ID: 1141291581

View in Genome Browser
Species Human (GRCh38)
Location 16:82722773-82722795
Sequence CAAGATGCTCACAGGGTACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 214
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 196}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1141291572_1141291581 27 Left 1141291572 16:82722723-82722745 CCTAGTTCTCCTGCAGGAAGTTC 0: 1
1: 0
2: 2
3: 17
4: 165
Right 1141291581 16:82722773-82722795 CAAGATGCTCACAGGGTACCAGG 0: 1
1: 0
2: 1
3: 16
4: 196
1141291574_1141291581 18 Left 1141291574 16:82722732-82722754 CCTGCAGGAAGTTCAGGAGTGAA 0: 1
1: 0
2: 1
3: 21
4: 231
Right 1141291581 16:82722773-82722795 CAAGATGCTCACAGGGTACCAGG 0: 1
1: 0
2: 1
3: 16
4: 196

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1141291581 Original CRISPR CAAGATGCTCACAGGGTACC AGG Intronic
900148354 1:1167862-1167884 TAAGATGCTCACAGGGGCCCGGG - Intergenic
900613256 1:3553288-3553310 CGCCAGGCTCACAGGGTACCCGG - Intronic
900695454 1:4006688-4006710 ACAGCTGCTCACAGGTTACCTGG + Intergenic
905715463 1:40145622-40145644 CAAAATGTTCCCAGGGTCCCAGG + Intergenic
907573526 1:55505675-55505697 CTATCTGCTCACAGGGTACAGGG + Intergenic
907707984 1:56849211-56849233 CAAAAAGCTCGCAGGGTATCGGG + Intergenic
908660536 1:66430717-66430739 CAAGAAGCTCAAAGGACACCTGG - Intergenic
909053029 1:70790383-70790405 CAAAATGCCCACAGGGTACAAGG - Intergenic
911168203 1:94743943-94743965 ACAGATGCTCCCAGGGTCCCTGG + Intergenic
912842016 1:113047212-113047234 GAAAATGCTCACAGGATAGCAGG + Intergenic
913533461 1:119749498-119749520 CAACATGCACACAGGCTCCCGGG + Intronic
916070038 1:161164728-161164750 CAAGATGCTCCCAGTGTGTCGGG + Intronic
916787515 1:168097177-168097199 CATGAAGATCACAGGGAACCGGG - Exonic
920340172 1:205270711-205270733 TCAGATGCTCTCTGGGTACCAGG - Intronic
920699044 1:208203957-208203979 CAAGAAGCTCACAGTTTTCCTGG + Intronic
921347609 1:214203172-214203194 CGAGCTGCTCCCAGGGTCCCAGG - Intergenic
923018227 1:230143199-230143221 CCAGATGCTCACAGGGAATGGGG - Intronic
924278648 1:242413418-242413440 CAAGATGTTCACAGACTAGCAGG + Intronic
1063073678 10:2692425-2692447 CCAGGCGCTCACAGGGTCCCTGG + Intergenic
1066651230 10:37656991-37657013 CAAGAAGCTCAAAGAGCACCTGG - Intergenic
1067801255 10:49361008-49361030 CTAGGTGCTTCCAGGGTACCAGG + Intergenic
1067834973 10:49632820-49632842 CATGAGGCCCACAGGGTTCCAGG + Intronic
1068932999 10:62610749-62610771 GAAGACGCCCACAAGGTACCTGG + Intronic
1074904745 10:117851870-117851892 CAAGATGCACACACAGCACCAGG + Intergenic
1074990431 10:118701103-118701125 CAAGGTGCTCACAGCTCACCGGG + Intronic
1075259781 10:120953239-120953261 CAAGAAGCTCATGGGGTACCAGG - Intergenic
