110273463-110273485 GAAGGAGAGATGATAACCCAGGG - Intronic
912744292 1:112232384-112232406 GAAAGAAATAAGACAAACTTCGG + Intergenic
913347566 1:117823924-117823946 AAAGGACAGAGGACAACCTAGGG - Intergenic
916303354 1:163301092-163301114 GAAAGAAAAATGCCAAAATAGGG + Intronic
916850000 1:168694062-168694084 GAACTAAAGATGATAACCTAGGG - Intergenic
917843294 1:179000210-179000232 GAAAGAATGTTGAAAACATATGG + Intergenic
918559833 1:185851575-185851597 GAAAGACAAATGACAACAAATGG + Intronic
918753262 1:188300867-188300889 GAAAGTAAAAAGGCAACCTACGG + Intergenic
919298381 1:195731267-195731289 GAAGGAGAGGAGACAACCTATGG - Intergenic
919717161 1:200790634-200790656 GAAAGAAAGGTGAGAACACAAGG - Intronic
922093431 1:222419955-222419977 GAAAGAAGGAAGCCTACCTATGG - Intergenic
1063437928 10:6049580-6049602 CAGAGAAAGATGACAGCCAATGG - Intronic
1063657078 10:8001320-8001342 GATATAAACATGACAATCTAAGG - Intronic
1063884824 10:10566704-10566726 GAACAAAAGATGGCAACCTGAGG - Intergenic
1064367675 10:14722756-14722778 GAAATTAAAAAGACAACCTATGG - Intronic
1065540904 10:26766121-26766143 CAAAGAAAGGTGATAACATAGGG + Intronic
1068703708 10:60049004-60049026 GAAAGATAGATAGCAACATATGG + Intronic
1070229262 10:74547279-74547301 CAAAGAAACATGACAAGTTAAGG - Intronic
1071795205 10:88997477-88997499 GAAAGAAAGAGGACATCCCTGGG + Intronic
1072336269 10:94401665-94401687 GAAAAAAAGATTATCACCTAAGG - Intergenic
1073799285 10:107023901-107023923 GAAATAAAAAAGAAAACCTAAGG + Intronic
1074187357 10:111108376-111108398 GAAAGGAAGATGACAAGGCAAGG - Intergenic
1075154175 10:119960432-119960454 GAAAGACTGATGTCAACCAAGGG + Intergenic
1075216982 10:120544761-120544783 GAAAGAAACCAGAAAACCTAGGG + Intronic
1075656462 10:124164999-124165021 ACAAGAAAGAAGACAACCTTTGG - Intergenic
1075720803 10:124586249-124586271 GACAGAAAGGTGACAATGTAGGG - Intronic
1076506458 10:130976716-130976738 GAAAGCAGAATGACAACCCATGG - Intergenic
1077609729 11:3636901-3636923 CAGAGAAAGATGACAAGCCACGG - Intergenic
1077849921 11:6066371-6066393 GAAAGAAGGGTGGCAAACTATGG - Intergenic
1077935128 11:6775840-6775862 GAAAGTGATAAGACAACCTATGG - Intergenic
1077941089 11:6844307-6844329 GAAAGAAGGTTAACAACATATGG - Intergenic
1078458563 11:11495183-11495205 GAAACAAAGTTGGAAACCTACGG - Intronic
1079022675 11:16922799-16922821 GGAAGAGAGAAGACAAGCTAAGG + Intronic
1080129132 11:28772766-28772788 AAAAGAATGATGAAAGCCTAGGG - Intergenic
1080377584 11:31731521-31731543 AAAAGAATGAAGAAAACCTAGGG + Intronic
1082896570 11:58197408-58197430 CAGAGTAAAATGACAACCTAAGG - Intergenic
1083091616 11:60205661-60205683 GATAGCAAGATGAAAACCCAGGG + Intronic
1083101299 11:60309085-60309107 GATAGCAAGATGAAAACCCAGGG - Intergenic
1083601429 11:63950877-63950899 GAAAGTAAGATCACAACCACAGG - Intronic
1086226580 11:84518761-84518783 GGCAGAAAGATAACAAGCTAAGG + Intronic
1089188255 11:116635716-116635738 GAAAGAAAGAAGAAAAACTAGGG - Intergenic
1089871127 11:121673396-121673418 AAGAGAATGATGCCAACCTAAGG + Intergenic
1091509245 12:1105164-1105186 GAAAGAAAACTGACAAGCTATGG - Intronic
1092738183 12:11603753-11603775 GGAGGAAAGATGACCACCAATGG - Intergenic
1094142722 12:27197736-27197758 GAAAGACAAATGACAAACTCAGG - Intergenic
1094261437 12:28504695-28504717 GAAAGAAAGAAGCAAACATAAGG - Intronic
1095153993 12:38830741-38830763 GAAAGAAAAAAGCCAACCTATGG + Intronic
1095487855 12:42703204-42703226 GAAAGAAGGATGATAAAGTAAGG + Intergenic
1095944233 12:47745068-47745090 CAAAGCAAGATGACAAGCTACGG - Intronic
