ID: 1141284694

View in Genome Browser
Species Human (GRCh38)
Location 16:82660581-82660603
Sequence AAGATGACAACCTAGGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 125}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141284689_1141284694 3 Left 1141284689 16:82660555-82660577 CCCGAGGCCAGAGATGAAGTGAA 0: 1
1: 0
2: 1
3: 29
4: 297
Right 1141284694 16:82660581-82660603 AAGATGACAACCTAGGGCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 125
1141284690_1141284694 2 Left 1141284690 16:82660556-82660578 CCGAGGCCAGAGATGAAGTGAAA 0: 1
1: 0
2: 1
3: 31
4: 300
Right 1141284694 16:82660581-82660603 AAGATGACAACCTAGGGCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 125
1141284687_1141284694 22 Left 1141284687 16:82660536-82660558 CCTGGCAAAACAGAAACAGCCCG No data
Right 1141284694 16:82660581-82660603 AAGATGACAACCTAGGGCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 125
1141284691_1141284694 -4 Left 1141284691 16:82660562-82660584 CCAGAGATGAAGTGAAAGAAAGA 0: 1
1: 0
2: 5
3: 49
4: 729
Right 1141284694 16:82660581-82660603 AAGATGACAACCTAGGGCCCAGG 0: 1
1: 0
2: 1
3: 11
4: 125

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141284694 Original CRISPR AAGATGACAACCTAGGGCCC AGG Intronic
901039504 1:6355520-6355542 AAGGTGACCACCTGGGGCGCAGG + Intronic
902398222 1:16143861-16143883 GAGCTGACAACCTCAGGCCCTGG + Intronic
906330193 1:44877878-44877900 AAGAAGAGAACCTAGGGCTGGGG - Intronic
907755371 1:57305531-57305553 CAGAAGACAACCAAAGGCCCAGG + Intronic
907927382 1:58967202-58967224 GAGATGAGAACCTACTGCCCAGG - Intergenic
910187144 1:84556415-84556437 AAGATGACCACTTTGGGGCCGGG + Intronic
910447515 1:87313644-87313666 AAGAGTGCAACCTGGGGCCCAGG + Intergenic
911431251 1:97790090-97790112 AAGTTTACAACGTAGGTCCCAGG - Intronic
913595600 1:120373120-120373142 AACATTACAACCTAGGTTCCAGG + Intergenic
914091676 1:144505855-144505877 AACATTACAACCTAGGTTCCAGG - Intergenic
914306869 1:146428005-146428027 AACATTACAACCTAGGTTCCAGG + Intergenic
914595181 1:149144793-149144815 AACATTACAACCTAGGTTCCAGG - Intergenic
917425398 1:174907608-174907630 AAGATGACAACATAGGGGCCAGG - Intronic
917519993 1:175740472-175740494 AAGATGGCAACCTATGGCCATGG + Intronic
917544729 1:175952124-175952146 AAGATGACAAACAAGAGGCCAGG + Intronic
1065063416 10:21932583-21932605 AAGATGCCAACCTAAGGCCTTGG + Intronic
1074209862 10:111320663-111320685 AAGCTGAGAACCTAGGATCCTGG + Intergenic
1077199996 11:1302001-1302023 AAGCTGAGAACCTGGAGCCCAGG + Intronic
1078798858 11:14622869-14622891 AGAATAACAACATAGGGCCCTGG + Intronic
1081161090 11:39749218-39749240 ATGATGATAAACTAGGGGCCTGG - Intergenic
1083327521 11:61880322-61880344 AGCAGGACAACCTGGGGCCCTGG - Intronic