1076366703 10:129925983-129926005 CAAGATGCTCTAAAGGTATCAGG - Intronic
1076778691 10:132711886-132711908 CCAGAGGCTCAGAGGGTACCAGG - Intronic
1077308890 11:1879848-1879870 CCAGATCCTCACAGGGCCCCAGG + Intronic
1081732511 11:45381474-45381496 CAAGATGCTGACAGGCCAGCAGG + Intergenic
1081739320 11:45427067-45427089 CAAGCTGCTAACATGGTGCCTGG - Intergenic
1083664128 11:64265492-64265514 CCAGACACTCACAGGGCACCTGG - Exonic
1084967296 11:72751448-72751470 CAAGATCATCACAGGGTAGAAGG - Intronic
1085724200 11:78940545-78940567 CAAGAGGCTGACAGGGCAGCAGG + Intronic
1089414611 11:118277039-118277061 CAATATGCTAACATGGGACCAGG + Intergenic
1090130324 11:124135270-124135292 CAAGATGCTGACAGGGATCTGGG + Intronic
1090411897 11:126515045-126515067 AAAGATGCTCCCAGGAGACCCGG + Intronic
1091568337 12:1663282-1663304 CACGATCCTCACAGGGGACAGGG - Intergenic
1091897661 12:4118042-4118064 CAGGGTGTTCACAGGGTACCAGG - Intergenic
1095600906 12:44012297-44012319 CACGATGCTCACAGAACACCAGG - Intronic
1096242255 12:49965764-49965786 CACGATCTCCACAGGGTACCAGG + Intergenic
1098457442 12:70690894-70690916 CAAAAAGCTCAGAGTGTACCAGG - Intronic
1098518775 12:71410838-71410860 CAAGAAGCTCAAAGAATACCTGG + Intronic
1103208706 12:119150960-119150982 CAAGATGCTCCCAGAGTAGTGGG + Intronic
1103980789 12:124735877-124735899 CAACATGCTCCCAGAGTATCTGG - Intergenic
1104034915 12:125091553-125091575 CAGGATGCTCACAGGGCAAGGGG - Intronic
1105840567 13:24250403-24250425 CAAAGTGCTCACTGGATACCCGG - Intronic
1106088046 13:26560590-26560612 CAAGATGTTCATAGTCTACCAGG + Intronic
1108209710 13:48125769-48125791 CAAGATGCTTACTGGCCACCTGG - Intergenic
1110340776 13:74387756-74387778 CAAGAAGCTCAAAGGACACCTGG - Intergenic
1112012110 13:95301296-95301318 CAAGATGCTGCCCGTGTACCAGG - Exonic
1112121563 13:96418095-96418117 CACCATGCTGACAGGGTGCCCGG - Intronic
1114033530 14:18597654-18597676 CAAGAAGCTCACAGTGCAACAGG - Intergenic
1114078317 14:19176854-19176876 CAAGAAGCTCACAGTGCAACAGG - Intergenic
1114125171 14:19717697-19717719 CAAGAAGCTCACAGTGCAACAGG + Intergenic
1116044736 14:39730972-39730994 CAAGAAGCTCAAAAAGTACCAGG - Intergenic
1117182361 14:53203813-53203835 CAAGAAGCTCAGAGAGCACCTGG + Intergenic
1118326326 14:64783869-64783891 CAAGATGATCACAGTGGTCCAGG - Intronic
1119549039 14:75494727-75494749 CATGATGCCCAAAGGGTCCCTGG + Intergenic
1119617637 14:76109371-76109393 CAAGGTACTCACAGGGTGTCTGG - Intergenic
1120189378 14:81426516-81426538 GAAGATGCTCAGTGGGCACCAGG - Intronic
1121503324 14:94457534-94457556 CAAGATGCTCAAAGAACACCTGG - Intergenic
1122455907 14:101851108-101851130 CAAGGTGCTCCCAGGGTCCTGGG - Intronic