1096545932 12:52340299-52340321 GAAGGAAAGATGACCAGGTAAGG - Intergenic
1096879013 12:54652487-54652509 GAAAGAAAGCTATCAAGCTAGGG - Intergenic
1097471056 12:59991896-59991918 GTATGAAAAATGACAACCAAAGG + Intergenic
1098204302 12:68091620-68091642 AAAATAAATATGACAATCTAGGG - Intergenic
1098325233 12:69295096-69295118 GAAAGAAAAAGAAAAACCTATGG + Intergenic
1099276995 12:80589391-80589413 GATAGGAAGATGATAACATAAGG - Intronic
1099278245 12:80606325-80606347 CAAAGTAAGATGACAACCTAAGG + Intronic
1099919357 12:88938715-88938737 GAAAGGTAGATTAAAACCTAAGG - Intergenic
1100827849 12:98491659-98491681 GAAAGAAAGAAGAAAACATCTGG - Intronic
1101110443 12:101481180-101481202 AAAAAAAAGATGACAGCCAAGGG - Intronic
1101521013 12:105482430-105482452 CACAGAAATATGAAAACCTACGG - Intergenic
1101684789 12:107008269-107008291 AAAAGAAAAATGAAAATCTAGGG + Intronic
1102792693 12:115660533-115660555 GAAAGAAAGATGTCCTCCAACGG + Intergenic
1103820749 12:123696265-123696287 GAGAGAAAGATGGCAACTTCGGG - Intronic
1104997554 12:132668094-132668116 GAAAGAAATAGGACAGCCCAGGG + Intronic
1105729294 13:23196105-23196127 GAAAAACATATAACAACCTAGGG - Intronic
1106162056 13:27210408-27210430 GAAAGTGAAAAGACAACCTACGG + Intergenic
1106954093 13:34916408-34916430 GAAAGAAAGATGACTCCATCTGG + Intergenic
1107018206 13:35725706-35725728 GAAAGAAAGAAAGAAACCTAAGG + Intergenic
1107509128 13:41064055-41064077 AAAAAAAAAATGATAACCTATGG - Intronic
1107552354 13:41488615-41488637 AACAGAAAGAAGACAACCTAGGG - Intergenic
1109280848 13:60353405-60353427 GAAAGCAAGATTACAACCCAAGG - Intergenic
1109666886 13:65551861-65551883 GAAAGAAAGATGTTAAACTCAGG - Intergenic
1110536379 13:76655208-76655230 GAAAGAAAAATCACAAGCTTAGG + Intergenic
1110625767 13:77653939-77653961 GGAAGAACTATGACCACCTAAGG - Intergenic
1111602432 13:90492289-90492311 AAAAGAATGAAGACAGCCTATGG - Intergenic
1111764487 13:92510849-92510871 GAAAGAATGCTGACAAGCCATGG - Intronic
1111986550 13:95071856-95071878 GAAAGAAATATGACATCCCGAGG + Intronic
1112312166 13:98328378-98328400 GAAAGAAAAATAAAATCCTAAGG - Intronic
1112471902 13:99696850-99696872 AAAAGAAAGATGAGAAGATAAGG + Intronic
1112940671 13:104857331-104857353 GAAAAAAAGAAGAAAACCTCAGG + Intergenic
1113541556 13:111113885-111113907 GAAGGAAAGATGTCAACCCGGGG - Intergenic
1114352346 14:21866813-21866835 GAAAGAAGGATGTGAACATAAGG + Intergenic
1116689257 14:48083546-48083568 GGAAGAAAGATACCAACCTATGG - Intergenic
1118214940 14:63799855-63799877 GAAAGAAAGATGCCATCCCAGGG - Intergenic
1118665816 14:68068074-68068096 GAAACAAAGGTGACAAGGTATGG + Intronic
1122054813 14:99088021-99088043 AAAAGAAAAATAACAAACTAAGG + Intergenic
1122433091 14:101669431-101669453 AAAAGAATGATGAAAACTTATGG + Intergenic
1122479636 14:102038568-102038590 GACAGGAAGATGACAAACGATGG - Exonic
1202845015 14_GL000009v2_random:162024-162046 TAAAGAAAGATAACAACAGATGG - Intergenic
1202914415 14_GL000194v1_random:152293-152315 TAAAGAAAGATAACAACAGATGG - Intergenic
1202875772 14_GL000225v1_random:209198-209220 TAAAGAAAGATAACAACAGATGG + Intergenic
1202878256 14_KI270722v1_random:30419-30441 TAAAGAAAGATAACAACAGATGG + Intergenic
1123756669 15:23402339-23402361 GAAAGAAAGATGAAAAGAAAAGG + Intergenic
1124243247 15:28049031-28049053 GAAAGTGAAACGACAACCTATGG + Intronic
1124789485 15:32714132-32714154 GAAAGAAATATGACAAAATGTGG - Intergenic
1124986021 15:34615048-34615070 GTAAGAAAAATGACATCGTAAGG - Intergenic