1083396625 11:62396981-62397003 AAGGTGACAATCCAGGGCCAAGG - Intergenic
1084105088 11:66975738-66975760 AAGATGACAACCGAGCTGCCTGG + Intronic
1084445672 11:69202218-69202240 AGGAGGACCACCTAGGGGCCTGG + Intergenic
1086721582 11:90128000-90128022 AAGAGGACAACATAGAGCTCAGG - Intergenic
1088091750 11:106048590-106048612 AAGATAGCAACCTAGGACCAAGG + Intergenic
1089919621 11:122196169-122196191 AAGATGAAAACCTAAGACACTGG - Intergenic
1093449488 12:19298662-19298684 AAGATGACAAGCTTTGGGCCAGG - Intronic
1097715241 12:62959377-62959399 AAGATGACAACCTAAGCCACTGG + Intergenic
1099605585 12:84797820-84797842 AACATGACAAGCAAGGGCCATGG - Intergenic
1104720429 12:131042273-131042295 ATGATGCCAACCAAGGGCTCTGG - Intronic
1104792351 12:131492002-131492024 AAGATGACAGCTCTGGGCCCTGG + Intergenic
1104902526 12:132197176-132197198 AAGATGCCAACTTTGGGCTCCGG - Exonic
1108423226 13:50271685-50271707 AAAATGGCAGCCTAGAGCCCCGG - Intronic
1114645347 14:24252938-24252960 AAGATGACAGCCGCAGGCCCAGG + Intronic
1117403779 14:55381961-55381983 AAGAAAACAACCCAGGGGCCTGG - Exonic
1121510435 14:94509238-94509260 GAGAAGACAACCAAGGGCCAAGG - Intronic
1121554806 14:94828356-94828378 AAGAGGGTAACCTAGGGGCCGGG + Intergenic
1122051324 14:99062455-99062477 AAGATAGGAACCTAGGGTCCAGG + Intergenic
1124239417 15:28017524-28017546 AAGTTGACATCCTAAGACCCTGG + Intronic
1126439793 15:48675156-48675178 AAGATGACCACACAGGGACCAGG - Intergenic
1129424355 15:75453597-75453619 ACTCTGACAACCTAGTGCCCTGG - Intronic
1129473670 15:75768800-75768822 AAGATGACTTCCTAGGAGCCAGG + Intergenic
1129757959 15:78109967-78109989 AAGATGACAGCCCAGGGCACTGG + Intronic
1129947015 15:79547997-79548019 AAGAAGACAACCTAGAGTCGTGG + Intergenic
1131214346 15:90524804-90524826 AAGACGACAACCTGGGATCCGGG + Intergenic
1132232617 15:100195111-100195133 AAGAAGACAACCAAGGGCACGGG + Intronic
1132291137 15:100704655-100704677 AAGATTCCAATCTGGGGCCCAGG - Intergenic
1134683347 16:16141837-16141859 AAGAGGACCATCCAGGGCCCTGG - Exonic
1135385411 16:22035186-22035208 AAGATCACAGCCCAGGGCACAGG - Intronic
1138167035 16:54812409-54812431 GAGATGGCAACCTAGAGCCCAGG - Intergenic
1138347697 16:56330150-56330172 GTGATGACTACCTAGGCCCCCGG + Intronic
1141284694 16:82660581-82660603 AAGATGACAACCTAGGGCCCAGG + Intronic
1142852388 17:2710596-2710618 AAGATGACGACTGAGGGCCTGGG + Intronic
1143329691 17:6124231-6124253 ATGATGACCACCTTGGGCCTTGG + Exonic
1143524869 17:7466184-7466206 AAGAGGACAGCTTTGGGCCCGGG - Exonic
1148571061 17:48669496-48669518 AAGATGACCATCTACGACCCAGG + Intergenic
1152563804 17:81091263-81091285 TCGCTGACAACCTAGGCCCCAGG - Intronic
1155619914 18:27767069-27767091 AAGATGACAGTCTAGGACGCAGG - Intergenic
1157164556 18:45346450-45346472 AAGAAGACAACCCAGGGACCAGG - Intronic