1125606843 15:40944308-40944330 CAAGGTGCTCACAAGGGGCCTGG - Intergenic
1127416108 15:58758731-58758753 CATGATCCTGACATGGTACCAGG + Intergenic
1127573817 15:60271180-60271202 CAAGAAGCTCAAAGAATACCCGG - Intergenic
1128086227 15:64888548-64888570 CAAGAAGCTCGCAGGCTGCCAGG + Intronic
1129129353 15:73478899-73478921 CAAGATCATCACAGGATACAAGG - Intronic
1131574392 15:93572040-93572062 CAAGATGTTCAGAGAGTACACGG - Intergenic
1135877669 16:26218267-26218289 CCAGATGCTTGCAGAGTACCTGG + Intergenic
1136556776 16:31011539-31011561 CAAGGAGGTCACTGGGTACCTGG - Intergenic
1136568545 16:31083778-31083800 CCAGCTGCTGACAGGGGACCTGG - Exonic
1140194248 16:72843906-72843928 CAGGAAGTTAACAGGGTACCAGG - Intronic
1141291581 16:82722773-82722795 CAAGATGCTCACAGGGTACCAGG + Intronic
1142002670 16:87672316-87672338 CAAGATGGTCCCAGGCTAACGGG + Intronic
1142317435 16:89356950-89356972 CAAGATGGTCACAGGTCACTTGG - Intronic
1142750876 17:1986863-1986885 CACAATGCTCACAGGCTTCCAGG + Intronic
1147054207 17:37821746-37821768 CAAGGAGCTCACAGTGTACTGGG - Intergenic
1147911225 17:43857409-43857431 GAAGATGCTCACATGGCTCCTGG - Intronic
1148344919 17:46896857-46896879 CTAGATGCCCTCAGGGTCCCAGG - Intergenic
1149643299 17:58219159-58219181 CAAGTTGCGCACGGGGTCCCGGG + Exonic
1152217489 17:79042277-79042299 CAAGCCGCTCACAGGGTGGCAGG + Intronic
1152482273 17:80562422-80562444 AAAGATGCTCACTGTGTACTGGG - Intronic
1152553492 17:81041271-81041293 CAGGATGCTCCCAGGGTCCCTGG + Intronic
1155802887 18:30131282-30131304 CAAGCTGAGCACAGGGTGCCCGG + Intergenic
1158097788 18:53793979-53794001 CAAGAAGCTCAAAGAATACCTGG + Intergenic
1159298141 18:66523452-66523474 GAAGATGTTCACAGGTTGCCTGG + Intronic
1160012184 18:75114480-75114502 CAAAAGCCTCACTGGGTACCAGG - Intergenic
1162304021 19:9860611-9860633 CCAGCTGCCCCCAGGGTACCTGG + Intronic
1164526146 19:29015031-29015053 CAAGATGCTGCCAGTGTAGCTGG + Intergenic
1165032049 19:33005039-33005061 TAAGGGGCTCACAGGGGACCAGG + Intronic
1165459814 19:35937622-35937644 CAAGAGTGTCAAAGGGTACCTGG - Intronic
1167334410 19:48875682-48875704 CAAGCTGCTCCCAGGGGCCCTGG - Exonic
925346497 2:3175564-3175586 CAAGATGCACATAAGGTGCCTGG - Intergenic
930633744 2:53782624-53782646 GAAGATGCTCAAAGGCTTCCAGG - Intronic
935691982 2:105740386-105740408 CAAGTAGCTCACAGGGGAACTGG + Intergenic
938097641 2:128474047-128474069 CAAGATGCCCACATGGTCCCTGG + Intergenic
939118353 2:138087656-138087678 CAAAATGCTCACAGACTGCCAGG + Intergenic
939198446 2:139003021-139003043 CAAGATGGTCACAGATTAGCTGG - Intergenic
940016905 2:149116314-149116336 CAAGATGCTCACTGGATGCCTGG - Intronic
940073101 2:149711431-149711453 GAAGATTCTCACAGGGTTCTGGG - Intergenic
