ID: 1141284695

View in Genome Browser
Species Human (GRCh38)
Location 16:82660584-82660606
Sequence ATGACAACCTAGGGCCCAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 109}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141284690_1141284695 5 Left 1141284690 16:82660556-82660578 CCGAGGCCAGAGATGAAGTGAAA 0: 1
1: 0
2: 1
3: 31
4: 300
Right 1141284695 16:82660584-82660606 ATGACAACCTAGGGCCCAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 109
1141284689_1141284695 6 Left 1141284689 16:82660555-82660577 CCCGAGGCCAGAGATGAAGTGAA 0: 1
1: 0
2: 1
3: 29
4: 297
Right 1141284695 16:82660584-82660606 ATGACAACCTAGGGCCCAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 109
1141284691_1141284695 -1 Left 1141284691 16:82660562-82660584 CCAGAGATGAAGTGAAAGAAAGA 0: 1
1: 0
2: 5
3: 49
4: 729
Right 1141284695 16:82660584-82660606 ATGACAACCTAGGGCCCAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 109
1141284687_1141284695 25 Left 1141284687 16:82660536-82660558 CCTGGCAAAACAGAAACAGCCCG No data
Right 1141284695 16:82660584-82660606 ATGACAACCTAGGGCCCAGGAGG 0: 1
1: 0
2: 1
3: 7
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141284695 Original CRISPR ATGACAACCTAGGGCCCAGG AGG Intronic
902398223 1:16143864-16143886 CTGACAACCTCAGGCCCTGGTGG + Intronic
902518013 1:17000223-17000245 GTGAGGAGCTAGGGCCCAGGGGG - Intronic
905018081 1:34791249-34791271 ATGAGAACCGAGGCCCCTGGAGG - Intronic
907188393 1:52629510-52629532 ATGGCAACCAATGGCCCAGGCGG - Intergenic
912474653 1:109927907-109927929 AGGCCCAGCTAGGGCCCAGGAGG - Intronic
916426244 1:164683465-164683487 ATGACAACTGAGGCTCCAGGAGG + Intronic
918783557 1:188733456-188733478 AGGAGAAACTAGGGCACAGGTGG - Intergenic
1063709233 10:8461051-8461073 ATGAAATCCTAGGGGACAGGAGG - Intergenic
1064285238 10:13985731-13985753 ACCACAGCCTAGGGCACAGGAGG + Intronic
1067209734 10:44250015-44250037 CTTAAAACCTAGGGCCCTGGTGG + Intergenic
1067715832 10:48690833-48690855 ATGGCCACCTATGGCCCAGTTGG - Intronic
1072985242 10:100133923-100133945 ATGACAGCCTGGGCACCAGGGGG - Intergenic
1076052789 10:127348603-127348625 AAAACAGCCTAGGGACCAGGTGG - Intronic
1076110372 10:127855383-127855405 CTGGCAACCCAGGGCCCATGGGG + Intergenic
1083396624 11:62396978-62397000 GTGACAATCCAGGGCCAAGGCGG - Intergenic
1083760631 11:64815011-64815033 AGGACCACCTTGAGCCCAGGAGG - Intergenic
1086735702 11:90302744-90302766 CTGGAAACCTAGGGCCCTGGTGG + Intergenic
1088433479 11:109783964-109783986 GTGAGAAACAAGGGCCCAGGAGG - Intergenic
1089185208 11:116610353-116610375 ATGTGCACATAGGGCCCAGGTGG + Intergenic
1089675634 11:120086920-120086942 ATGTCTATGTAGGGCCCAGGCGG - Intergenic
1091301700 11:134512099-134512121 AAGGGAACCTAGGGCCCAAGTGG + Intergenic
1092044873 12:5424156-5424178 AGGACAACCTGGGGTCCAGGAGG + Intergenic
1096543948 12:52324150-52324172 ATCACAGCCTGGAGCCCAGGAGG - Intergenic
1097386566 12:58956823-58956845 ATGACAAATTTGGTCCCAGGTGG - Intergenic
1113143031 13:107175727-107175749 ATGACACCCTTGGGACCTGGGGG + Intronic
1113791716 13:113032656-113032678 AGGATCACCTTGGGCCCAGGAGG - Intronic
1118263057 14:64266336-64266358 ATGAAAACCAAGGGCCAAAGAGG + Intronic
