ID: 1141284696

View in Genome Browser
Species Human (GRCh38)
Location 16:82660585-82660607
Sequence TGACAACCTAGGGCCCAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 153}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141284691_1141284696 0 Left 1141284691 16:82660562-82660584 CCAGAGATGAAGTGAAAGAAAGA 0: 1
1: 0
2: 5
3: 49
4: 729
Right 1141284696 16:82660585-82660607 TGACAACCTAGGGCCCAGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 153
1141284690_1141284696 6 Left 1141284690 16:82660556-82660578 CCGAGGCCAGAGATGAAGTGAAA 0: 1
1: 0
2: 1
3: 31
4: 300
Right 1141284696 16:82660585-82660607 TGACAACCTAGGGCCCAGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 153
1141284687_1141284696 26 Left 1141284687 16:82660536-82660558 CCTGGCAAAACAGAAACAGCCCG No data
Right 1141284696 16:82660585-82660607 TGACAACCTAGGGCCCAGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 153
1141284689_1141284696 7 Left 1141284689 16:82660555-82660577 CCCGAGGCCAGAGATGAAGTGAA 0: 1
1: 0
2: 1
3: 29
4: 297
Right 1141284696 16:82660585-82660607 TGACAACCTAGGGCCCAGGAGGG 0: 1
1: 0
2: 0
3: 12
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141284696 Original CRISPR TGACAACCTAGGGCCCAGGA GGG Intronic
900095163 1:937257-937279 TCACAGCCCAGGGCCCAGGGAGG - Intronic
900558560 1:3292139-3292161 TGACAACCTTGGGCACGTGACGG + Intronic
903019475 1:20383970-20383992 TGCTAATCTGGGGCCCAGGAAGG - Intergenic
905109410 1:35584401-35584423 TTAAAACCTAGGGCCCAGGCTGG - Intronic
907319339 1:53592980-53593002 TGACATTGTAGGGGCCAGGAAGG - Intronic
907406543 1:54257066-54257088 AGTCCACCTAGGGCCAAGGATGG + Intronic
908440639 1:64150416-64150438 TGACAAACTGGAGCCCAGGGTGG - Intronic
912474652 1:109927906-109927928 GGCCCAGCTAGGGCCCAGGAGGG - Intronic
914091675 1:144505851-144505873 TTACAACCTAGGTTCCAGGTAGG - Intergenic
914306870 1:146428009-146428031 TTACAACCTAGGTTCCAGGTAGG + Intergenic
914595180 1:149144789-149144811 TTACAACCTAGGTTCCAGGTAGG - Intergenic
915459180 1:156059575-156059597 TGACAGCCCAGGGCCTGGGATGG - Intergenic
916335496 1:163666398-163666420 TGACCACTTAGGTCCTAGGATGG + Intergenic
916735338 1:167602340-167602362 TGACAACCTTACTCCCAGGAAGG + Intergenic
917361714 1:174183772-174183794 AGACAAACTAGGGTCCAGGGAGG - Intronic
920709045 1:208277553-208277575 TGACCACCTAGGACACAGGTAGG + Intergenic
921043726 1:211459301-211459323 TGAGAACCTTGGACACAGGAAGG + Intergenic
921564755 1:216703379-216703401 TTCCAACATATGGCCCAGGACGG - Intronic
923806915 1:237267595-237267617 TGAGGATCTAGGGCCCAGAAAGG - Intronic
1064285240 10:13985732-13985754 CCACAGCCTAGGGCACAGGAGGG + Intronic
1066345965 10:34587035-34587057 TGACATCCTAATGCCCAGCATGG + Intronic
1069034231 10:63630559-63630581 TTACAACCTAGGTCCCCGGGAGG + Intergenic
1070706195 10:78640633-78640655 TGAAAATCCAGGGCCCAGAAAGG - Intergenic
1074447225 10:113530526-113530548 GCACAACCCAGTGCCCAGGAAGG + Intergenic
1075777217 10:124996728-124996750 AGACCACCGAGGCCCCAGGAGGG + Intronic
1077115325 11:881656-881678 TGACCACGTCGGGCTCAGGATGG + Intronic
1077309943 11:1883823-1883845 AGAGAACCTGGGGCTCAGGAAGG + Intronic
1081910610 11:46697551-46697573 TCACAGCCAAGGGCCCTGGATGG + Intronic