940753727 2:157658119-157658141 CAGGATTCTTACAGGGTTCCAGG + Intergenic
943319666 2:186432110-186432132 CCAGATGCAGACAGGGCACCTGG + Intergenic
945250282 2:207760146-207760168 CATGAGGCTCACAGGCTAACAGG + Intronic
948450502 2:238067588-238067610 CATGTCGCCCACAGGGTACCTGG - Intronic
949034155 2:241808911-241808933 CCTGATGCTCAGAGGGTAACTGG - Intronic
1168855583 20:1005443-1005465 CAAGATGCTCAGAGGGTGTTTGG + Intergenic
1170759112 20:19234215-19234237 TAACAAGCTCACAGGGGACCTGG - Intronic
1172407981 20:34703755-34703777 CCAGATGCTCCCCGGGAACCGGG + Intronic
1172409876 20:34713020-34713042 CAAGTTGCTCAGAGGGTTCCAGG - Exonic
1173297919 20:41775668-41775690 CAAGACACTTACAGGGTACCTGG + Intergenic
1175413911 20:58788924-58788946 CAAGATGGTAACTGGGTACCTGG - Intergenic
1175510855 20:59525162-59525184 CAAGAAGCTCAGAGAGCACCAGG - Intergenic
1175545421 20:59775026-59775048 GCAGATGCTCACAGGGTCCTTGG + Intronic
1175727220 20:61327089-61327111 CACAATGCTCACAGGATCCCAGG - Intronic
1175762545 20:61571394-61571416 CTTGATGCCCAGAGGGTACCTGG + Intronic
1175801004 20:61800965-61800987 CAAGATGCTTGGAGGGTCCCAGG - Intronic
1178896830 21:36565702-36565724 CAATTTGCTCTCAGGGTACTGGG - Intronic
1180034174 21:45234826-45234848 GAAGAGGCTCACAGGGAAGCGGG - Intergenic
1180457644 22:15524713-15524735 CAAGAAGCTCACAGTGCAACAGG - Intergenic
1180839208 22:18950996-18951018 AGAGCTGCTCACAGGGCACCCGG - Intergenic
1180972322 22:19822031-19822053 AAAGAGGCACACAGGGTCCCGGG + Intronic
1181062683 22:20289460-20289482 AGAGCTGCTCACAGGGCACCGGG + Intergenic
1181876849 22:25946181-25946203 GAAGGTGCTCACAGCGGACCTGG + Exonic
1182755186 22:32673490-32673512 CAAGAAGCTCACTGTGTACTAGG + Intronic
1182996356 22:34816549-34816571 CAAGATGATAAGAGGTTACCTGG + Intergenic
1183702900 22:39459803-39459825 GAGGATGCACACAGGGTGCCTGG + Intronic
1185065035 22:48627911-48627933 CCAGATGCTCCCAGGTGACCCGG + Intronic
950372901 3:12546126-12546148 CAAGAAGCTCACAGACTAACGGG - Intronic
953576190 3:44114798-44114820 CTAGATGGTCCCAGGGTCCCTGG + Intergenic
954259013 3:49425381-49425403 CAGGTTGCTCACAGGGCACTGGG + Exonic
955410944 3:58654896-58654918 AAAGTTGCTCACATGGTGCCTGG - Intronic
961018219 3:123483221-123483243 CAAGATTCTCACAGGCCTCCAGG - Intergenic
967050791 3:185782747-185782769 CATGAAACTCACAGGGTACAAGG + Intronic
968873633 4:3254039-3254061 CAAGATGCTCACAGGGCAGCCGG + Intronic
971858291 4:32071752-32071774 CAAAATGCTCCCAGGCCACCTGG + Intergenic
975061982 4:70014686-70014708 CAAGAAGCTCAAAGAGCACCTGG - Intergenic
975484654 4:74922253-74922275 CAAAATGCTTACAGAGTAGCAGG + Intergenic
975771314 4:77725903-77725925 TAAAATGCTCACTAGGTACCAGG - Intronic