1118837531 14:69487323-69487345 ATGGGAAGCTGGGGCCCAGGGGG - Intronic
1122682460 14:103476160-103476182 CTGACAACCTAAGGCTCAGCAGG - Intronic
1124661107 15:31551758-31551780 GGGACATCCGAGGGCCCAGGTGG - Intronic
1128513472 15:68327573-68327595 ATGACAGCCCTGGCCCCAGGTGG - Intronic
1129757960 15:78109970-78109992 ATGACAGCCCAGGGCACTGGTGG + Intronic
1131853382 15:96566386-96566408 ATGACAACCAGGTGCCCATGTGG - Intergenic
1133327339 16:4949664-4949686 ATTACAATGTAGGGACCAGGTGG - Intronic
1135539769 16:23320919-23320941 ATGACCACCTAAGCCCCAGCCGG + Intronic
1136616542 16:31401902-31401924 ATGACAACACAGGACCCAGGTGG - Intronic
1137368370 16:47881025-47881047 CTGACAACCCAAGGCCCAGCAGG + Intergenic
1141284695 16:82660584-82660606 ATGACAACCTAGGGCCCAGGAGG + Intronic
1141420130 16:83909317-83909339 ATGATAACCTAGGGCCCATCAGG + Intronic
1146662010 17:34671075-34671097 AGGAGATCCAAGGGCCCAGGTGG - Intergenic
1150009345 17:61490084-61490106 ATGACAGCTTAGGGCCCAGGAGG - Intergenic
1150282739 17:63938782-63938804 GTGCCAGCCCAGGGCCCAGGAGG + Exonic
1150742816 17:67793138-67793160 ATGAGAAACTAAGGCACAGGTGG + Intergenic
1152215064 17:79027242-79027264 ATGGCAACCTGTGGCCCATGAGG - Intronic
1153360932 18:4196132-4196154 ATGACAACCCAGTGCCTAGATGG - Intronic
1160041079 18:75346198-75346220 GTGCCATCCTAGGGGCCAGGTGG - Intergenic
1160265121 18:77335543-77335565 ATGACACTATGGGGCCCAGGAGG + Intergenic
1160619484 18:80160649-80160671 ATGACGGCCGAGGGCTCAGGCGG - Intronic
1163643979 19:18478015-18478037 AAGCCAATCAAGGGCCCAGGAGG + Intronic
1165939477 19:39407961-39407983 GTGACAGCTCAGGGCCCAGGCGG - Exonic
925263439 2:2547646-2547668 ATGACATCTTCAGGCCCAGGTGG + Intergenic
926313801 2:11695014-11695036 CTGAAAACCAAGGCCCCAGGTGG + Intronic
927085557 2:19671514-19671536 GTGAAACCCTAGGCCCCAGGTGG - Intergenic
932554205 2:72805134-72805156 TTGACAAACTAGGCACCAGGAGG - Intronic
934714940 2:96537816-96537838 AGGACCCCCGAGGGCCCAGGGGG + Intronic
936015458 2:108955614-108955636 AGGACAATCTTGAGCCCAGGAGG + Intronic
937871530 2:126789532-126789554 TGGACACCCTTGGGCCCAGGTGG + Intergenic
939887913 2:147701312-147701334 ATGACAAGTTATGGCCAAGGTGG - Intergenic
942040219 2:172054082-172054104 ATGAAAACCCAGGGCTCAGTGGG + Intronic
947823578 2:233089212-233089234 ATGACAAGATAGGCCCCAGGTGG - Intronic
948140230 2:235667571-235667593 ATGACAGCCTAGCGCCCATCTGG - Intronic
948229984 2:236342442-236342464 ATGGCCACCTGGGGCCCTGGTGG + Intronic
948374571 2:237512909-237512931 ATCACCACCAAGGGGCCAGGAGG + Intronic
1168829121 20:834622-834644 ATAGCAACCTAGGGGGCAGGGGG - Intronic
1170348646 20:15416082-15416104 ATGACAGCTCAGGCCCCAGGAGG - Intronic
1170377286 20:15713865-15713887 ATGAAATCCAAGGGGCCAGGAGG + Intronic
1172910132 20:38402463-38402485 ATGATAACTTAGGGCAGAGGTGG - Intergenic
1173010279 20:39175933-39175955 AAGGCAACCTGGGGCCCACGGGG - Intergenic
1173418607 20:42880564-42880586 ATTACAGCCCAGGGCCCAGCAGG - Intronic
1181038816 22:20182372-20182394 ACGCCAACCTAGGGCCCCAGGGG + Intergenic
1183168049 22:36162297-36162319 AAGAGAAACTAGGGCACAGGTGG + Intronic
1184102347 22:42347472-42347494 ATGACATCCTGGGGCTCAGTCGG - Intergenic
950052822 3:10005051-10005073 ATGGCAACCTGGGTCCCAGTTGG - Intronic