1126219732 15:46198303-46198325 GAAAGTAAAAATACAACCTATGG - Intergenic
1126442398 15:48703609-48703631 GAAATAAAGATAATAACTTAGGG - Intergenic
1127697240 15:61462320-61462342 GAAAGAAACATGATAAACTTGGG - Intergenic
1127887829 15:63218935-63218957 GAGAGAAAAATGACAACTTCAGG - Intronic
1128474619 15:67986616-67986638 AAAAGAAAGATGACATCTTTGGG + Intergenic
1128909568 15:71500418-71500440 CAAAGGAAAAAGACAACCTATGG - Intronic
1129310360 15:74703797-74703819 GAAAGTGAAAAGACAACCTACGG + Intergenic
1129552313 15:76466235-76466257 GAAAGAGTGATGAAAGCCTAAGG - Intronic
1130569383 15:85027051-85027073 GTTATAAAGATGAGAACCTAAGG + Intronic
1130633233 15:85590808-85590830 GAAAAAAAGATGACAACGAAAGG - Intronic
1131202752 15:90414127-90414149 GAAAGGAAGAGGAAAAACTAGGG - Intronic
1131340749 15:91598476-91598498 GAAAGAGAGATTACAACTCAGGG - Intergenic
1131388852 15:92030895-92030917 TAAAAACAGATGCCAACCTATGG + Intronic
1131503550 15:92994985-92995007 GAAACAAAAATTTCAACCTAAGG - Intronic
1132235109 15:100214013-100214035 GCAAGAAAGATGACTAGTTACGG + Intronic
1133530540 16:6651300-6651322 GAGAGAAAGATGGCGACCTGGGG - Intronic
1137730963 16:50689816-50689838 GAAAGTAAAAAGACAACCAACGG - Intergenic
1138358060 16:56401500-56401522 GAAACTAAGATGGCAAACTATGG + Intronic
1139401129 16:66682317-66682339 GAAAGAAAGTAGACAAGCTGAGG + Intronic
1141284693 16:82660575-82660597 GAAAGAAAGATGACAACCTAGGG + Intronic
1141784880 16:86192827-86192849 GAAAGTAGGAAGAAAACCTATGG + Intergenic
1143238637 17:5424818-5424840 TAAAAAAAGATGATAACTTAAGG - Intronic
1143663563 17:8342675-8342697 GAAAGAAACAGGAGAAACTAGGG - Intronic
1144938743 17:18921520-18921542 GAAAGACATATGACAACCAGAGG - Intronic
1146679230 17:34795110-34795132 GGAAGAAGGATTACAATCTAAGG - Intergenic
1146822742 17:35997874-35997896 GAGAGAAAGATTACAAACTGAGG + Intronic
1148536406 17:48442648-48442670 GGAAGAAAGATGACCCCCCAGGG - Intergenic
1148614815 17:48994010-48994032 AAAAGAAAGATGAAAAGTTATGG + Intergenic
1149900359 17:60471194-60471216 GAAAATAAAAAGACAACCTATGG - Intronic
1150822909 17:68450199-68450221 AAAAGAAAAATGAGAACCCAAGG + Intronic
1150992000 17:70270484-70270506 GAAAGAAACATGAAAACATATGG - Intergenic
1151097289 17:71512911-71512933 GAAAGAAAGATGTTAAAGTAAGG - Intergenic
1153311670 18:3682837-3682859 GAAAGAAAGAAAACAAGCTTTGG - Intronic
1153385328 18:4487705-4487727 GAAAGTAAAATGACAACCCATGG + Intergenic
1153410295 18:4784812-4784834 AAAAGAGTGAAGACAACCTATGG + Intergenic
1153867014 18:9280015-9280037 AAAAGAAACATGAAAATCTAGGG - Intronic
1154061958 18:11070691-11070713 GAAGGAAGGAAGTCAACCTATGG + Intronic
1155087637 18:22473333-22473355 GAAGGAAAGAAGGAAACCTATGG - Intergenic
1156571678 18:38262442-38262464 AAAATAAAGGAGACAACCTATGG - Intergenic
1157897103 18:51479535-51479557 GAAAGAAAGAAAATAACCCAAGG + Intergenic
1158279742 18:55811067-55811089 AAAAGAAAAATGACAAACTGGGG - Intergenic
1158353883 18:56594604-56594626 GAAAGTGAAAAGACAACCTACGG - Intergenic
1158444601 18:57508515-57508537 GCAGGAAAGATGCCAACTTACGG - Intergenic
1158501975 18:58010559-58010581 GAAAGAAAGAAGAGAACTTATGG - Intergenic
1158984676 18:62801769-62801791 GAAAGAAATATGAGAAACCATGG - Intronic
1159076500 18:63687401-63687423 AAGTGAAAGAAGACAACCTATGG - Intronic
1159427644 18:68310431-68310453 CAAAGCAATATTACAACCTAGGG - Intergenic
1161932555 19:7350367-7350389 GAAAAGAACATGACAACCAAAGG + Intronic
1162669940 19:12248318-12248340 GAAAGAACGTTGACAACTGAAGG + Intronic