977549461 4:98424871-98424893 CAAGAAGCTCAAAGAATACCTGG + Intronic
982087520 4:151851252-151851274 CAAGAAGCTCACAGGCTAAGGGG - Intergenic
984266505 4:177503955-177503977 CAAGAAGCACAAAGGATACCTGG - Intergenic
985941161 5:3137379-3137401 CTGGATGCTCACAGGGCACATGG - Intergenic
986115609 5:4770889-4770911 CAAGGTGCTCAATGGGAACCTGG - Intergenic
986600220 5:9465643-9465665 GAAGATGCTCACAGGTTATATGG + Intronic
987335972 5:16898128-16898150 CAAGCAGCTCACAGGGCCCCAGG + Intronic
988528153 5:32004232-32004254 CCAGGTGCCCACAGGGTGCCAGG + Intronic
992263235 5:74991541-74991563 CAAGATGCACACACAGTAGCAGG - Intergenic
994660564 5:102648921-102648943 GAAGATGCTCTCAGGGATCCAGG + Intergenic
995914799 5:117232035-117232057 CAAGATGCTTTCAGAGTACAAGG + Intergenic
996678482 5:126203475-126203497 CAAGATGCTCAAAGAACACCTGG + Intergenic
997420537 5:133763535-133763557 GCAGATGCTCACAGGGAGCCAGG - Intergenic
998733137 5:145104072-145104094 AAAGATGCTCACACAATACCTGG - Intergenic
999403786 5:151288452-151288474 TAAGAAGCTGACAGTGTACCTGG + Exonic
999538609 5:152547316-152547338 CAAGATGCCCAAAGGGGAACTGG + Intergenic
1001018834 5:168165581-168165603 AAAGAGGCTCACAGGGTCCCCGG + Intronic
1001299239 5:170522129-170522151 CAAGATGACCACATAGTACCTGG - Intronic
1002571154 5:180140063-180140085 CAGGAGGCTCCCAGGGGACCTGG + Intronic
1003336871 6:5181623-5181645 GAATCTGCTCACAGGGGACCTGG - Intronic
1004021515 6:11780069-11780091 CAAGATGCTGACAGAGTGCCTGG + Intronic
1006068318 6:31478385-31478407 CCAGATGGTGACAGGGTCCCAGG - Intergenic
1006192621 6:32218982-32219004 TAAGATGCTCAGACAGTACCTGG + Intronic
1007494040 6:42246997-42247019 CAAGATGCTCACAGTCTACTGGG + Intronic
1008528474 6:52432710-52432732 CAAGAAGCTCAAAGAATACCTGG - Intronic
1010479724 6:76336867-76336889 CAAGAAGCTCAAAGAATACCTGG - Intergenic
1011241378 6:85274853-85274875 CAAGATCCTCAAAGTCTACCTGG + Intergenic
1012421873 6:99074691-99074713 CAGGAGGCTCAGAGGATACCGGG + Intergenic
1014547595 6:122751406-122751428 CAAGATGCACCCACAGTACCTGG - Intergenic
1015222297 6:130817902-130817924 CAAGAAGCTCACAGAACACCTGG + Intergenic
1018472177 6:164106755-164106777 CAGGATGCTCCCAGGGCCCCTGG - Intergenic
1018681980 6:166271949-166271971 CAAGAGGCCCACAGGAGACCTGG + Intergenic
1019123257 6:169822314-169822336 CAAGAAGCTCAGAGAATACCTGG - Intergenic
1019522720 7:1467970-1467992 CAAGAGGCCCAGAGGGTCCCAGG + Intergenic
1021508687 7:21411948-21411970 CAAGAAGCCCACAGGGAAGCTGG - Intergenic
1022533373 7:31080743-31080765 TAAGAGGCTCACTGGGTATCAGG + Intronic
1023864054 7:44230461-44230483 CAAGAGGCCCCCAGGGCACCAGG - Intronic
1024665472 7:51542877-51542899 CAAGAAGCTCAAAGAATACCTGG - Intergenic