1157518540 18:48328604-48328626 CAGATGGGAACCTGGGGCCCAGG + Intronic
1160143987 18:76349123-76349145 AAGATGACATGCTTGGCCCCCGG - Intergenic
1166181601 19:41112930-41112952 AATTTGACACCCTAGGTCCCAGG - Intergenic
925604289 2:5642475-5642497 AACATTACAACCTAGGTTCCAGG + Intergenic
928828969 2:35455675-35455697 AAGCACACAACCTAGAGCCCTGG - Intergenic
932647587 2:73520494-73520516 AAGAAGACAACCTGGGTCTCTGG - Intronic
934044081 2:88157144-88157166 AAGATTACAAACTGGGGGCCAGG - Intergenic
946959252 2:224966303-224966325 AAGACGACAATCAAGGGCCACGG - Intronic
947277125 2:228405116-228405138 AAGAAGAAAACCTAAGGCCATGG - Intergenic
947717824 2:232350712-232350734 AGGATGTCAACCTAGGGCTCTGG + Intergenic
948495249 2:238344678-238344700 AAGAGGAAAACCTCGGGCTCTGG - Intronic
1172383367 20:34515458-34515480 AACAGGACAACATAGGGCTCTGG + Intergenic
1174898414 20:54474939-54474961 AAGATGGCCACCTAGGTGCCAGG - Intergenic
1177847262 21:26305524-26305546 CTGATGAAAACCTAGGGCTCAGG - Intergenic
1181054589 22:20254684-20254706 AAGAGGAAAACGTGGGGCCCAGG + Intronic
1182415448 22:30218280-30218302 AGGATGCCAACCGAGGGCCTGGG - Intergenic
1183625142 22:38997268-38997290 AAGATGGAAACCCAGGGCCTGGG + Intergenic
1183781723 22:40003243-40003265 AAGAGGACAATCTAGGTCTCTGG - Intronic
1184346142 22:43914478-43914500 TTGATGACAACCTGAGGCCCCGG + Intergenic
1185036015 22:48477279-48477301 TAGTTGACAACCTAGAGTCCTGG - Intergenic
1185413149 22:50696614-50696636 AAGTTGACAGCCGAGGGCCCGGG + Intergenic
953550763 3:43900801-43900823 AAGATGGCCACCTGGGGACCAGG + Intergenic
954258980 3:49425249-49425271 AAGATAACACCCAAGGGCCCTGG + Intronic
958416908 3:93885213-93885235 AACAAGACAACTTAGAGCCCAGG - Intronic
960513275 3:118575763-118575785 AAAATAACAAACCAGGGCCCAGG - Intergenic
961742573 3:129042002-129042024 AAGTTCACAGCCCAGGGCCCAGG + Intergenic
965130504 3:164693285-164693307 AAGATACCAAAATAGGGCCCAGG - Intergenic
966818949 3:183910060-183910082 AAGATGAAGACCTAGAACCCAGG + Intergenic
967989736 3:195121920-195121942 AGGATGACAATGTAGGGTCCAGG - Intronic
968853512 4:3101267-3101289 AAAACCACAACCTAGGGCCATGG - Intronic
969719233 4:8883973-8883995 AATATGACAAGCTAGGGCCTTGG + Intergenic
971828016 4:31652566-31652588 AAGATTACAAACTATGGCTCAGG + Intergenic
971953313 4:33382811-33382833 AAGGTGAAAAACTATGGCCCTGG - Intergenic
973115521 4:46453079-46453101 AAGATGAATACTTGGGGCCCAGG + Intronic
974716852 4:65678925-65678947 AAGAGGCCAACCTAGAGCTCAGG + Intergenic
975730415 4:77332418-77332440 AAGATTAGAAACTATGGCCCAGG + Intronic
976223647 4:82778307-82778329 AAGATGTCACCCCAGGGACCTGG + Intronic
983081123 4:163386844-163386866 AAAATGAAAACATGGGGCCCTGG + Intergenic
985861919 5:2477991-2478013 ATGATGACAAAGCAGGGCCCTGG + Intergenic