1164483662 19:28636412-28636434 GAAAGCAAGATGGCAAACAAGGG + Intergenic
1165904439 19:39185144-39185166 GGAACAAAGATGTCAACCTGAGG + Intergenic
1167218901 19:48184419-48184441 GAAAGAAAGATGAGAAAGTAGGG + Intronic
925387549 2:3472660-3472682 AAAAGTAAAAAGACAACCTATGG + Intronic
925855162 2:8122523-8122545 GGAGGATAGATGACAATCTATGG - Intergenic
925857377 2:8142900-8142922 GATAGGATGATGACAACCTATGG - Intergenic
926263436 2:11290638-11290660 GAAAGAAAAATGCCAAGCAATGG + Intronic
927909510 2:26886903-26886925 GAAAGGAAAATGGAAACCTATGG - Intronic
928105380 2:28467494-28467516 GAAAGAAACATGTGAACCTGGGG + Intronic
929744911 2:44646883-44646905 GAAAGAAGGATGAGAGCCAATGG + Intronic
931124342 2:59257283-59257305 GAAAGAAAGATGACTACAACTGG + Intergenic
933775344 2:85768189-85768211 GAAAATGAGATGACCACCTAAGG + Intronic
937940441 2:127281182-127281204 AAAAGAAAGTTGACAATCTAGGG + Intronic
938375836 2:130805933-130805955 AAAAGAATGATGATAACCAAGGG + Intergenic
938488272 2:131738870-131738892 GAAAGAAAGAAAAAATCCTAAGG + Intronic
938909319 2:135871489-135871511 GAAAGATAAATGAAAACCCAGGG - Intronic
939981908 2:148792561-148792583 GAAAGCAAGATAGCCACCTAGGG - Intergenic
940249499 2:151659030-151659052 GAGAGAAAGATGACAACAGGGGG + Intronic
940281776 2:151996651-151996673 GAAAGAAAGGTAAAAACCTTGGG - Intronic
940622598 2:156130958-156130980 GAAAAAAGTATGGCAACCTAGGG + Intergenic
941387049 2:164866500-164866522 GAAAGAAACATGACCTGCTAAGG + Intergenic
942314947 2:174689662-174689684 GCAAGAATGATGACAAGCCATGG + Intergenic
943099270 2:183468816-183468838 GGCAGAAAGATGGCAAGCTAAGG - Intergenic
943606031 2:189977767-189977789 AAAAGAGAGTTGACAAGCTAAGG + Intronic
943825778 2:192389382-192389404 GAAAGAAAGAACACAACTGATGG + Intergenic
945144752 2:206726494-206726516 TAAAGAAATATGACAACTAAAGG - Intergenic
946048048 2:216837543-216837565 GAAAGAAAGAAGACTCCTTATGG - Intergenic
947954451 2:234176175-234176197 GAAAGAAAAATGACAAAAGAGGG - Intergenic
948315141 2:237022785-237022807 GAGAGAAAGATGAGAACCCAAGG - Intergenic
948318651 2:237051294-237051316 GACAGGAAGAGGACAATCTAGGG + Intergenic
948523247 2:238554808-238554830 GAAAGAAAGAGGAGAAATTAGGG - Intergenic
949080250 2:242090777-242090799 TATAGAATGATGACAACCCACGG - Intergenic
1169622146 20:7519405-7519427 GAAAGTGAAAAGACAACCTAAGG - Intergenic
1169650845 20:7865514-7865536 GAATGGAAGATGACAAGCAAAGG - Intergenic
1171984795 20:31652301-31652323 GAAAGAAGGCTGACCAGCTAGGG - Intergenic
1172074123 20:32280741-32280763 GAAAGAAAGATGAAAGCTGATGG + Intronic
1172625535 20:36344606-36344628 GAAAGGAAGATGAGTACCTGGGG - Intronic
1173045147 20:39502700-39502722 GAAAGGCAGATGACACCTTAGGG - Intergenic
1173483146 20:43419169-43419191 GAAAGAAAGATGAAAAGAAAGGG + Intergenic
1174999338 20:55609486-55609508 GAAAGACAGCTTACAACTTATGG - Intergenic
1176346206 21:5750310-5750332 GAAAGAATCATGACATGCTATGG - Intergenic
1176353020 21:5870894-5870916 GAAAGAATCATGACATGCTATGG - Intergenic
1176498621 21:7574145-7574167 GAAAGAATCATGACATGCTATGG + Intergenic
1176540527 21:8148380-8148402 GAAAGAATCATGACATGCTATGG - Intergenic
1176559478 21:8331425-8331447 GAAAGAATCATGACATGCTATGG - Intergenic
1176633770 21:9166938-9166960 TAAAGAAAGATAACAACAGATGG - Intergenic
1176639561 21:9287880-9287902 TAAAGAAAGATAACAACAGACGG + Intergenic
1177103500 21:16924799-16924821 GAAAGCAAGATAACAACATCAGG + Intergenic