1027707018 7:81548329-81548351 GAAGATGCTCTCAGGGCACTTGG + Intergenic
1028262973 7:88686746-88686768 CAAGTTCCTCCCAGGGCACCTGG - Intergenic
1028937825 7:96485893-96485915 CAACATGTTCACAGTGTACATGG + Intronic
1031475097 7:122211645-122211667 CAACATTCTCACAAGGGACCTGG - Intergenic
1032803044 7:135331750-135331772 CAAGATGTTCAGAGGCTAACAGG + Intergenic
1037995912 8:23352324-23352346 CCAGATGGTCACGGGGTAGCTGG - Intronic
1040087143 8:43355923-43355945 CCTGTTGCTCACAGTGTACCAGG - Intergenic
1043496793 8:80810148-80810170 CCTCATGCCCACAGGGTACCAGG + Intronic
1044518234 8:93165652-93165674 CAAGATGCTAGCAGAGTGCCTGG + Intronic
1045499652 8:102735341-102735363 GAAGATGCTCACTGTGTCCCAGG - Intergenic
1049086332 8:140481179-140481201 CAAGATGCTCAAAGAACACCTGG + Intergenic
1049221964 8:141432532-141432554 CAAGAGGCTCACAGTCTAGCAGG + Intergenic
1049404056 8:142443800-142443822 CAAGGTGCCCCCAGGGTCCCTGG + Intergenic
1052253747 9:26428951-26428973 CAAGATGCTCAGAGAATACCTGG + Intergenic
1054462108 9:65470943-65470965 CAAGTGGGTCACAGGGTACCAGG + Intergenic
1057381640 9:94572595-94572617 CAAGTTGCTCACAGTCTAGCTGG - Intronic
1058694364 9:107546991-107547013 CCAGATGCTCAAATGGTGCCTGG - Intergenic
1059168855 9:112105421-112105443 CAAAAAACTCACAGGGGACCGGG + Intronic
1061678484 9:132231254-132231276 CCAGACACTCACAGGGTGCCAGG + Intronic
1061889606 9:133610944-133610966 CAAGATACTCACAGGGGGCAGGG - Intergenic
1185762185 X:2697078-2697100 GAAAATGCCCACAGGGTACATGG + Intronic
1186742126 X:12529615-12529637 CAAGATACTCACAGTCTGCCTGG + Intronic
1187109140 X:16278129-16278151 CAAGAAGCTCAAAGGACACCTGG - Intergenic
1187268804 X:17761385-17761407 CAGGATGCTCACAGTCTATCTGG + Intergenic
1187320672 X:18234941-18234963 CAGGATGCTCACAGTCTATCTGG - Intergenic
1189600004 X:42614312-42614334 CAAGAAGCTCAAAGAGCACCTGG - Intergenic
1190070249 X:47273527-47273549 CAGGTTGCTCACAGGGCACTGGG + Intergenic
1192494359 X:71605101-71605123 GAAGAGGCTCACAGTCTACCGGG - Intronic
1192609796 X:72555889-72555911 CAAGAAGCTCAAAGAATACCTGG + Intronic
1192817762 X:74612785-74612807 CAAGAAGGTCAGAGGGGACCAGG + Intronic
1196122105 X:112062321-112062343 CAAGAAGCTTACAGTGTACTTGG + Intronic
1196852076 X:119947277-119947299 CAGGCTGCTCCCAGGATACCTGG - Intergenic
1198943142 X:141981037-141981059 CAAGAAGCTCAAAGAATACCTGG - Intergenic
1199793600 X:151176354-151176376 CATGATGCTTGCAAGGTACCTGG + Intergenic
1202038298 Y:20657611-20657633 CAAGAAGCTCAAAGGATTCCTGG + Intergenic
1202332748 Y:23771401-23771423 CAAAATGGTTACAGGTTACCTGG - Intergenic
1202538021 Y:25898662-25898684 CAAAATGGTTACAGGTTACCTGG + Intergenic