1083327519 11:61880318-61880340 GGACAACCTGGGGCCCTGGGAGG - Intronic
1083396623 11:62396977-62396999 TGACAATCCAGGGCCAAGGCGGG - Intergenic
1083764134 11:64834019-64834041 TGAGGAACTAGGGTCCAGGAGGG + Intronic
1085054256 11:73394774-73394796 TGACAGCCTGGGGGCCGGGAGGG + Intronic
1086432375 11:86748195-86748217 TTATAACCAAGTGCCCAGGATGG - Intergenic
1088585049 11:111354413-111354435 GGACAAACTGGGGCCCAGGTAGG + Exonic
1089326194 11:117659038-117659060 AGACTACCTAGGAACCAGGAAGG - Intronic
1090596138 11:128323075-128323097 TGATACCCCAGAGCCCAGGAAGG - Intergenic
1092044874 12:5424157-5424179 GGACAACCTGGGGTCCAGGAGGG + Intergenic
1095922178 12:47542555-47542577 TGAGAAGCAAGGGGCCAGGATGG + Intergenic
1096487540 12:51993915-51993937 TGAGAGCCTAGGGACCAGAAAGG + Intronic
1096543947 12:52324149-52324171 TCACAGCCTGGAGCCCAGGAGGG - Intergenic
1108702250 13:52953571-52953593 TGGAGAACTAGGGCCCAGGATGG - Intergenic
1110613692 13:77517690-77517712 TGATAACGTAAGGCCCAGCATGG + Intergenic
1114083280 14:19219621-19219643 TGAGCACCTATGGTCCAGGAAGG - Intergenic
1115764965 14:36614118-36614140 TGAAAACCTAGTGCGGAGGAAGG + Intergenic
1122415485 14:101547657-101547679 TGACACCCCCGGCCCCAGGAAGG - Intergenic
1122960029 14:105090048-105090070 AGGCAAGCTGGGGCCCAGGAGGG + Intergenic
1202894898 14_GL000194v1_random:1391-1413 TGAACACCTAGGGTCCAGGAAGG - Intergenic
1124661106 15:31551757-31551779 GGACATCCGAGGGCCCAGGTGGG - Intronic
1127553053 15:60060177-60060199 TGAGAACCTTGAGCCCTGGAGGG + Intronic
1133979387 16:10622240-10622262 CAACAACCCAGGGCCCAGCAGGG + Intergenic
1134846116 16:17442167-17442189 TGGCAAGCTGGGTCCCAGGAGGG - Intronic
1135800298 16:25488431-25488453 TGGCAACCTATTGCCCTGGAGGG + Intergenic
1136616541 16:31401901-31401923 TGACAACACAGGACCCAGGTGGG - Intronic
1137433292 16:48435496-48435518 TGGAAACCTGGGACCCAGGAAGG + Intronic
1140102436 16:71929288-71929310 TCACCACCCATGGCCCAGGATGG - Exonic
1140904329 16:79397668-79397690 TGATAACACAGGGTCCAGGAAGG - Intergenic
1141284696 16:82660585-82660607 TGACAACCTAGGGCCCAGGAGGG + Intronic
1141634206 16:85305079-85305101 GGACAAGCTGCGGCCCAGGATGG - Intergenic
1142672884 17:1495434-1495456 AGACAGCCTGAGGCCCAGGACGG + Exonic
1145062125 17:19739971-19739993 TGACAAACTCGGGGCCAAGAGGG + Intronic
1147258406 17:39195452-39195474 TGCCAACCCAGGGCCCAGCCTGG + Intronic
1148737868 17:49874823-49874845 TGAGAAGCTGAGGCCCAGGAAGG + Intergenic
1150282740 17:63938783-63938805 TGCCAGCCCAGGGCCCAGGAGGG + Exonic
1151546251 17:74795119-74795141 CGCCAACCTGGGGGCCAGGAGGG - Intronic
1152215063 17:79027241-79027263 TGGCAACCTGTGGCCCATGAGGG - Intronic
1154407475 18:14107571-14107593 TGCCAACTTAGGTCCCAGCATGG + Intronic
1156485568 18:37463604-37463626 TGGCATCGTAGGGTCCAGGAGGG - Intronic
1157518542 18:48328608-48328630 TGGGAACCTGGGGCCCAGGGAGG + Intronic
1157564976 18:48673724-48673746 GGCCAACCTGTGGCCCAGGATGG + Intronic
1160041078 18:75346197-75346219 TGCCATCCTAGGGGCCAGGTGGG - Intergenic
1160155771 18:76432755-76432777 TGACAGTCTGGGGCCCAGGCAGG + Intronic
1160760013 19:779117-779139 TGAAAACCATGTGCCCAGGAGGG - Intergenic
1162043721 19:7985427-7985449 TGACATCCTGGGTCCCGGGATGG - Intronic
1165939476 19:39407960-39407982 TGACAGCTCAGGGCCCAGGCGGG - Exonic