1177235266 21:18381795-18381817 GATAGTAAGATGACAACTTTGGG + Intronic
1178151340 21:29797756-29797778 TAAAGAAAAATGACAAGCTCAGG - Intronic
1179839195 21:44059615-44059637 AAAAGAAAGATGAACACCCAAGG - Intronic
1180348575 22:11777255-11777277 TAAAGAAAGATAACAACAGATGG + Intergenic
1180372862 22:12060709-12060731 TAAAGAAAGATAACAACAGATGG + Intergenic
1180416314 22:12719530-12719552 TAAAGAAAGATAACAACAGATGG + Intergenic
1180423606 22:12895348-12895370 TAAAGAAAGATAACAACAGACGG + Intergenic
1181955654 22:26586214-26586236 GAAAGAAAGAAAGCAGCCTAGGG - Intronic
1182770989 22:32796364-32796386 GAAAGAAATATGAAAACCTGAGG + Intronic
1183851950 22:40597079-40597101 GAAAGGAAGAAGAAAACCTGGGG - Intronic
1184155392 22:42663451-42663473 GAAATAAAAATGATAACCTGAGG - Intergenic
1184336701 22:43858087-43858109 GAAAGAAAGAAAAGAAACTATGG + Intronic
1184843808 22:47068370-47068392 GAAAGAAACATGACTTCCTTTGG - Intronic
1203245469 22_KI270733v1_random:64798-64820 GAAAGAATCATGACATGCTATGG - Intergenic
950340137 3:12236247-12236269 GAAAGAAAGATGCCTCCCTTGGG + Intergenic
950347002 3:12305120-12305142 GAAGGAAAGAAGAAAACATAGGG - Intronic
950531515 3:13554798-13554820 GAAAGGAAGCTGACACCCTCTGG - Intronic
950839503 3:15953574-15953596 GAAAGACAAATGAGAAACTAAGG - Intergenic
951356221 3:21670626-21670648 GAAATAAAAATGAAATCCTAAGG + Intronic
951523953 3:23635441-23635463 GAAAGTGAAATGCCAACCTACGG - Intergenic
953347569 3:42188985-42189007 GAAAGTACGCTCACAACCTAGGG - Intronic
954865090 3:53722171-53722193 GAAAGAAAGATGAGCACAAATGG - Intronic
954991293 3:54842931-54842953 GAAGGAAAGAGAACTACCTAGGG + Intronic
955282438 3:57606497-57606519 AAAAGAAAAATGACACCATATGG + Intergenic
955718693 3:61859272-61859294 TAAAGAAAGAAAATAACCTAAGG - Intronic
957100640 3:75822939-75822961 TAAAGAAAGATAACAACAGATGG - Intergenic
957243373 3:77687685-77687707 GAAAAAAAGATGACCTCCAATGG + Intergenic
957522940 3:81344142-81344164 GAAAGAAAAATGTCATCCTGAGG + Intergenic
957900655 3:86484445-86484467 GAAGGAAAGATGAAAAACAAGGG + Intergenic
958855748 3:99383001-99383023 GAAGGAAAGAAGAGAACCTCGGG + Intergenic
959327267 3:104953401-104953423 GAATGAAAGGAGACAACGTACGG - Intergenic
959430203 3:106245023-106245045 AAAATATAGATGACAAACTATGG - Intergenic
959614056 3:108327460-108327482 GAAAGAAAGATGAGAAACAGAGG - Intronic
959768380 3:110061732-110061754 GAAAGATAAATAACAACCTTGGG - Intergenic
960013871 3:112863168-112863190 AACAGAATGAAGACAACCTATGG - Intergenic
960443015 3:117712131-117712153 GAGAGAAAAATGCCACCCTAAGG - Intergenic
961033070 3:123623298-123623320 AAAATAAAGATGGCTACCTAAGG + Intronic
964999338 3:162932653-162932675 GAAACAAAGGTGATAACCAATGG + Intergenic
965026438 3:163307338-163307360 GAAAAAAATATCAAAACCTATGG + Intergenic
965692562 3:171372999-171373021 GAAAGAGAGAAGAGAGCCTAGGG - Intronic
966698491 3:182818932-182818954 GAAAAAAAGAAAAAAACCTAAGG + Intronic
967759661 3:193209291-193209313 GCTAGAAAGATGAGAACCCATGG + Intergenic
967973420 3:195015958-195015980 CAGAGAAAGATGACAGCCCAGGG + Intergenic
1202747333 3_GL000221v1_random:117147-117169 TAAAGAAAGATAACAACAGACGG - Intergenic
968861669 4:3176377-3176399 GAAAGAAAGATGAAAGCATCAGG - Intronic
970392324 4:15626283-15626305 GAAAGAAAGAGAATAACCGACGG + Intronic
971197941 4:24487189-24487211 GAAACAAAGATGACAGCCGAAGG + Intergenic
971655695 4:29341616-29341638 GAGAAAAAGATGACAATCAAGGG - Intergenic
973144477 4:46807453-46807475 CAAAGCAAAATGACAGCCTATGG - Intronic