951674557 3:25222209-25222231 ACTGCAACCTAAGGCCCAGGAGG + Intronic
953810987 3:46112730-46112752 AGGACAACCTCAGGCACAGGTGG - Intergenic
960113415 3:113868434-113868456 ATGACAACCCATGGGACAGGAGG - Intronic
960947701 3:122978199-122978221 AGGGCACCCTGGGGCCCAGGTGG - Intronic
961698056 3:128720058-128720080 ATGACACACTGGGGCCAAGGAGG - Intergenic
961815981 3:129550635-129550657 GTGAAGACCTAGGACCCAGGAGG + Intronic
962457614 3:135579392-135579414 ATGCCACCCTATTGCCCAGGAGG - Intergenic
968500855 4:949218-949240 ATGACAATGAAGGGCCCGGGTGG + Intronic
974160637 4:58133588-58133610 ATGACAACCTATGACTCAGCTGG - Intergenic
978997245 4:115172094-115172116 AAGACAACCTAGGGCATAGGAGG + Intergenic
979943438 4:126793081-126793103 ATAATAACCTAAGCCCCAGGAGG - Intergenic
981846474 4:149175884-149175906 ATGGAAACCCAGGGCCCTGGTGG - Intergenic
985671488 5:1209115-1209137 CTGGCAGCCCAGGGCCCAGGAGG + Intronic
986504138 5:8431061-8431083 ATGAAAACTTAGGGCAAAGGAGG + Intergenic
988212128 5:28217242-28217264 AAGAGAAACTAGGGCACAGGTGG - Intergenic
991016634 5:61940241-61940263 ATGGCAAGCTAGGGCCCTTGTGG - Intergenic
995480310 5:112586360-112586382 CTGGAAACCCAGGGCCCAGGTGG - Intergenic
997295233 5:132764775-132764797 ATGACCACCCTGGTCCCAGGAGG - Intronic
998007578 5:138667067-138667089 GGGAAAACCTAGGGCCCAGTTGG - Intronic
998204883 5:140151229-140151251 ATCACTACCTAGGCCCAAGGTGG - Intergenic
999383374 5:151137407-151137429 ATGACACCCCAGGACTCAGGAGG + Intronic
1006409081 6:33861903-33861925 ATGTCCACATAGGGACCAGGAGG + Intergenic
1008877615 6:56346907-56346929 ATGACACCCAAGAGACCAGGAGG - Intronic
1012958115 6:105592581-105592603 AGGACAACCAAGTGGCCAGGAGG - Intergenic
1016886641 6:148965326-148965348 CTGACAGCCTGGTGCCCAGGAGG + Intronic
1021878719 7:25073056-25073078 ACAACAAACTAAGGCCCAGGTGG - Intergenic
1028296829 7:89143268-89143290 AGGAGAAACTAGGGCACAGGTGG - Intronic
1031412683 7:121458396-121458418 ATGAAAAAATAGGGCCAAGGAGG + Intergenic
1032479011 7:132231819-132231841 AGGACAACCCAGAGGCCAGGAGG + Intronic
1037855997 8:22370951-22370973 ATGCCCACCTAGGGGACAGGAGG + Intronic
1038038796 8:23706998-23707020 AGGTCAACCTAGGGTCCACGGGG + Intergenic
1038530725 8:28316357-28316379 ATCACTACCGAGGGCCCTGGAGG - Intergenic
1051745428 9:20290844-20290866 ATTGCAACCTTGTGCCCAGGAGG + Intergenic
1053751952 9:41266191-41266213 ATGACAGCCTCAGGCGCAGGAGG + Intergenic
1054257475 9:62830521-62830543 ATGACAGCCTCAGGCGCAGGAGG + Intergenic
1054333839 9:63785201-63785223 ATGACAGCCTCAGGCGCAGGAGG - Intergenic
1056284157 9:85071086-85071108 ATGGCATCCTGGGCCCCAGGTGG - Intergenic
1059530202 9:115028441-115028463 AGCACAACCTGGGGCACAGGAGG + Intronic
1062550716 9:137085143-137085165 AAGACCACCTAAGCCCCAGGAGG - Intergenic
1188915501 X:35904984-35905006 ATGGAAACCCAGGGCCCTGGTGG + Intergenic
1192327610 X:70146435-70146457 ATGACAAGTTAGGGCCCAGCAGG - Intronic
1197768789 X:130075939-130075961 ATGCCAAGGGAGGGCCCAGGAGG + Intronic
1198953126 X:142095861-142095883 ATGACAAATTAGGGACCAAGAGG + Intergenic
1200788849 Y:7282125-7282147 ATGACAATCGTGAGCCCAGGAGG + Intergenic
1201986741 Y:19976924-19976946 AGGACAAACTAGTGCACAGGTGG - Intergenic