925604290 2:5642479-5642501 TTACAACCTAGGTTCCAGGTAGG + Intergenic
927085556 2:19671513-19671535 TGAAACCCTAGGCCCCAGGTGGG - Intergenic
929515015 2:42599071-42599093 TGACAGCTCAGGGCTCAGGACGG + Intronic
935622410 2:105141749-105141771 TGACAACCTCAGGCTGAGGAAGG - Intergenic
937346491 2:121129371-121129393 TTCCTACCTGGGGCCCAGGAGGG - Intergenic
937385588 2:121429029-121429051 ATACAACCTAGGCCACAGGAAGG + Intronic
938493302 2:131777010-131777032 TGAGCACCTATGGTCCAGGAAGG + Intergenic
938548945 2:132361718-132361740 TGACAGCCTCAGGCGCAGGAGGG - Intergenic
941046670 2:160683768-160683790 AGAGAACCGAAGGCCCAGGAAGG + Intergenic
941269488 2:163407820-163407842 TGTCAACCTGAGGCACAGGAGGG - Intergenic
946485998 2:220101338-220101360 TGGCAACCAAGGCCCAAGGAGGG + Intergenic
947436647 2:230078595-230078617 TAACTCCCTAGGGACCAGGATGG + Intergenic
947823577 2:233089211-233089233 TGACAAGATAGGCCCCAGGTGGG - Intronic
1169477997 20:5949948-5949970 TGGCACCCTAGGGCCAAGAATGG + Intronic
1170377287 20:15713866-15713888 TGAAATCCAAGGGGCCAGGAGGG + Intronic
1174174398 20:48635884-48635906 GCACAACCTGGGGCCCAGGGAGG - Intronic
1174520577 20:51127221-51127243 TGAGAAGTCAGGGCCCAGGAAGG + Intergenic
1176027928 20:62995538-62995560 TGACAGTCTAGGGCACAGGGAGG + Intergenic
1176614601 21:9017378-9017400 TGAACACCTAGGGTCCAGGAAGG - Intergenic
1179987391 21:44929268-44929290 TGCCACACTAGGGCCCAGAAGGG - Intronic
1180183514 21:46128452-46128474 TGTCCACCCAGTGCCCAGGAGGG - Intronic
1180294694 22:10873646-10873668 TGAGCACCTATGGTCCAGGAAGG + Intergenic
1180497500 22:15903060-15903082 TGAGCACCTATGGTCCAGGAAGG + Intergenic
1180698683 22:17770079-17770101 TGGCAACCCAGGGCCAGGGAAGG - Intronic
1180723484 22:17927096-17927118 TGACAACCATGGGCTGAGGAAGG - Intronic
1181025299 22:20124293-20124315 TGTCTACCAAGGGCCCATGATGG - Intronic
1185160955 22:49229579-49229601 AGAGAACGTAGGGCCCTGGAGGG - Intergenic
1185206482 22:49541819-49541841 TGGCAGCCTAGGGGTCAGGACGG - Intronic
1185241405 22:49749474-49749496 TGAGAACCCAGGGCCCAGGCTGG - Intergenic
949727697 3:7069352-7069374 TGCCAACCTGGAGCCCAGAAGGG + Intronic
954320798 3:49830862-49830884 TGACAACCAAGGCTCCAGGAAGG + Intronic
954645802 3:52130851-52130873 CCTCAACCTAGGGCCCAGCATGG + Intronic
955486151 3:59436814-59436836 AGACAATCTAGGGATCAGGAGGG - Intergenic
959935230 3:112022216-112022238 TGACAACCTAGGGCCTCTGATGG + Intergenic
960113414 3:113868433-113868455 TGACAACCCATGGGACAGGAGGG - Intronic
962407942 3:135116377-135116399 TGAGAAGCTAGGGACCAAGATGG - Intronic
963235766 3:142953996-142954018 TGACCACCCAGGCCTCAGGAAGG - Intronic
966013386 3:175110507-175110529 TGACAACTTATGGCCAAAGAGGG + Intronic
967294205 3:187949498-187949520 TGATAGCCTAGGACTCAGGAGGG + Intergenic
967989735 3:195121916-195121938 TGACAATGTAGGGTCCAGGCTGG - Intronic
969039837 4:4287603-4287625 AGAAAACCTAAGGCTCAGGAGGG + Intronic
976239712 4:82942263-82942285 TGACAAACTAGGGTGAAGGAGGG + Intronic
979943437 4:126793080-126793102 TAATAACCTAAGCCCCAGGAGGG - Intergenic
982994028 4:162317741-162317763 TGCCAACCCTGGGCCAAGGAGGG - Intergenic
983486338 4:168335327-168335349 TCCCAACCTGTGGCCCAGGATGG - Intergenic
984913515 4:184698900-184698922 TGAAAACCTAAGGCACAGGGAGG - Intronic