974351462 4:60752741-60752763 GAAAGAAAAATGATAACTTGGGG + Intergenic
974713345 4:65632496-65632518 GAAACAAAGATAGCAACCTTTGG - Intronic
975219801 4:71801031-71801053 GAAAGTGAAATGACAACCCACGG + Intronic
975425438 4:74220290-74220312 GAAAGAAAGAGAATAACCAAGGG + Intronic
975980472 4:80152856-80152878 GAAATCATGATGACAACTTAGGG - Intergenic
976423085 4:84868222-84868244 GAAAGAAAAAGGAAAACCTCAGG - Intronic
976695133 4:87910882-87910904 GAAAGAAAGGTGAGGACTTAGGG - Intergenic
976723364 4:88192226-88192248 GAAAGAAAAATGACTACAAATGG + Intronic
976906387 4:90241638-90241660 GAAAAAAAAATAACACCCTAAGG - Intronic
976942764 4:90726445-90726467 GAAAAAAAGATGGCATCCTAGGG + Intronic
977420464 4:96793498-96793520 GAAATAAAGAAAACAACTTAAGG - Intergenic
979184484 4:117771632-117771654 GAAAGGTAGATGACAAACTGAGG + Intergenic
980150866 4:129047064-129047086 GAAAGTAAAAAGACAAGCTATGG - Intronic
982118934 4:152120534-152120556 CAAAGAGAAATGAAAACCTATGG - Intergenic
982155911 4:152520506-152520528 GAAAGAAAGAGGACAACTGGAGG - Intronic
982294520 4:153813455-153813477 GAAAAAAAAAAGAAAACCTAGGG + Intergenic
982411524 4:155082931-155082953 GAACGACACATGAGAACCTAGGG + Intergenic
984043404 4:174767033-174767055 GAAAAAGAGATGAAAACATAAGG + Intronic
984996749 4:185439355-185439377 GAAAGGAAGAGGACAAGCAAGGG + Intronic
985011143 4:185583287-185583309 GGAAGAAAGATGACAGGCTTGGG + Intergenic
1202754451 4_GL000008v2_random:46271-46293 TAAAGAAAGATAACAACAGATGG + Intergenic
986187241 5:5455911-5455933 GAAAGCAAGATGACTACTAAAGG - Intronic
986509230 5:8485706-8485728 GAAAGGCAGATGATAACATATGG + Intergenic
987376336 5:17238662-17238684 GAAAAGAAGATGACAAACTAGGG - Intronic
988217232 5:28290733-28290755 GAAAGAATGATGTAAGCCTAGGG - Intergenic
988783424 5:34544012-34544034 AAAAGAAATATGAAAACTTAAGG + Intergenic
989566059 5:42902630-42902652 GAAAGAAAGAAGAAAATGTATGG + Intergenic
990015615 5:51058302-51058324 GAAAGAAAGATGACAAGAAAAGG + Intergenic
991219548 5:64197222-64197244 GAACGAAAGATGAGTCCCTATGG - Intronic
991778107 5:70105424-70105446 TAAAGTAAAATGACAACCTATGG + Intergenic
991857397 5:70980890-70980912 TAAAGTAAAATGACAACCTATGG + Intronic
991870555 5:71105766-71105788 TAAAGTAAAATGACAACCTATGG + Intergenic
992306836 5:75449209-75449231 GACAGAAAAATGACAAACCAAGG + Intronic
993390169 5:87311167-87311189 GAAAAATAGCTGACAAACTATGG + Intronic
994263896 5:97691966-97691988 GAAAGAAACATGATAACTCATGG - Intergenic
994334051 5:98543197-98543219 AGAAGAAAGATGAGAACATATGG + Intergenic
994860215 5:105182808-105182830 AAAAGAATAATGAAAACCTATGG + Intergenic
995097932 5:108261446-108261468 GAAAGAAAGAAGATAAACTTTGG + Intronic
995627778 5:114098094-114098116 GAAAGAAAGATGATGAGCTACGG - Intergenic
995788116 5:115853408-115853430 GAAAGTAAAAAGACAACCTATGG - Intronic
996393621 5:122989931-122989953 GCAAGAAAGATGAGAAATTAGGG - Intronic
997347508 5:133202635-133202657 GAGAGAAAGCAGACATCCTACGG + Intronic
997577083 5:134987987-134988009 AAAAGAAAGATGTAAAGCTATGG + Intronic
997973103 5:138420450-138420472 GAAAGATGGATGACAACAAAAGG + Intronic
998615943 5:143740691-143740713 GAAAGAAAGAGGAAAAACTGAGG - Intergenic
999044124 5:148449177-148449199 GACACAAAGATTACAACATAGGG - Intergenic
999485999 5:151996906-151996928 AAAAGAAAGAAGACAGCCAATGG - Intergenic
1000680770 5:164181494-164181516 GGAAGAAAGATGAAAAGGTAGGG - Intergenic
1001701132 5:173707207-173707229 AAAAGAATGCTGACAACCTCAGG + Intergenic