985930308 5:3051819-3051841 ATGATGACAACCTAGTTTCCTGG - Intergenic
987897993 5:23973069-23973091 AAGATGACAGGCTAGCGCTCTGG + Intronic
989020428 5:36999181-36999203 AGGATGCCAACCTCTGGCCCAGG - Intronic
989258400 5:39391509-39391531 ACCATGCAAACCTAGGGCCCTGG - Intronic
997449430 5:133969633-133969655 AAGAAGTTCACCTAGGGCCCTGG + Intergenic
998375175 5:141685936-141685958 AAGATGACAACTGGGGACCCTGG - Intergenic
1005889460 6:30124834-30124856 AAGATGAAAAACTATGGCCATGG - Intergenic
1007944594 6:45814299-45814321 AAGTTGACAACCAAGAGCTCTGG + Intergenic
1008028272 6:46663493-46663515 AAGATGACAAACTGGGCCCTGGG - Intronic
1017604061 6:156114346-156114368 AAGATGACATCCTTGGTCTCTGG + Intergenic
1017885356 6:158594971-158594993 AAGTTGAAAACGTAGGGGCCAGG - Intronic
1024322948 7:48088399-48088421 AAGAAGACGACCTAGAGGCCCGG - Intergenic
1024348821 7:48341398-48341420 AAAATGAGGACCTAGAGCCCAGG - Intronic
1026232387 7:68496575-68496597 AAGAGTACAACCCAGGGCCAAGG - Intergenic
1029331537 7:99860445-99860467 AAGAAGCCAAGCTAGGACCCAGG + Intronic
1030884053 7:114917500-114917522 AAGAAGAAAACTTAGGGCGCAGG - Intergenic
1031182694 7:118436961-118436983 AAGATGGCTACCTGGGGGCCAGG - Intergenic
1031938718 7:127764492-127764514 AAGATGGCAGCCTAGGGCAGAGG - Intronic
1036200730 8:6769436-6769458 AAGATGACCACCTAGATCCTGGG - Intergenic
1037273804 8:17156721-17156743 AAGATGGCGCCCTCGGGCCCGGG + Exonic
1040513647 8:48117157-48117179 ATGTTGACAACCTAGGCTCCTGG + Intergenic
1045397510 8:101775614-101775636 AAGATTCCAACCAAGAGCCCTGG + Intronic
1046271738 8:111904961-111904983 AAGTTGACAACCTCAGACCCAGG - Intergenic
1046651923 8:116844934-116844956 AAGATTACAGCCTGGGGCCTAGG + Intronic
1047291651 8:123536763-123536785 ATGATCACAATCTATGGCCCAGG - Intronic
1047444874 8:124910716-124910738 AAGAGGACAACCTGGGCCTCTGG - Intergenic
1050547225 9:6719185-6719207 AACCTGAAAACCCAGGGCCCTGG + Intergenic
1051683003 9:19627142-19627164 AAGATGACAGCCCAGGGTGCAGG + Intronic
1053573863 9:39337795-39337817 AGGATGACAAAAGAGGGCCCAGG + Intergenic
1054095429 9:60896483-60896505 AGGATGACAAAAGAGGGCCCAGG + Intergenic
1054590861 9:67010160-67010182 AGGATGACAAAAGAGGGCCCAGG - Intergenic
1055872883 9:80905292-80905314 AAGATCACAGCCCAGGGCACAGG + Intergenic
1056733585 9:89185716-89185738 AAGATTGCAACCTGGGGCCTTGG + Intergenic
1056991814 9:91420513-91420535 AAGATAACAAGCTGGGGCCTGGG + Intronic
1057138812 9:92714397-92714419 AAAATGAAAACCTGGGGCCTTGG + Exonic
1062198856 9:135289961-135289983 TAGATGGTCACCTAGGGCCCAGG - Intergenic
1189931147 X:46012455-46012477 TAGATGCCAAAGTAGGGCCCTGG - Intergenic
1189946863 X:46188716-46188738 AATATGACAAGGTAGGGCCATGG - Intergenic
1192333669 X:70200124-70200146 ATGATGACAACCTAGTGAACAGG + Intronic