985199579 4:187470918-187470940 TGACAAGTTGGGGCCGAGGAAGG + Intergenic
985671489 5:1209116-1209138 TGGCAGCCCAGGGCCCAGGAGGG + Intronic
985671507 5:1209194-1209216 CGAGAGCCCAGGGCCCAGGAGGG + Intronic
987638391 5:20577552-20577574 TGAACACTTAGGGTCCAGGAAGG + Intergenic
990728025 5:58777785-58777807 TGAGAACCTTGGACACAGGAAGG - Intronic
990794703 5:59526326-59526348 TGACAACTAAGGGACCATGAAGG + Intronic
991075138 5:62527471-62527493 TTACAATCTAGGGCAGAGGATGG - Intronic
993408736 5:87547785-87547807 TGACAAACTAGGGCATTGGAAGG - Intergenic
996868855 5:128162861-128162883 GGACTACATATGGCCCAGGATGG + Intronic
997295232 5:132764774-132764796 TGACCACCCTGGTCCCAGGAGGG - Intronic
997404704 5:133636027-133636049 TTATAACCCAGGGCCCAGGTCGG + Intergenic
999225636 5:150021447-150021469 GTCCAACCTATGGCCCAGGATGG + Intronic
1001641881 5:173250170-173250192 TGCCAGCCTGGGGCCCAGGATGG - Intergenic
1007277454 6:40685636-40685658 TGGAAACCAAGGCCCCAGGAGGG - Intergenic
1008877614 6:56346906-56346928 TGACACCCAAGAGACCAGGAGGG - Intronic
1017937027 6:159014841-159014863 TGACAACCCAGGCACCAGGCAGG - Intergenic
1018629200 6:165807525-165807547 TGAGAGCCTGGGGGCCAGGATGG + Intronic
1024217546 7:47260224-47260246 TGACAACCTAAAGCCAGGGAAGG - Intergenic
1024417958 7:49129960-49129982 TGAGAAGCGAGGGTCCAGGAAGG - Intergenic
1029151956 7:98486589-98486611 TGAGGAACTGGGGCCCAGGATGG + Intergenic
1030973479 7:116090917-116090939 TGAGAACATAGGGCACAGGGAGG + Intronic
1032479012 7:132231820-132231842 GGACAACCCAGAGGCCAGGAGGG + Intronic
1034436384 7:151064598-151064620 AGACACCCCAGGGCCCAGGACGG + Exonic
1035589473 8:802065-802087 TGAGGACGGAGGGCCCAGGAGGG - Intergenic
1037791764 8:21950013-21950035 ACACAGCCTAGGGCCCAGTACGG - Intronic
1037855998 8:22370952-22370974 TGCCCACCTAGGGGACAGGAGGG + Intronic
1038151946 8:24949877-24949899 TGCAAAGCTAGGACCCAGGATGG + Intergenic
1039314194 8:36353639-36353661 TAACAACCTAGAGGCCAGAAGGG - Intergenic
1039494645 8:37971810-37971832 TGAAAACCTGAGGCCCAGGCTGG + Intergenic
1041274832 8:56146341-56146363 TGAGAACCTTGGACACAGGAAGG - Intergenic
1043428378 8:80171247-80171269 TGGCATCCTGGGGCCCTGGAAGG - Intronic
1049575561 8:143388274-143388296 TGACAGCCCAGAGCCCAGCATGG - Intergenic
1050585290 9:7104408-7104430 GGACAGCCTGGGGCCCTGGAAGG + Intergenic
1051972831 9:22911763-22911785 TGACAACATAGGTTACAGGAGGG + Intergenic
1052734892 9:32331614-32331636 AGACAACAGAGGGACCAGGAAGG + Intergenic
1053751953 9:41266192-41266214 TGACAGCCTCAGGCGCAGGAGGG + Intergenic
1054257476 9:62830522-62830544 TGACAGCCTCAGGCGCAGGAGGG + Intergenic
1054333838 9:63785200-63785222 TGACAGCCTCAGGCGCAGGAGGG - Intergenic
1059530203 9:115028442-115028464 GCACAACCTGGGGCACAGGAGGG + Intronic
1062025416 9:134338078-134338100 AGACGACGTAGGGCTCAGGAAGG + Intronic
1062266251 9:135687778-135687800 TGACACCCTAGGCTCCAGGGAGG + Intergenic
1187458803 X:19466914-19466936 GGACCACATATGGCCCAGGATGG + Intronic
1190046036 X:47112233-47112255 TGTCAACCTAGGGAGCAAGATGG + Intergenic
1192327609 X:70146434-70146456 TGACAAGTTAGGGCCCAGCAGGG - Intronic
1195131854 X:101861174-101861196 AGTCAACCTAATGCCCAGGATGG + Intergenic
1198853633 X:140992805-140992827 TGACAACCGTGGGTCCTGGAAGG - Intergenic