1001996822 5:176168391-176168413 TACAGAAATATGACAACCAAAGG + Intergenic
1004075101 6:12337789-12337811 GCAAGATGGATGACAGCCTAAGG + Intergenic
1005225541 6:23638057-23638079 AAAAGAACCATGACAAGCTAAGG - Intergenic
1006332835 6:33404704-33404726 CAAAGAAAGATGAGAAAATAAGG - Intronic
1006788116 6:36681254-36681276 GAAAGAAAGAAAAGCACCTAGGG - Intronic
1007881309 6:45170600-45170622 GAAATAAAAATGACTACCAAGGG + Intronic
1008326276 6:50185696-50185718 GAAAGAAAGATGTTTACCTAAGG + Intergenic
1008621231 6:53273441-53273463 GAAAGAGAGATGACTTCCAACGG + Intronic
1009550320 6:65083904-65083926 GAAATATACATGTCAACCTATGG - Intronic
1010022936 6:71182138-71182160 GAAGGAAAGATAAAAATCTAGGG + Intergenic
1010869343 6:81018626-81018648 AAAAGAATGATGACAGCCCAGGG - Intergenic
1011738862 6:90339303-90339325 TAAAGAACCATGACCACCTATGG + Intergenic
1011891743 6:92171837-92171859 GAAAGAAAGAAGACAAAAAAAGG - Intergenic
1012153950 6:95793077-95793099 GAAAGAAACAGGATAACCAAGGG + Intergenic
1012685624 6:102244293-102244315 GAAAAACAGATGACAAAATATGG - Intergenic
1013324207 6:109028131-109028153 GAAAAAAAGTTTACAACCTGGGG - Intronic
1013781487 6:113733360-113733382 GAAAGAGAGAAGAAAAACTATGG + Intergenic
1014544844 6:122722434-122722456 CACAGAAAGATAACAACTTAAGG + Intronic
1014745988 6:125201483-125201505 GAAAAAAAGGTGCAAACCTAAGG - Intronic
1014822274 6:126003822-126003844 AAAAGATAAATGACAAGCTAAGG - Intronic
1017055402 6:150431525-150431547 GAAGGAAAGATGACAATCAGGGG + Intergenic
1017950864 6:159133547-159133569 GAAAGAAAGAAAACGAACTAAGG - Intergenic
1018700317 6:166421265-166421287 CAAAGGAATATCACAACCTAGGG + Intronic
1021494714 7:21261399-21261421 GAAAGAAAAATGAAAGCCTCAGG + Intergenic
1021643801 7:22767844-22767866 GAAAGAAAAACGGCAATCTATGG + Intergenic
1023978363 7:45050785-45050807 CAAAGACAAATGACAAACTAGGG - Intronic
1025745228 7:64237009-64237031 GAAAGAAAGAAAGAAACCTATGG + Intronic
1027664897 7:81033435-81033457 GAAAGAAAGATGAAACAATAGGG - Intergenic
1027900031 7:84101081-84101103 GAAAAAAAAATGACATCATAGGG - Intronic
1027980720 7:85217621-85217643 CAAAGAAACATGACAACAAAAGG - Intergenic
1029232943 7:99086569-99086591 CAAAGAAAAGTGACAACATATGG + Intronic
1029876804 7:103762884-103762906 GAATCAAAGATGACAAACGAGGG + Intronic
1030040978 7:105449599-105449621 AAAAGAAAGTAGACAACCCATGG + Intronic
1031895672 7:127346014-127346036 GAGAGAAAGGGGAAAACCTAAGG + Intergenic
1033153847 7:138939621-138939643 GAAATACAGAGGACCACCTAGGG - Intronic
1034332363 7:150293950-150293972 GAAAGAAAGAAAAAAAACTAAGG + Intronic
1035489480 7:159260577-159260599 GAAAAAAAGATAACCACCTGAGG + Intergenic
1035675924 8:1455446-1455468 GAAAGGAAGATGTCAACATTCGG + Intergenic
1037236620 8:16728004-16728026 AAAAGAAAGATAAAAATCTAGGG + Intergenic
1037236718 8:16728885-16728907 AAAAGAAAGATAAAAATCTAGGG + Intergenic
1037628916 8:20634600-20634622 GAAATAAAGAAGATAACATAAGG + Intergenic
1038304952 8:26391630-26391652 GTAAGAAAAATGACAATCTGGGG - Intronic
1038894695 8:31769422-31769444 GAAAGAAAGTGGACAAGCTGCGG - Intronic
1041433268 8:57808579-57808601 GAAAGAAAGAAAAAATCCTAAGG + Intergenic
1041680087 8:60579925-60579947 GAAACAAAAATGTTAACCTAGGG - Intronic
1042078559 8:65023616-65023638 GAAAGAAAGAAGAGTAACTATGG + Intergenic
1042817144 8:72890045-72890067 GAAATAAAGATGAAAAAATAAGG - Intronic
1043177058 8:77034998-77035020 TTAGGAAAGATGACAACCTGGGG + Intergenic
1043203465 8:77405042-77405064 GACATAAAGATGACACCCTATGG - Intergenic
