ID: 1141287473

View in Genome Browser
Species Human (GRCh38)
Location 16:82685913-82685935
Sequence TGGCCGCCACCCACATATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 68
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 63}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141287467_1141287473 18 Left 1141287467 16:82685872-82685894 CCTCTTTTTGATACGTGGTTTTC 0: 1
1: 0
2: 1
3: 19
4: 257
Right 1141287473 16:82685913-82685935 TGGCCGCCACCCACATATCATGG 0: 1
1: 0
2: 0
3: 4
4: 63

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141287473 Original CRISPR TGGCCGCCACCCACATATCA TGG Intronic
905332771 1:37218494-37218516 TGGCCTCCACTAACATAACAAGG - Intergenic
906564689 1:46790587-46790609 TGGCAGCCACCCACATTTTTAGG - Intronic
913160394 1:116139943-116139965 GGGCAGCCACCCACAGACCAAGG + Intergenic
913999896 1:143684593-143684615 TGACTGCCACCCACCTACCAAGG - Intergenic
918371705 1:183867702-183867724 TGGCCCCCACCCCCGCATCATGG - Intronic
1067437948 10:46292088-46292110 TTTCCTCCACCCACATATAAAGG - Exonic
1068688100 10:59889752-59889774 TGGGCAGCACCCACATCTCAAGG + Intronic
1076390491 10:130097474-130097496 TGCCCACCACCAACATATGAGGG - Intergenic
1079386001 11:19980251-19980273 CCGCCTCCACCCACCTATCATGG + Intronic
1085464593 11:76715302-76715324 TAGCACCCACCCACATCTCAGGG + Intergenic
1089063834 11:115646992-115647014 TGGCCCCCACCCACAGCCCAAGG - Intergenic
1089877656 11:121741257-121741279 TGGCTTCCACCTACATCTCAAGG - Intergenic
1101326282 12:103718537-103718559 AGGCTGCCACCAACATTTCAAGG + Intronic
1104062839 12:125282488-125282510 TGGCCTGCACACACATCTCATGG + Intronic
1114612710 14:24052797-24052819 TACCCACCACCCACACATCAAGG + Intronic
1122331287 14:100916305-100916327 TGAACGCCAGCCACATTTCAAGG - Intergenic
1127943412 15:63724896-63724918 AGGCTGCCACTCACATCTCAGGG + Intronic
1136067379 16:27768199-27768221 TGGCTTCCAACCACATGTCAGGG - Intronic
1141287473 16:82685913-82685935 TGGCCGCCACCCACATATCATGG + Intronic
1144467889 17:15511088-15511110 AGGCAGCCACCCACAGGTCATGG + Intronic
1152163656 17:78686486-78686508 TGGCCGCCCACCACAGGTCAGGG - Intronic
1152503141 17:80726362-80726384 TGCTCGCCGCCCACAGATCACGG + Intronic
1157959302 18:52134506-52134528 TGGCCTACACCCACAAATGAAGG + Intergenic
1160722725 19:604486-604508 TTGACCCCACCCAGATATCACGG - Intronic
1168454139 19:56492361-56492383 TGACCCCAACCCACATATTAAGG - Intergenic
938592600 2:132753786-132753808 TGCATGCCACCCAAATATCAAGG - Intronic
941634902 2:167925992-167926014 TGGCAGCCAGCCACATAGCCTGG + Intergenic
942998781 2:182298474-182298496 TGTCCCCATCCCACATATCATGG - Intronic
948771329 2:240252663-240252685 TGGCCGCCACCCACCCAGCTGGG - Intergenic
948822555 2:240557484-240557506 GGGCCGCCACCCACAGGTCCCGG + Intronic
1169827243 20:9782523-9782545 TGCCTGCCACCCACATGTCACGG - Intronic
1173978433 20:47204847-47204869 TAGCTGCCACCTTCATATCAGGG - Intergenic
1174625108 20:51907735-51907757 TGGCCGCCCCCCACAAATTCTGG - Intergenic
1174675440 20:52349839-52349861 TGGCCTACAGCCTCATATCAAGG - Intergenic
1179645028 21:42770447-42770469 TGTCCCCCACCCTCATCTCACGG + Intronic
1183311435 22:37112055-37112077 TGCCCCCCACGCACATGTCAGGG - Intergenic
1184664151 22:45978607-45978629 GGGCAGCCACCCCCATTTCACGG + Intergenic
950464324 3:13144373-13144395 TGGCAGCCACCCACATCAGAGGG + Intergenic
953923835 3:46970422-46970444 TGGCCGGTAGCCACATTTCAAGG + Intronic
961808364 3:129505679-129505701 TGGCAGCCACCAACATCTCAAGG + Intronic
962193462 3:133335980-133336002 TAGCCGACACCCACCCATCAAGG + Intronic
962445014 3:135456302-135456324 TGGCCGGCCCCCATAAATCACGG + Intergenic
976478169 4:85508850-85508872 TGTCCTCCACCCACATTCCAAGG + Intronic
999728342 5:154455624-154455646 TGGCAGCCAACCACCTGTCATGG - Intronic
1001775559 5:174326784-174326806 TGCCAGCCACCTGCATATCAAGG + Intergenic
1002172193 5:177381568-177381590 TGGCCAGCACCCACATTTAAGGG - Intronic
1003375483 6:5572894-5572916 TGGCCATCATCCACATATCATGG + Intronic
1003977459 6:11357425-11357447 TGGCCACAACCCAGATCTCAAGG + Intronic
1016986329 6:149898394-149898416 GGGCCCCCACCTACATATCAAGG - Intergenic
1021777453 7:24067609-24067631 TGGCCGTCACCCATGTTTCATGG - Intergenic
1032003602 7:128282675-128282697 TGGCCGCCACACACAGCTCCTGG + Intergenic
1033609601 7:142953178-142953200 TGGTAGCCACCCAGGTATCAGGG + Intronic
1034420938 7:150990351-150990373 TGACAGCCACCCAGAGATCATGG + Intergenic
1048781159 8:138003547-138003569 GGGTCCCCACCCAGATATCATGG + Intergenic
1051150388 9:14073143-14073165 TGGCCGCTGCCCACACATCCAGG + Intergenic
1051581270 9:18677959-18677981 TGGCAGCTACCCACTGATCAAGG + Intronic
1051824841 9:21209572-21209594 TGGCTGCCATCCACATCTCCAGG + Intronic
1051826837 9:21231649-21231671 TGGCTGCCATCCACATCTCCAGG + Intronic
1052016520 9:23474681-23474703 AGGCCTCCACACACATATTAAGG - Intergenic
1057142676 9:92737065-92737087 TGCCCACCACCCCCATCTCAGGG + Intronic
1058214436 9:102216495-102216517 TGGCAGCCACCTACACACCAAGG + Intergenic
1059087150 9:111316455-111316477 TGGTGGCCACCCACATTTCTTGG - Intergenic
1060593831 9:124836081-124836103 GGCCCACCACCCACACATCAAGG + Intergenic
1062322090 9:135995077-135995099 TGGCCGCCACCCCCAGGTCCTGG + Intergenic
1187499807 X:19830457-19830479 TGGCCCCCACCCACTTATTTTGG - Intronic
1189861097 X:45273384-45273406 TGGCCGACACCCCTATAACAAGG + Intergenic
1190063494 X:47225222-47225244 TGCCTGTCACCCACATATCCAGG + Intronic
1199357284 X:146876501-146876523 TGGCCTCCTCCCAAATCTCATGG - Intergenic