1043311593 8:78866480-78866502 GAAAGTGAAAAGACAACCTACGG - Intergenic
1043368651 8:79564960-79564982 GAGAGAAGGATGACAACTCAGGG + Intergenic
1044712198 8:95068750-95068772 GAAGGAGAGATGACAGCCTTGGG - Intronic
1046403509 8:113740212-113740234 GAATGAAAGATGATAACATTAGG - Intergenic
1047211084 8:122841075-122841097 GAAAGAAAGACAAGAACCAAGGG - Intronic
1047425476 8:124741670-124741692 GAAAGAAAGGAGAGAACCTGTGG + Intergenic
1048257291 8:132914730-132914752 GAAAGAAAGATCACAGGCTCTGG - Intronic
1049060308 8:140271555-140271577 GAGAGAGAGAAGACAACCAATGG + Intronic
1049080542 8:140440090-140440112 TAAACAAAGATCACAACGTAAGG + Intronic
1050303168 9:4279852-4279874 TAAAGAGATATGACAACCAAAGG + Intronic
1051318529 9:15871802-15871824 AAAAGAAAGATGACAAGAAACGG - Intronic
1051430302 9:16975088-16975110 CAAAGACAGATGACAAACTGAGG + Intergenic
1053340139 9:37319314-37319336 GAAAATAAGAAGACAAACTATGG - Intronic
1055139310 9:72857741-72857763 GAAATAAAGCTGGAAACCTAAGG - Intergenic
1055447873 9:76400813-76400835 GAAAGAAAAATGTCTAGCTAGGG + Intergenic
1056213911 9:84390681-84390703 GAAAGAAAGAAAAGAACTTATGG - Intergenic
1056297051 9:85203463-85203485 GAAGGAAAGATAACAATCTATGG + Intergenic
1056394772 9:86171730-86171752 GAAAATAAAAAGACAACCTATGG - Intergenic
1057089097 9:92240092-92240114 GGAAGAAAGCAGACCACCTAAGG - Intronic
1057994857 9:99812181-99812203 GAAAGACAAATGACAAACTACGG + Intergenic
1058883997 9:109309176-109309198 GAAATGAAGATGACTACTTAGGG + Intronic
1059224796 9:112662096-112662118 AACAGAAAGATTACAACCTCTGG - Exonic
1059489064 9:114652260-114652282 CAAAGAAAGATGTCACCCTGTGG + Intergenic
1059924602 9:119195812-119195834 GAAGGGAATATGACAACCTGTGG + Intronic
1061906043 9:133698956-133698978 GGAAGAGAGATGACAACCACAGG + Intronic
1203756609 Un_GL000218v1:134581-134603 TAAAGAAAGATAACAACAGATGG - Intergenic
1203461806 Un_GL000220v1:47870-47892 GAAAGAATCATGACATGCTATGG - Intergenic
1203715969 Un_KI270742v1:147238-147260 TAAAGAAAGATAACAACAGACGG - Intergenic
1203535244 Un_KI270743v1:30998-31020 TAAAGAAAGATAACAACAGATGG + Intergenic
1203650212 Un_KI270751v1:110803-110825 TAAAGAAAGATAACAACAGATGG - Intergenic
1186840689 X:13482052-13482074 GAGACAAAGATAACAAGCTAAGG + Intergenic
1187221904 X:17335864-17335886 AAAAGAAGCATGACAAACTAGGG - Intergenic
1188077086 X:25791327-25791349 GAAAGAAAAATGACACAGTAGGG + Intergenic
1188195191 X:27224273-27224295 CAAAGAAAGGTGTCATCCTATGG + Intergenic
1188237877 X:27751599-27751621 TCAAGAAAGATGACAACCAGGGG + Intergenic
1194458904 X:94141080-94141102 GAAAGATTGAGGAAAACCTATGG + Intergenic
1196290989 X:113940732-113940754 CAGAGTAAGAAGACAACCTATGG + Intergenic
1196539689 X:116892937-116892959 AAAAGAATGAAGAAAACCTATGG - Intergenic
1197219873 X:123901804-123901826 GAAAGAAAGATGACAATTAAAGG - Intronic
1197711150 X:129669108-129669130 AAAAGAAAAAAGACAACCCATGG - Intergenic
1198659256 X:138949067-138949089 GAAAAAAAGATCACAAACTTTGG - Intronic
1199514202 X:148656998-148657020 GAAAGGAAAAAGAAAACCTATGG - Intronic
1199590934 X:149467988-149468010 AAAAGAAGGATGAAAACCAAAGG + Intergenic
1199676334 X:150192760-150192782 GAATGAAATATGTCAACATATGG - Intergenic
1200268674 X:154660967-154660989 GAAAAAAATATCAAAACCTATGG - Intergenic
1200697139 Y:6370974-6370996 GGAAGAAAGATGACAGTCAACGG + Intergenic
1201036974 Y:9793725-9793747 GGAAGAAAGATGACAGTCAACGG - Intergenic
1201235207 Y:11902736-11902758 GAAAGAAAAATGCCAAAATAAGG - Intergenic